ID: 972270523

View in Genome Browser
Species Human (GRCh38)
Location 4:37506856-37506878
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 2, 1: 7, 2: 11, 3: 31, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972270519_972270523 14 Left 972270519 4:37506819-37506841 CCTGATGTTTCTTTATTGATTTT 0: 2
1: 10
2: 61
3: 158
4: 1341
Right 972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG 0: 2
1: 7
2: 11
3: 31
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900380101 1:2379642-2379664 TGGCCACGGCTGACAGTGGGTGG + Intronic
901668355 1:10839090-10839112 TGTGCAAAGCTGAATGTGGCAGG + Intergenic
902296839 1:15473380-15473402 TTTCCAATCCTGAAAGCGGCTGG + Intronic
905674532 1:39816443-39816465 TGACCAAGGCTGAATGGGGGTGG + Intergenic
906594281 1:47060618-47060640 TGTCTAATACTGACAGTGGAGGG - Intergenic
910603579 1:89057908-89057930 TTTTCAATGCTGAAACTAGGTGG + Intronic
910877142 1:91887694-91887716 TCTCCAATTCTGCAATTGGGTGG - Intronic
911584477 1:99674789-99674811 TGAACAATCCAGAAAGTGGGAGG + Intronic
911783386 1:101912260-101912282 TGTGCAAAGCTGAAAGTGCAAGG + Intronic
915181833 1:154068382-154068404 TGTAGAAAGCTGAAACTGGGTGG + Intronic
915776945 1:158500772-158500794 TCACCAGTGCTGAAGGTGGGAGG - Intergenic
916287543 1:163126911-163126933 TGTCAGATGCTGGAAGAGGGTGG + Intronic
916468538 1:165097211-165097233 TGTCCATTGCTGAAAGTAGGGGG - Intergenic
918414472 1:184292295-184292317 TGCGCAATGAGGAAAGTGGGAGG - Intergenic
923367084 1:233273342-233273364 TGGCCACAGCTCAAAGTGGGAGG + Intronic
1065254147 10:23848291-23848313 TGTCTAATATTGACAGTGGGGGG + Intronic
1067557514 10:47283064-47283086 TGTTCATTGCTAAAACTGGGAGG + Intergenic
1067815332 10:49471239-49471261 TTTCCAAGGCTGAAAGTTTGGGG - Intronic
1068711240 10:60136429-60136451 TGTCTAATGCAGAGAGTGGCCGG - Intronic
1075596735 10:123736971-123736993 TGCCCACTGCGGAAGGTGGGAGG - Intronic
1076375187 10:129979003-129979025 TGTCAAGTGCTGGGAGTGGGAGG - Intergenic
1076419281 10:130317950-130317972 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1076613607 10:131742519-131742541 TGTGCGATGCTGCAGGTGGGAGG - Intergenic
1076662885 10:132067261-132067283 TCTCCAAGGCTGAGGGTGGGGGG + Intergenic
1077225386 11:1437148-1437170 AGTCCCATGCTGAATTTGGGAGG + Intronic
1079707215 11:23635965-23635987 CATCAAATGCTAAAAGTGGGGGG - Intergenic
1079958562 11:26894293-26894315 ATTCCAATGTTGAAGGTGGGTGG + Intergenic
1080336727 11:31206243-31206265 AGCCCATTGCTGAGAGTGGGAGG + Intronic
1083107922 11:60376402-60376424 TGTAAAATGCTGAAGTTGGGGGG + Intronic
1083941158 11:65896664-65896686 TGCCCAAGGCTGAAAGTGATAGG - Intronic
1084723093 11:70921546-70921568 TGCCGAATTCTGAAATTGGGAGG + Intronic
1085827392 11:79862463-79862485 TGTTAAATGCTGTCAGTGGGGGG - Intergenic
1086360022 11:86048958-86048980 CTTCCAATTCTGAAAATGGGAGG + Intronic
1088552668 11:111029300-111029322 TGTCCAGTGCTGTCAGTGGAAGG - Intergenic
1091084688 11:132709873-132709895 TGACCAATGCTTAAATTAGGGGG - Intronic
1091699687 12:2651465-2651487 TGTCCACTCATTAAAGTGGGCGG + Intronic
1092035446 12:5330623-5330645 TGTTCAATGCTGTAAGGGTGAGG + Intergenic
1093435983 12:19135540-19135562 TATCCAAAGCTTAAAGAGGGAGG - Intronic
1098180113 12:67838218-67838240 GGTCTAATGCTGAAGGTGGAGGG + Intergenic
1099781902 12:87205911-87205933 TGTCCAATGTTGAAGGTAGGAGG - Intergenic
1100907556 12:99319252-99319274 TGTCTAATGTTGACAGTGGGGGG + Intronic
1101294700 12:103409485-103409507 TTTACAATGCTGCAAGGGGGAGG + Intronic
1101636701 12:106549486-106549508 TGTCTAATGTTGACAGTGGGAGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1105252728 13:18715139-18715161 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1107083648 13:36402561-36402583 TGTCCAATGCTGAAAGTCAGGGG + Intergenic
1107369956 13:39734675-39734697 TGTCCAGTGCTCAAAGTAGAGGG + Intronic
1108307319 13:49151160-49151182 TGTCTAATGCTGAGAGTGGGGGG + Intronic
1109691232 13:65892409-65892431 TTTCCATTGCTCCAAGTGGGGGG + Intergenic
1110917233 13:81036661-81036683 TTTCCATAGCTGAAAGTGGAGGG - Intergenic
1114598322 14:23933483-23933505 TGTCCAATTTTCAAGGTGGGTGG - Intergenic
1115661403 14:35498281-35498303 TTTCCAATGCTGAAAGTTGGGGG - Intergenic
1117645545 14:57848239-57848261 AGTCAAATGCTGAATGAGGGTGG - Intronic
1117795103 14:59385321-59385343 TCTCCAATGATGAAAGTGAGGGG + Intergenic
1117952790 14:61099630-61099652 TGGGTAATTCTGAAAGTGGGTGG - Intergenic
1118040014 14:61906211-61906233 TGTCTACTGGTGAATGTGGGAGG + Intergenic
1118346387 14:64944235-64944257 TGTCCCCTGCTGAAGCTGGGTGG + Intronic
1118410238 14:65470481-65470503 TGTCTCAGGCTGAAAGGGGGCGG - Intronic
1118520218 14:66575227-66575249 TGAAAAATGCTGAAAGTGAGAGG - Intronic
1119539089 14:75427486-75427508 TGTCCAAGGATGAAACTGTGCGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1126333935 15:47565585-47565607 TGTACAATTCTGAATCTGGGAGG + Intronic
1129564397 15:76606595-76606617 TGTCTAATGTTGACAGTGGGGGG + Intronic
1135256799 16:20947612-20947634 TGTCCACTGCTTAATGTGTGGGG + Intronic
1135433284 16:22405666-22405688 TGTCCACTGATGAAAGTGCTGGG - Intronic
1139777271 16:69324323-69324345 TGGGCAATGGTGAAGGTGGGAGG + Exonic
1141948965 16:87328481-87328503 TGTCCACTGCTGAGTGTGAGTGG - Exonic
1142837555 17:2599373-2599395 TGTTAAATGGTGAAAGTTGGTGG + Intronic
1145723002 17:27090191-27090213 TCTACAATGCTGGCAGTGGGGGG + Intergenic
1147902256 17:43796068-43796090 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1147978287 17:44260215-44260237 TGTCCTATGCTCAGAGTTGGGGG - Intronic
1149251249 17:54772169-54772191 TTTCCAGTGCTCAAAGTGGTTGG - Intergenic
1151222686 17:72624801-72624823 TGTCCAATGCTGGAAGAAGAGGG - Intergenic
1151287234 17:73121692-73121714 TGTGCACTGCTGGAAGAGGGTGG + Intergenic
1151932529 17:77241538-77241560 TGTCCAAGGCTGAAGCGGGGTGG + Intergenic
1153887285 18:9478147-9478169 TGACTAATGCAGAAATTGGGGGG + Intronic
1155706499 18:28822120-28822142 TGTCCAATGCTAAGCATGGGGGG + Intergenic
1156427074 18:37025285-37025307 TGTCTAATGTTGACAGTGGGGGG - Intronic
1159142586 18:64415451-64415473 TGTCCATAGATGAAAGTTGGTGG + Intergenic
1159153362 18:64549867-64549889 TGTCCATTGCGGGAAGTGGGTGG + Intergenic
1160213640 18:76906658-76906680 TGACCAATGCTGTAATTGCGGGG + Intronic
1161234451 19:3190921-3190943 TGTCCCCAGCTGAACGTGGGTGG + Intronic
1166413851 19:42577507-42577529 TGTCAAATCCTGAAAGTAGAGGG + Intergenic
1166429300 19:42710670-42710692 TGTCAAATCCTGAAAGTAGGGGG + Intronic
1166442942 19:42831990-42832012 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166462627 19:43002752-43002774 TGTCAAATCCTGAAAGTGAATGG + Intronic
1166468765 19:43059213-43059235 TGTCAAATCCTGAAAGTGAATGG + Intronic
1167602935 19:50465079-50465101 AGTCCAAGGGTGAAAGTGGCTGG - Intronic
925235450 2:2273364-2273386 AGACCAATACAGAAAGTGGGTGG + Intronic
926478893 2:13363351-13363373 TGTCCAATGCTGAATGTGCAGGG - Intergenic
927138621 2:20114891-20114913 TGGCCATTGCTGTAAGTGTGAGG - Intergenic
927257316 2:21050792-21050814 TCTCCAAAGAAGAAAGTGGGTGG + Intergenic
927462981 2:23315258-23315280 TGTCCCATCATGGAAGTGGGAGG - Intergenic
927751797 2:25676127-25676149 TGACCAATTCAGAAACTGGGGGG + Intergenic
928802374 2:35110431-35110453 TGTCTAATGTTGACAGTGGGGGG + Intergenic
930228226 2:48816435-48816457 TGTCAGAGGGTGAAAGTGGGAGG - Intergenic
931486827 2:62702425-62702447 TGGGCAATCCTGGAAGTGGGAGG + Intronic
932467039 2:71930543-71930565 TCTCCCATGCTGAAAGGGGAGGG - Intergenic
932960351 2:76406295-76406317 TGCCCAATGCTGGCAGAGGGTGG - Intergenic
935128388 2:100243262-100243284 TGTCCAAGGCTGAAGGTGTGAGG - Intergenic
935853025 2:107243665-107243687 TGGCCAATGCTGATAGTGTGGGG + Intergenic
936856487 2:116964440-116964462 TGTCCAAAAGTGAGAGTGGGAGG - Intergenic
937370335 2:121293260-121293282 TCCCCAGTGCTGGAAGTGGGTGG - Intergenic
938261453 2:129898373-129898395 TGTCCATTACTGAGAGTGGGAGG - Intergenic
940972978 2:159913689-159913711 TGGCTAATGCTGAACCTGGGGGG + Intergenic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
941447037 2:165615134-165615156 TTTCCAATGCTGAAATGTGGTGG + Intronic
941524840 2:166594591-166594613 TGTCCAGTGCTGAAAGCGGGGGG - Intergenic
943253888 2:185568127-185568149 TGTGCACTGGGGAAAGTGGGTGG - Intergenic
943436950 2:187876664-187876686 TGTCAAAAGCTGAAAGGTGGTGG + Intergenic
946077517 2:217086881-217086903 TGTCCAATTCTAAGATTGGGAGG - Intergenic
946222138 2:218237117-218237139 TGTTCAATACTTAAAGTGTGTGG - Intronic
1170746963 20:19108147-19108169 TTTCCAATTCTGAATCTGGGTGG - Intergenic
1171432819 20:25095435-25095457 TATCCAATGTTGAAAGTGGGGGG - Intergenic
1176838242 21:13815026-13815048 TCTTCCAGGCTGAAAGTGGGAGG + Intergenic
1178300340 21:31447924-31447946 AGTCCAAGGCTGAAAGCAGGAGG + Intronic
1179358277 21:40682292-40682314 TGACCAATACAGAAAGTGGATGG + Intronic
949846363 3:8374448-8374470 TGTCTAATATTGACAGTGGGGGG - Intergenic
950679638 3:14576005-14576027 TGGCCAGTGCTGGAAATGGGAGG + Intergenic
952093423 3:29919805-29919827 TGTACAATGCTGAAAGCAGCAGG - Intronic
954716701 3:52530389-52530411 TGTACAATGGAGAAAGTGGAAGG + Intronic
956167665 3:66408610-66408632 AGTCCAATTCTTAAAGTGAGGGG - Intronic
956638557 3:71391676-71391698 TGCCCAATGCTGAGAGTTAGTGG - Intronic
958789683 3:98637027-98637049 TGTCTAAGGCTGAGAGTAGGGGG - Intergenic
959656958 3:108818328-108818350 TGGCCAATGAGGAAAATGGGTGG + Intergenic
962116501 3:132514849-132514871 TGTCAAAAGTTGAAAGTTGGGGG + Intronic
962817214 3:139012252-139012274 TGTCCTATGCTGAAAGTGGGGGG + Intronic
963323886 3:143839948-143839970 TCTCCTATGGTGAAAGGGGGAGG - Intronic
964517417 3:157527551-157527573 TGTCCAAGCTAGAAAGTGGGTGG - Intronic
964842885 3:161013603-161013625 TGTCTAATGTTGACAGTGGGGGG + Intronic
964846033 3:161045184-161045206 TGTCTAATGTTGACAGTGGGGGG - Intronic
965521327 3:169670234-169670256 TGTCCACAGCTGAAAGGGGAAGG - Intergenic
967738130 3:192975477-192975499 TGTCCAACGCTGAAAGTGGGAGG - Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972370730 4:38420746-38420768 ACTCAAATGCTGAAAGTGGCTGG + Intergenic
973626607 4:52778798-52778820 TCCCCAATGCTGGAGGTGGGAGG - Intergenic
974633370 4:64525890-64525912 TGTTTATTGCTGAAAGTTGGGGG + Intergenic
974741296 4:66011764-66011786 TGTCTAATACTGACATTGGGTGG + Intergenic
976450802 4:85188805-85188827 TATCCAATGCTGAAAGTTGGGGG + Intergenic
976728250 4:88237127-88237149 TGTTCAATGATGAAAGTGGGGGG + Intergenic
978409973 4:108415977-108415999 GGTCTAATCCTGAAAGTGGATGG + Intergenic
979317069 4:119277679-119277701 TGTCTAATGTTGACAGTGGGGGG + Intronic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
982989963 4:162261080-162261102 TGTCCATTTCTGAAACTCGGAGG - Intergenic
985038070 4:185861299-185861321 TGTCCTTCGCTGAAAATGGGGGG + Intronic
985365391 4:189226559-189226581 TATTCAATGCTGGAAGTGGGAGG - Intergenic
987883383 5:23779612-23779634 TGTTAAATGTTGAAAGTGGTTGG + Intergenic
988936791 5:36091550-36091572 TCCCCAATGCTGGAGGTGGGAGG + Intergenic
990578191 5:57143883-57143905 TGTTCAATGCTGAAACTGGAGGG + Intergenic
993410580 5:87567910-87567932 AGACCAACGCAGAAAGTGGGTGG - Intergenic
993600302 5:89914934-89914956 TGTGCAATGTTTAAAGTGGCAGG - Intergenic
998472859 5:142396868-142396890 TTTGCAATGCAGAAAGGGGGTGG + Intergenic
998737968 5:145164670-145164692 TGTCTAATGCTGAAAGTGGGAGG + Intergenic
999493342 5:152073006-152073028 TGTGCAATGGGGAAAGTGGAGGG + Intergenic
1000601532 5:163281278-163281300 TGCCCAATGTTGGAGGTGGGAGG + Intergenic
1000772130 5:165367971-165367993 TGTCCACTGCTCAGAGTGTGGGG - Intergenic
1003225518 6:4202093-4202115 TGTTTAATGTTGACAGTGGGGGG + Intergenic
1003848511 6:10198383-10198405 TTTCAAATGGAGAAAGTGGGTGG - Intronic
1005064093 6:21801552-21801574 AGTGCAATGCTGAAAGTTGGAGG + Intergenic
1008362775 6:50641441-50641463 TGTCCACTGCTGTAGGTGGGTGG - Intergenic
1008882094 6:56390884-56390906 TGTCCAATGCTAAAAGTAGGTGG - Intronic
1009770862 6:68141415-68141437 TGTCCAGTGCTGAAAGTGGGAGG + Intergenic
1010264104 6:73848627-73848649 TGTCTAATGCTGAAAGTTGGGGG + Intergenic
1011509577 6:88085867-88085889 TGTCCATTGCTAATCGTGGGAGG - Intergenic
1012075270 6:94674779-94674801 TGTCTAATATTGACAGTGGGGGG - Intergenic
1013742147 6:113299830-113299852 TGGCCTATGCTGAAAGTGAAAGG - Intergenic
1014638465 6:123878981-123879003 TTTCCAATACTGAAAATGAGTGG + Intronic
1015622557 6:135146870-135146892 TGTTTAATGCTGAGAATGGGAGG + Intergenic
1016623441 6:146139389-146139411 TGTCCAATGCTGAAAGTACAGGG + Intronic
1017524479 6:155230468-155230490 TGACCAGTGCCGAAAGTGGGGGG - Intronic
1021296245 7:18910026-18910048 TGTCCAATGCTGAGAGAGTGGGG + Intronic
1022704816 7:32792407-32792429 TGTTCACTGCTGAAGCTGGGTGG + Intergenic
1022910151 7:34893010-34893032 TGTTCATTGCTGAAGCTGGGTGG + Intergenic
1026535492 7:71235481-71235503 TGTCCAGTGTTGCAAGGGGGAGG + Intronic
1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG + Intronic
1028287368 7:89019554-89019576 TATCCAATTCTGAAAGTTGTGGG + Intronic
1028605953 7:92656060-92656082 TTTCCTATGGTTAAAGTGGGAGG + Intronic
1029907924 7:104111031-104111053 TTTCAAATGCTGACAGTGAGAGG - Intergenic
1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG + Intergenic
1030652715 7:112132707-112132729 TATCCAATACAGAAAGTAGGAGG + Intronic
1031711268 7:125048869-125048891 TGTCTAATATTGACAGTGGGGGG - Intergenic
1035950560 8:4016008-4016030 TGTCCAAGGCTGAAAGACAGTGG - Intronic
1038459119 8:27701883-27701905 TGTTCAGTGCTAAAACTGGGAGG + Intergenic
1043367157 8:79546130-79546152 TGTCCAGTGCTGAAAGTAGCTGG - Intergenic
1043750165 8:83925252-83925274 TGTCCCATGCTGAAAGTGGGGGG + Intergenic
1045207712 8:100059704-100059726 TGTCCAATGCTGAAAGTCAGAGG - Intronic
1046425247 8:114039196-114039218 TGTCCAATGCTGAGAGTGATGGG - Intergenic
1047937014 8:129791872-129791894 TGTCCAATACTAAAAGTCGTGGG + Intergenic
1048931385 8:139318207-139318229 TGTCCAATTCTTAAAGCAGGTGG + Intergenic
1050049716 9:1586997-1587019 TGTCTAATGTTGACAGTGGGGGG + Intergenic
1050058193 9:1677760-1677782 TGGTCAAAGCTGAAAGTGGATGG - Intergenic
1051992322 9:23166410-23166432 TGTCTAATCCTGAAAGTGAGAGG - Intergenic
1052525320 9:29610519-29610541 TGTCCCTTGCTAAAAGTGGAGGG - Intergenic
1053610482 9:39708470-39708492 TGTACACAGCTGAAAGTGCGCGG + Intergenic
1054087770 9:60762686-60762708 TGTACACAGCTGAAAGTGCGTGG - Intergenic
1054243041 9:62633925-62633947 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1054557165 9:66668443-66668465 TGTACACAGCTGAAAGTGCGCGG - Intergenic
1055227608 9:74018197-74018219 TGTTCAGTGCTGAACATGGGCGG - Intergenic
1056405644 9:86271822-86271844 TACACAATGCTGAATGTGGGTGG - Intronic
1059516924 9:114904526-114904548 TCTTCAATGCTGAAAGCTGGAGG + Intronic
1060376395 9:123118381-123118403 TGTCCAGTGCTGAAACTGCCTGG + Intronic
1061796998 9:133091388-133091410 TGTACAATATGGAAAGTGGGGGG - Intergenic
1185966525 X:4611795-4611817 TGTCTAATGCTGAAATTGCAAGG + Intergenic
1186611475 X:11142112-11142134 TGGGAAATGCTGAAAATGGGAGG - Intronic
1188806728 X:34600011-34600033 TGTCTAATGCTGTCAGTGGAGGG + Intergenic
1192149275 X:68701905-68701927 TGTCCCATGCTAGAATTGGGTGG + Intronic
1192940472 X:75906334-75906356 TGTTTAGTGCTGAAAGTGAGAGG + Intergenic
1192945559 X:75963041-75963063 TGTCCAATGGTGGATGTGAGAGG + Intergenic
1193211640 X:78812953-78812975 TGTCCAATGGTAAGAGTGGGGGG - Intergenic
1194371199 X:93074308-93074330 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1194419376 X:93654015-93654037 TGTCAAATACTGCAAGTGGAAGG - Intergenic
1194881841 X:99262190-99262212 TGTTCAATACTGAAAGCAGGAGG + Intergenic
1195993091 X:110702663-110702685 TGTCAAATGATGGAACTGGGAGG + Intronic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1196106943 X:111906542-111906564 TTTCCAAAGCTGGAAGTTGGGGG - Intronic
1196111079 X:111947861-111947883 TGTTCAATGCTGATGGTGGAGGG + Intronic
1197007106 X:121514863-121514885 TGACCAAAGCTGAAAGGGTGTGG + Intergenic
1197069787 X:122282319-122282341 TGTCCAATGCTGAAAGTGGAAGG - Intergenic
1198785203 X:140280505-140280527 TGTCCAATGCTGAAAGTGAGGGG + Intergenic
1200334638 X:155336651-155336673 TCTCACATGATGAAAGTGGGAGG + Intergenic
1200678998 Y:6186196-6186218 GTTTCATTGCTGAAAGTGGGGGG - Intergenic
1202594643 Y:26523832-26523854 TGTCCAATGCTGAGATTGAGTGG - Intergenic