ID: 972274147

View in Genome Browser
Species Human (GRCh38)
Location 4:37541409-37541431
Sequence AAGACTTAAGTACCTCTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972274147_972274150 3 Left 972274147 4:37541409-37541431 CCTATTAGAGGTACTTAAGTCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 972274150 4:37541435-37541457 ACAATGATAGACCCTTTAACAGG 0: 1
1: 0
2: 1
3: 6
4: 70
972274147_972274155 29 Left 972274147 4:37541409-37541431 CCTATTAGAGGTACTTAAGTCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 972274155 4:37541461-37541483 GTGATGAGCAGAAATGAGCGAGG No data
972274147_972274151 4 Left 972274147 4:37541409-37541431 CCTATTAGAGGTACTTAAGTCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 972274151 4:37541436-37541458 CAATGATAGACCCTTTAACAGGG 0: 1
1: 0
2: 1
3: 8
4: 107
972274147_972274152 7 Left 972274147 4:37541409-37541431 CCTATTAGAGGTACTTAAGTCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 972274152 4:37541439-37541461 TGATAGACCCTTTAACAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972274147 Original CRISPR AAGACTTAAGTACCTCTAAT AGG (reversed) Intronic
905420002 1:37835285-37835307 AATACTTACTTACCTCTATTAGG - Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907902508 1:58753850-58753872 AGGACTTAAGTACCTCAGCTAGG + Intergenic
910884213 1:91949121-91949143 AAAACTCAAGAACCTCTACTAGG + Intergenic
912309807 1:108609003-108609025 ATGACCTAATTACCTCTTATAGG + Intronic
916654341 1:166860070-166860092 TAGGTTTAAGTACCTTTAATAGG - Intronic
917367857 1:174253405-174253427 AAGATTTTAATACCTATAATTGG + Intronic
917647385 1:177042467-177042489 AAGAGTTAAGCACATGTAATGGG - Intronic
919029142 1:192216872-192216894 ATGACTTAAGTATCTCTCAAAGG + Intergenic
920269142 1:204750219-204750241 GAGACTCAAGTGCCTCTAGTGGG + Intergenic
1063003103 10:1943415-1943437 CACACTTAAGTACCTCTTCTTGG + Intergenic
1063098759 10:2931527-2931549 ATGACTCAAGTACCTCCCATTGG - Intergenic
1065711127 10:28519161-28519183 AAGACTTAACCACCTCTTACTGG - Intergenic
1072446787 10:95505617-95505639 AAGACTCGGGTAACTCTAATAGG + Intronic
1073743277 10:106436428-106436450 AAGACTTAATTCCCACTATTAGG + Intergenic
1074025858 10:109633635-109633657 AATAATTAAGTAACTGTAATAGG + Intergenic
1074685363 10:115957485-115957507 AAAACTTCATTACCTCTAAAGGG + Intergenic
1085644435 11:78213976-78213998 AAGACCTAAGTCCCTTTCATTGG + Exonic
1086386794 11:86317238-86317260 AAGACTTAAGTATTTCTAAGAGG + Intronic
1094747997 12:33368699-33368721 AAGGCATAAGTAGCACTAATAGG - Intergenic
1095730078 12:45497163-45497185 ATGACTTAATTACCTCTTAAAGG - Intergenic
1098023260 12:66176176-66176198 AATATTTAAGTATCTTTAATAGG + Intergenic
1098182219 12:67860062-67860084 ATGACTTAATTACCTCTTAAAGG + Intergenic
1099024332 12:77446841-77446863 AAGAATTAAGTACCTCTACTTGG - Intergenic
1099146425 12:79050841-79050863 AGGACTTTATTACTTCTAATAGG - Intronic
1099755121 12:86836348-86836370 AATATTTCAGGACCTCTAATTGG - Intronic
1106454475 13:29914914-29914936 AAGACTTAATCACCTCTTAAAGG + Intergenic
1106633410 13:31501350-31501372 ATGACTTAATCACCTCTAAAAGG - Intergenic
1106697117 13:32187033-32187055 AAAACTTTAGTTCCTCTAAAGGG - Intronic
1107281561 13:38742124-38742146 AAGTTTTAAGTATCTCTAACAGG + Intronic
1110369895 13:74728012-74728034 AAGACTTACACACCTCTACTGGG + Intergenic
1111245714 13:85537226-85537248 AAGACATAATCACCTCTTATTGG + Intergenic
1111656210 13:91156960-91156982 AAGAATTGTGTAACTCTAATTGG + Intergenic
1112532952 13:100222666-100222688 AAGACAGAATTACCTGTAATTGG - Intronic
1113487802 13:110667675-110667697 AAGAATTAAGTGCCTTTACTAGG - Intronic
1115985090 14:39096636-39096658 AAGTGTTAAATACCTCTTATTGG - Intronic
1116733783 14:48661251-48661273 AAGACTTAAAAAGCTCGAATGGG - Intergenic
1116802841 14:49461381-49461403 CAGTCTAAAGTACTTCTAATGGG + Intergenic
1116957272 14:50937421-50937443 AAGACTCAAGTACTTTTAAAAGG + Intronic
1117351677 14:54887249-54887271 AAGATTTAAAGACTTCTAATTGG - Intronic
1119341184 14:73879905-73879927 AATTCTTAAATACCTCTAACAGG + Intronic
1125637008 15:41197527-41197549 AAGAATCAAGTACCTATCATTGG - Intronic
1126332228 15:47545630-47545652 AAGATTTAAGTAAATATAATCGG + Intronic
1129063069 15:72876475-72876497 AAAACGAAAGTACCTCTGATTGG + Intergenic
1132119397 15:99163676-99163698 ATGACTTAATTACCTCTGAAAGG - Intronic
1135502745 16:23011425-23011447 AAAATGTAAGGACCTCTAATGGG - Intergenic
1135633225 16:24052363-24052385 AAGACCTAAGAACCTCTCTTGGG - Intronic
1138905025 16:61321605-61321627 AAGAATTAAGTAGCCCTATTTGG + Intergenic
1138965145 16:62075215-62075237 ATGGCTTAGGTAACTCTAATAGG + Intergenic
1140971834 16:80020791-80020813 AAGACTTTAGTAGCTCAAATAGG + Intergenic
1142319876 16:89374450-89374472 AAGCCTAAAATACCACTAATCGG + Intronic
1144306012 17:13970195-13970217 AATATTAAAGTACCTCTGATTGG + Intergenic
1148513769 17:48196920-48196942 ATGAGTTAAGTACCTATAAGAGG + Intronic
1156923249 18:42548538-42548560 AATACTTAAGTAGCTATAGTAGG + Intergenic
1158314524 18:56196036-56196058 CAGACTGTGGTACCTCTAATTGG + Intergenic
1158448156 18:57539193-57539215 AAGAAATAACTACCTCTCATTGG + Intergenic
1158463265 18:57665889-57665911 ATGGCTTATGTACCTCTATTTGG + Intronic
1164396203 19:27866021-27866043 CAGACTTCAGGAACTCTAATAGG + Intergenic
1165122837 19:33573131-33573153 AAGACGAAAGTACCTCTGATTGG - Intergenic
1165642025 19:37397800-37397822 ATGACTTAATTACCTCTTAAAGG + Intergenic
1202669215 1_KI270709v1_random:35601-35623 AAGAATAAAATACCTATAATTGG - Intergenic
933462093 2:82601217-82601239 AAGGCTTAAGTGCGTTTAATGGG + Intergenic
936780106 2:116022145-116022167 AAGACTTGGGTACCTCAAAGTGG - Intergenic
938291208 2:130151693-130151715 AATACTTAAGTACCACTGAACGG + Exonic
938465333 2:131521266-131521288 AATACTTAAGTACCACTGAACGG - Intergenic
938576910 2:132613310-132613332 AAAACTTAAATAACTCTATTGGG + Intronic
939657890 2:144850429-144850451 GAAACTTAAGTGCCTTTAATTGG + Intergenic
940774384 2:157871573-157871595 AACAATGAAGTAACTCTAATGGG + Intronic
943048874 2:182892333-182892355 TACACTAAAGAACCTCTAATTGG - Intergenic
945014463 2:205500654-205500676 AAGAGTTAAGTACATCTTGTAGG - Intronic
945518208 2:210789736-210789758 AAGACTCAAGTAACACTAAATGG + Intergenic
945632988 2:212306867-212306889 AAGACATAAGTAATTTTAATTGG - Intronic
946875439 2:224125405-224125427 AAGACTTAACTACCTCCCAAAGG + Intergenic
946918307 2:224549969-224549991 AAGTCTTAAGTACCACTAACTGG + Intronic
948075467 2:235162305-235162327 AAAATGAAAGTACCTCTAATTGG - Intergenic
1169458773 20:5776464-5776486 AAAACTTAATTACCTCTAGCTGG + Intronic
1169651238 20:7870080-7870102 AAGACTTAAGACACGCTAATGGG + Intergenic
1169773645 20:9228731-9228753 AACACTTCAGTAACTATAATGGG + Intronic
1170151733 20:13233621-13233643 AAGAATTAGGAACATCTAATGGG - Intronic
1170407756 20:16056768-16056790 AAGACTTAATCACTTCTTATAGG - Intergenic
1170542067 20:17399205-17399227 AAGATTTAAGTACTTCTATGGGG - Intronic
1173236712 20:41252775-41252797 AAGAATTATAAACCTCTAATAGG - Intronic
1173744934 20:45429082-45429104 AAGACTTAATTAAATCAAATAGG + Intergenic
1175035988 20:56002693-56002715 AAGAATTAAGTAGCTCCATTTGG - Intronic
1175408224 20:58748896-58748918 AAGAGTTAAGTACCAGTCATTGG - Intergenic
949238811 3:1844482-1844504 AAAACTTAAATACCTTTTATGGG + Intergenic
950765929 3:15272973-15272995 AAGAACTAAGAACCACTAATGGG - Intronic
955127062 3:56123237-56123259 ATGACCTAATTACCTCTAAAAGG - Intronic
964297928 3:155254143-155254165 AAGACTTTACTACCTCTTCTGGG + Intergenic
967502563 3:190216863-190216885 AAGGCTTAATTACCTCTTAAAGG - Intergenic
970053193 4:11939658-11939680 TAGACTCATGTACTTCTAATGGG - Intergenic
972274147 4:37541409-37541431 AAGACTTAAGTACCTCTAATAGG - Intronic
974769341 4:66390341-66390363 AACACATAAGTAACTCTCATTGG + Intergenic
975284497 4:72601353-72601375 AATAATTAAATACCTCTTATTGG - Intergenic
975442937 4:74433795-74433817 AAAACGAAAGTACCTCTGATTGG - Intergenic
978034788 4:103978801-103978823 AAAAAGAAAGTACCTCTAATTGG + Intergenic
981119741 4:141036258-141036280 AAATCTTAAGTACCTATTATAGG - Intronic
982858994 4:160424584-160424606 AAAACTTAAGTAACTCTCATGGG - Intergenic
985705402 5:1397969-1397991 AAGATTTAAGTCCTTATAATGGG + Intronic
987702803 5:21423679-21423701 AAGACTTCATAACTTCTAATTGG + Intergenic
993593040 5:89819766-89819788 TAGACTTAAGCACCACTAACGGG - Intergenic
995104808 5:108364285-108364307 AAGGCCTAATTACCTCTATTTGG - Intronic
995976614 5:118044502-118044524 AAGTCTTAAATACCCCTCATAGG - Intergenic
998815270 5:146007519-146007541 AATACTTAAGCACCTCATATGGG - Intronic
999102088 5:149034378-149034400 AAGTCCAACGTACCTCTAATAGG + Intronic
999642346 5:153684385-153684407 AAGACATAGTTAACTCTAATTGG + Intronic
1000970094 5:167704551-167704573 AAGACTTAAATACCAATATTAGG + Intronic
1005950090 6:30625544-30625566 TTGACTTCAGTACCTCTCATGGG + Exonic
1010145171 6:72659715-72659737 ATGACTTAATTACCTCCAAAAGG + Intronic
1011579996 6:88852119-88852141 AGGACTTAAATACCTCTCTTTGG + Intronic
1013566114 6:111365424-111365446 AACACTTAAGTACCACTTGTGGG + Intronic
1013889197 6:115005621-115005643 AGGTCTCAAATACCTCTAATAGG - Intergenic
1015105690 6:129533415-129533437 AAAATTAAAGTACCTCTGATTGG + Intergenic
1020192905 7:6014177-6014199 AAGACTAAATTACCTGAAATAGG + Intronic
1021487687 7:21184699-21184721 AACACATAAGTACATTTAATAGG - Intergenic
1021627742 7:22611128-22611150 ATGACTTAAGTACCTAAATTTGG + Intronic
1022458097 7:30577048-30577070 AAGACTTAAGTACATGTAAATGG - Intergenic
1023704439 7:42926523-42926545 AAGTATAAAGTACCTGTAATCGG + Exonic
1030264415 7:107604070-107604092 AATACTTAGGTACCCATAATAGG - Intronic
1031252416 7:119403814-119403836 ACTACTTAGGTACCTCTAAGTGG - Intergenic
1033231026 7:139597392-139597414 AAGACTTAAGTACCTTTGAAGGG - Intronic
1033238348 7:139656237-139656259 TTGACTTAAGTATCTCTAATTGG + Intronic
1037137180 8:15477026-15477048 AAATCGTAAGTACCTCTGATGGG - Intronic
1037656123 8:20885719-20885741 AAGTCTTCTCTACCTCTAATAGG - Intergenic
1038244723 8:25844810-25844832 AAGGCTTCAGTGCCTTTAATGGG - Intronic
1044929850 8:97241508-97241530 AAGACTTAATTACCTCCCAAAGG + Intergenic
1045864303 8:106847290-106847312 AAGATTTAAGTACCTGTAAGAGG + Intergenic
1046142092 8:110107257-110107279 AACACTTAAGTACTTCTGTTGGG + Intergenic
1049939961 9:535976-535998 AAGACTTTAGTACCTGGAAGTGG - Intronic
1052959912 9:34286604-34286626 AAGAATTAATTACCTCTAAGAGG + Exonic
1058705520 9:107634847-107634869 AAGACTTATGTAGCTCAAGTTGG + Intergenic
1059910367 9:119037024-119037046 AAGACTTAATTACCTCCCAAAGG - Intergenic
1060808025 9:126590401-126590423 AATACTTACCTACCTCTAAAAGG + Intergenic
1187450193 X:19389239-19389261 AAGAATTGAGTACTTCTAATGGG + Intronic
1188374651 X:29413043-29413065 ATGACTCAATTACCTCTAACGGG - Intronic
1193548649 X:82861243-82861265 AAGACCTAAATACCTCTTAAAGG - Intergenic
1194108098 X:89797130-89797152 ATGACTTAATTACCTCTTAAAGG - Intergenic
1200460753 Y:3451859-3451881 ATGACTTAATTACCTCTTAAAGG - Intergenic