ID: 972265716

View in Genome Browser
Species Human (GRCh38)
Location 4:37457315-37457337
Sequence GTTTTCAGTTGACCACAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972265715_972265716 -8 Left 972265715 4:37457300-37457322 CCTTTCTTTTTTATTGTTTTCAG 0: 1
1: 0
2: 20
3: 465
4: 5903
Right 972265716 4:37457315-37457337 GTTTTCAGTTGACCACAACATGG 0: 1
1: 0
2: 0
3: 14
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972265716 Original CRISPR GTTTTCAGTTGACCACAACA TGG Intronic
902132163 1:14271394-14271416 GATTTCAGTTAATCACAACTGGG - Intergenic
908337100 1:63137678-63137700 GTTTTCAGATGACCACCTCAAGG + Intergenic
909758770 1:79263093-79263115 GTTTTCATTTGTCTCCAACAAGG - Intergenic
909843463 1:80359592-80359614 TTTTTCAGTCTACCACAACCTGG - Intergenic
910407632 1:86906649-86906671 GTTTTCAGTTGCTCTCTACATGG - Intronic
911455218 1:98113820-98113842 GTTTTCTGTTGGCCATCACATGG - Intergenic
915058893 1:153163161-153163183 GCTTCCAGATGATCACAACATGG + Intergenic
917646628 1:177034978-177035000 CCTTTCAGATGATCACAACAGGG + Intronic
917767147 1:178233400-178233422 CTTTTCACTGGACCACACCATGG - Intronic
918429393 1:184443501-184443523 GGTTTCAGGAGCCCACAACAGGG - Intronic
923959116 1:239056918-239056940 ATTTTCTGTTGACCAAAATACGG + Intergenic
1063873042 10:10440239-10440261 ATTTTCAGATGCCCCCAACATGG - Intergenic
1065885008 10:30069102-30069124 TTTTTCCGTTGACCACAGCCTGG + Intronic
1072302734 10:94077230-94077252 ATTTTCAGTTGTCAACAACTGGG + Intronic
1073814402 10:107190329-107190351 GTTTTCAGTTGTTTTCAACAGGG + Intergenic
1080270822 11:30449078-30449100 ATTTTAAGTTTACCACAGCAGGG + Intronic
1082014080 11:47471310-47471332 CTTTGCAGTTCACCACAGCAAGG - Intronic
1082596068 11:55084107-55084129 TTTCTCAATTGACCACAACGAGG + Intergenic
1089313833 11:117577279-117577301 GTGTTCAATTCAACACAACATGG + Intronic
1090777832 11:129980635-129980657 TTTATTATTTGACCACAACAAGG + Intronic
1091315840 11:134613497-134613519 GTTCTCAGTAGGCCACATCAGGG + Intergenic
1093121448 12:15276255-15276277 TATTTCAGTTGGCCACAAGATGG + Intronic
1099692226 12:85971318-85971340 TTTTTCAGTTGTCCAAACCAAGG - Exonic
1101095833 12:101339783-101339805 ATTTTAAGTTGACCATTACAAGG + Intronic
1101659090 12:106750136-106750158 GTTTTAAGTTAACCATAACAAGG + Intronic
1109813531 13:67547496-67547518 GGAATCAGTTGACCACAGCAGGG + Intergenic
1110570956 13:77002896-77002918 ATTTGCAGTTGACCAAAACTTGG - Intronic
1110591379 13:77265514-77265536 GTTTTAAGTTCATCAAAACAAGG + Intronic
1111264128 13:85784897-85784919 GTTTGGAGATGACCACAACAAGG + Intergenic
1116848007 14:49882547-49882569 GGTTTCACTTGAACACCACAGGG - Intergenic
1119972495 14:78987220-78987242 GTTCTCAGACGACCACAACCTGG - Intronic
1120714133 14:87822112-87822134 GTTTTCTGTTGGCCACATCTAGG + Intergenic
1120982390 14:90301741-90301763 GTATTCAGTTGATCACTAGATGG + Intronic
1121961373 14:98263221-98263243 GTTTTCAGTGAGCCACGACAGGG + Intergenic
1122346291 14:101062723-101062745 GTGTTCAGTTGACTACAAATTGG + Intergenic
1123203479 14:106691137-106691159 GTTTTCGCTTGACCAGATCAGGG + Intergenic
1124840157 15:33234092-33234114 GCTTTCAGTTGGCCACGAGAGGG + Intergenic
1126201479 15:45991822-45991844 GTTTTAATTTGAACAGAACAGGG - Intergenic
1127879668 15:63145629-63145651 GTTTTCAGTTTCTCACCACATGG + Intronic
1128535576 15:68487408-68487430 GGTTTCAGTTGACCTCAGAATGG + Intergenic
1131367869 15:91854455-91854477 GTTTTCAGGTGACCTGCACATGG + Intronic
1132199973 15:99944617-99944639 GTTTTTAGTTGATCCCAACTGGG + Intergenic
1133603208 16:7360304-7360326 GTTTTCAGTTGACCACAGTTTGG - Intronic
1137855919 16:51794634-51794656 ATTGTCAGGTGACCAAAACAAGG + Intergenic
1140395546 16:74623435-74623457 TTATTCAGTTGAACACAAGAGGG - Exonic
1147649971 17:42056272-42056294 TTTTTCAGTTGAGCACACCAAGG + Intronic
1155580015 18:27293386-27293408 GTTTTCAGCTGTGCACTACAAGG + Intergenic
1158140085 18:54246222-54246244 GTTCACTGTTTACCACAACATGG - Intergenic
1159092780 18:63868628-63868650 GTTTTCACTTCTACACAACAAGG + Intergenic
1162243803 19:9381848-9381870 GTTTCCAGGTGACCATAACAGGG - Exonic
925740016 2:6996919-6996941 GTTCTGCGATGACCACAACAAGG + Exonic
926530321 2:14036806-14036828 GTTTTCAGTTTAATACAACAGGG + Intergenic
927176393 2:20411813-20411835 GTTTTCAGCTGACCCCAGCTGGG + Intergenic
927812908 2:26190060-26190082 GTTTTCAGATGACCAGAGTAGGG - Intergenic
929324880 2:40597374-40597396 TTTTTCATTTAACAACAACATGG - Intronic
929479193 2:42286866-42286888 GTTTTGAATTGATGACAACATGG + Intronic
930296379 2:49559771-49559793 GTTTTGAGGTGAACAAAACATGG - Intergenic
930851110 2:55961496-55961518 CTTTCCATTTGACCACAAGAGGG - Intergenic
935802083 2:106707836-106707858 TTTTTAGGTTGACAACAACATGG - Intergenic
939211474 2:139180759-139180781 GTTTTCAATTCACCACAAATGGG + Intergenic
944920363 2:204406464-204406486 GATTTCAGATGACTAAAACAGGG - Intergenic
947205522 2:227657805-227657827 GTTCTTAATTGAACACAACATGG + Intergenic
1169340534 20:4793106-4793128 GTAATAAGTTGGCCACAACAAGG + Intronic
1170357449 20:15507853-15507875 GCTTCCTATTGACCACAACAGGG - Intronic
1173202552 20:40964894-40964916 GATTTCAGCTGACCACTCCATGG + Intergenic
1173300168 20:41795368-41795390 GTTTTCAGTTGCACACAGGACGG - Intergenic
1175123140 20:56731944-56731966 GTTTTCAGCTGAGCATAGCAAGG + Intergenic
1179265112 21:39796208-39796230 GTGGCCAGTTGACCACAACAAGG - Intronic
1179602246 21:42487197-42487219 GTTTGCAGTTGTCCACATCATGG - Intronic
1184028804 22:41878638-41878660 GTTTTCATTTGAAATCAACAGGG + Intronic
949852023 3:8429306-8429328 GTCTTCAGTTGTCCAGAACTTGG - Intergenic
951289029 3:20853185-20853207 GTTCAAAGTTGACCAAAACATGG - Intergenic
952051031 3:29384868-29384890 TTTTTCATTTAACCAGAACAAGG - Intronic
953954293 3:47218901-47218923 GTCTTCAATAGACAACAACAAGG - Intergenic
958476122 3:94585534-94585556 GTTGTCTGTTGACCACTACTAGG + Intergenic
959387202 3:105725401-105725423 ATTTTCAGTTGACTCCAACATGG - Intronic
961114969 3:124321575-124321597 GATTTCAGTTAATCACAGCATGG + Intronic
963818642 3:149863212-149863234 GTTTATAGTTGAACACAACCTGG - Intronic
966629657 3:182058422-182058444 GCTTTCAGATGACCACACCTTGG - Intergenic
967697817 3:192553865-192553887 GTTTTCAGTGGTCCCCAACCTGG - Intronic
969184106 4:5462850-5462872 GTTCCCAGTTGACAACCACAAGG + Intronic
972153517 4:36126757-36126779 GTTGTCAGTCTACCAGAACAAGG - Intronic
972265716 4:37457315-37457337 GTTTTCAGTTGACCACAACATGG + Intronic
975645156 4:76538542-76538564 GTTTGCAGATGACTACAACAAGG + Intronic
976347341 4:84019731-84019753 GTTTTCAGTAGACTACAAGCAGG + Intergenic
977217896 4:94304548-94304570 ATTTTCACCTGACCACAAGATGG + Intronic
977738363 4:100445016-100445038 GTTTTGAGTTGATCCCAACTAGG + Intronic
978999078 4:115195439-115195461 GGTGTCAGTTGACCTCTACAAGG - Intergenic
981311902 4:143305680-143305702 GTTTGCAGTTGAGCCCAACCTGG + Intergenic
981654430 4:147097205-147097227 GTCTTCAATTGACCACTAGATGG - Intergenic
983943491 4:173561128-173561150 GTTTTCAGTTCACCAAATAAAGG + Intergenic
986327588 5:6688068-6688090 TTTTTCAGTTGACCACAGTTGGG - Intergenic
987181207 5:15370344-15370366 GTTTTAAGTTGATCACAGCCAGG + Intergenic
991763991 5:69954876-69954898 GGTGTCAGTGGACCACATCAGGG + Intergenic
991783334 5:70163259-70163281 GGTGTCAGTGGACCACATCAGGG - Intergenic
991843223 5:70829946-70829968 GGTGTCAGTGGACCACATCAGGG + Intergenic
991875778 5:71163595-71163617 GGTGTCAGTGGACCACATCAGGG - Intergenic
993811312 5:92480754-92480776 GTTTTTTGTTTATCACAACATGG - Intergenic
999670599 5:153956129-153956151 ATTTTCAGTAGACCACAGGAGGG + Intergenic
1003196741 6:3921368-3921390 GTTTTCAGTTCACAGCAAGATGG - Intergenic
1006067528 6:31472799-31472821 GTTTTCAGATGATCAAAACTGGG + Intergenic
1010895673 6:81359777-81359799 GCTCACAGTTGACCCCAACATGG - Intergenic
1012931775 6:105324894-105324916 GTTTTAAGGTTACCATAACAGGG + Intronic
1015231229 6:130917167-130917189 GTGTGCAGTTGTCCACAGCAGGG + Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1019048590 6:169166794-169166816 AATTTCAGTTCATCACAACAAGG + Intergenic
1020326443 7:6978172-6978194 GTTCTCAGGGGACCAGAACAAGG - Intergenic
1021199880 7:17716878-17716900 GTTTCCAATTCACCAAAACAAGG + Intergenic
1021461735 7:20895401-20895423 ATTTTCAGTTGCCTACAACTTGG - Intergenic
1023189240 7:37561636-37561658 GTTTTCAGCTGTCCACAGCCAGG - Intergenic
1028860974 7:95650074-95650096 GTGTTCAGTCCACCACAACCAGG + Intergenic
1030346767 7:108442492-108442514 GTATTCTGTTGTCCAGAACAGGG + Intronic
1030917440 7:115333178-115333200 GTCTTCAGTTGTCCACAAACTGG + Intergenic
1031836968 7:126690580-126690602 GCTTCTAGTAGACCACAACATGG + Intronic
1031952629 7:127908071-127908093 GTTTTGAGTTGTCCATAAGATGG + Intronic
1034052985 7:148002928-148002950 GTTTACAGTTGAACACAAAAAGG + Intronic
1036796851 8:11762363-11762385 GTTTTCAGATGAACACAAAAAGG + Exonic
1038136953 8:24796642-24796664 GTGTTCACTTTACCACACCAGGG + Intergenic
1039967217 8:42292193-42292215 GTCTCCACTTGACTACAACATGG - Intronic
1041669052 8:60474992-60475014 GGTTTCAGCTGACGACAACCTGG - Intergenic
1046441572 8:114262075-114262097 GTTTCAAGTTGACCACAATGAGG + Intergenic
1056011930 9:82341248-82341270 GTTGACATTTCACCACAACATGG + Intergenic
1056266649 9:84903470-84903492 GTTATGAGATGACCATAACATGG - Intronic
1058108760 9:101005960-101005982 GTTTTCAGCATACTACAACAAGG - Intergenic
1058161820 9:101578524-101578546 GGTTTCACTTGACCACAGCAAGG - Intronic
1059039752 9:110799913-110799935 GTTTTTTGTTGACAACACCATGG - Intronic
1061737801 9:132674221-132674243 GTTTCCAGTTGACCACTATTAGG - Intronic
1186488787 X:9954868-9954890 GCTTTCAGCTCACCACATCAAGG - Intergenic
1189683993 X:43544792-43544814 GTTTTCCCTTGACCCCTACATGG - Intergenic
1192734529 X:73836626-73836648 CTTTTCAGTTGACAAGAGCAAGG - Intergenic
1194698559 X:97085889-97085911 GTTTTCAGTTGATCAGAAGTAGG + Intronic
1194845782 X:98807557-98807579 GTTTTCAGGAAACCACAGCAAGG - Intergenic
1195373722 X:104204761-104204783 GTTTTCAGTTTCCCAGAAGAGGG + Intergenic
1197426415 X:126302391-126302413 AGTTCCAGTTGACCACCACAAGG + Intergenic
1201784912 Y:17764665-17764687 GTTTTCATTTCACCATAGCATGG + Intergenic
1201816640 Y:18141322-18141344 GTTTTCATTTCACCATAGCATGG - Intergenic