ID: 972276269

View in Genome Browser
Species Human (GRCh38)
Location 4:37560676-37560698
Sequence CTAGATGCAGGGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 465
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 425}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972276269_972276279 29 Left 972276269 4:37560676-37560698 CCAGCTTCCCTCCCTGCATCTAG 0: 1
1: 0
2: 3
3: 36
4: 425
Right 972276279 4:37560728-37560750 TCTTTCCCTCTAGGCTCCAAAGG 0: 1
1: 0
2: 1
3: 25
4: 341
972276269_972276275 20 Left 972276269 4:37560676-37560698 CCAGCTTCCCTCCCTGCATCTAG 0: 1
1: 0
2: 3
3: 36
4: 425
Right 972276275 4:37560719-37560741 ACCCTTGCCTCTTTCCCTCTAGG 0: 1
1: 0
2: 2
3: 34
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972276269 Original CRISPR CTAGATGCAGGGAGGGAAGC TGG (reversed) Intronic
900101753 1:964916-964938 CTGGCTGCAGGAAGGGATGCGGG - Intronic
900266066 1:1757810-1757832 CTGTGTGCAGGGGGGGAAGCGGG - Intronic
900292650 1:1930024-1930046 CCACATGCAGGCTGGGAAGCAGG - Intronic
900940222 1:5793629-5793651 CCAGATGGCAGGAGGGAAGCAGG + Intergenic
901230082 1:7636960-7636982 GTAGAGGCAGAGAGGGAATCAGG + Intronic
902724516 1:18325863-18325885 CAAGATGCCGTGAGGGCAGCCGG + Intronic
902943835 1:19819661-19819683 CTAGCTGCAGGCTGGGGAGCCGG + Intergenic
903034964 1:20487009-20487031 CTCGATGCCGGGAGGGAGACTGG + Intergenic
903279716 1:22243679-22243701 CTGCCTGCAGGGAGGGACGCTGG + Intergenic
903369224 1:22824556-22824578 CCAGAAGGAGGGAGGGAAGACGG + Intronic
903576077 1:24340691-24340713 CTGGAGGCAGGCAGGGAGGCAGG - Intronic
904118631 1:28180420-28180442 CAACAGGCAGGGAGGGAACCAGG + Intronic
904355001 1:29933294-29933316 CTAGATGCAGGGAGGGTGTGTGG + Intergenic
905134074 1:35784774-35784796 CTAGATGCAGGGCAGCAAGGTGG - Intergenic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
907131509 1:52101470-52101492 CCAGATGCTGGGAGGGTAGGGGG + Intergenic
907694647 1:56710974-56710996 GAATATGCAGGGAGGGAAGTAGG + Exonic
907744411 1:57198620-57198642 GAAGATGCAGGGAGGGAGGGAGG - Intronic
908319782 1:62967874-62967896 CTAGGAGCAGGGAGGAAAGAGGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
909522902 1:76589833-76589855 CTAGATGCATGAAGGGGTGCTGG - Intronic
912948992 1:114107471-114107493 CTGGAGGCAGGGAGGAAACCAGG + Intronic
913224441 1:116686727-116686749 CTTGTTTCAGGGAGAGAAGCTGG + Intergenic
914781431 1:150789395-150789417 CGAGAAGGAGGAAGGGAAGCTGG - Intergenic
915089695 1:153415832-153415854 CAAAGTCCAGGGAGGGAAGCAGG - Intergenic
915095813 1:153461308-153461330 CAAAGTCCAGGGAGGGAAGCAGG + Intergenic
915329007 1:155097771-155097793 TCAGATGCAGAGAGGGGAGCTGG - Intergenic
915457776 1:156052117-156052139 CTAGGTGGAGGGACTGAAGCTGG - Intronic
916243439 1:162662389-162662411 GCAGATTCAGGGAAGGAAGCTGG - Intronic
917598312 1:176551920-176551942 AGAGATGCAGGGAGGGAAAGCGG + Intronic
917633680 1:176915393-176915415 CTTGATGCAAGGAGGGGAGGAGG - Intronic
919935241 1:202246385-202246407 ATAGATGAAGGGAGGGAGGGAGG - Intronic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
922192296 1:223330053-223330075 ATAGATGGAAGGAGGGAAGAAGG + Intronic
922939289 1:229447589-229447611 CAATATCCAGGGAGGGAAGAGGG + Intronic
924088213 1:240476373-240476395 ATAGATGCAGGGTGGGAAGTGGG + Intergenic
924548446 1:245052038-245052060 TGAGATGAAGGGAGGGAAGTGGG + Intronic
924720804 1:246621202-246621224 CTAGATGCTAGGAGAGTAGCAGG - Intronic
924944866 1:248839149-248839171 CAAGATGAAAGAAGGGAAGCTGG - Intronic
1062962225 10:1581149-1581171 CTAGAAGCAGGGATAGAACCTGG + Intronic
1063124059 10:3124594-3124616 CCAGGTGCAGGCAGGGAAGGGGG - Intronic
1063161318 10:3420893-3420915 TGAGATGCAGGTAGGGACGCAGG + Intergenic
1063172982 10:3526347-3526369 CTAGATGAAGTGAAGGAACCAGG - Intergenic
1063487412 10:6432898-6432920 AAAGATGAGGGGAGGGAAGCAGG - Intronic
1067084736 10:43231787-43231809 CCAGCTGCAGGGATGCAAGCAGG - Intronic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067378731 10:45752722-45752744 CTAGCTGCAGGGAGTGTTGCTGG - Intronic
1067882810 10:50061440-50061462 CTAGCTGCAGGGAGTGTTGCTGG + Intergenic
1067886430 10:50093402-50093424 CTAGCTGCAGGGAGTGTTGCTGG - Intronic
1069933815 10:71901253-71901275 GCAGATGGAGGGAGGGAAGATGG - Intergenic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1071363604 10:84876681-84876703 CTAGATGCAGGGAAGTGACCTGG - Intergenic
1071876094 10:89844842-89844864 ATAGATTCAGGGAAGGAAGCAGG + Intergenic
1072035575 10:91560460-91560482 CTGGAGGCAGGGAGGCCAGCTGG - Intergenic
1073674387 10:105628827-105628849 CAATATGCAGAGAGGGAAGCAGG - Intergenic
1073978161 10:109123761-109123783 CTAGAAGCAGGAAGGTAAACAGG - Intergenic
1074263892 10:111881944-111881966 CGAGATTCAGGGGGGGAATCTGG - Intergenic
1074431464 10:113398427-113398449 CTTGATCCTGGGAGGGAAGAAGG - Intergenic
1075102364 10:119515481-119515503 CAAGGTGCAGGCAGGGAAGTCGG + Intronic
1075605871 10:123807469-123807491 GTAGCTGCAGGGAGAGGAGCAGG - Intronic
1075948354 10:126456841-126456863 CCAGGAGCAGGGAGGGAGGCTGG + Intronic
1076097636 10:127744922-127744944 TTAGATCCAGGGAGTGCAGCAGG - Intergenic
1076429716 10:130393273-130393295 CATGATGCAGGGAGGGAACATGG + Intergenic
1076692433 10:132230656-132230678 CTTGCTGCTGGGGGGGAAGCTGG + Intronic
1076727082 10:132419010-132419032 CTAGTTGCAGGCTGGGCAGCTGG - Intergenic
1077135423 11:995746-995768 CTAGGTGGAGGGAGGGGAGAGGG - Intronic
1078434675 11:11314609-11314631 CTAAAAGCAGGGTGGGAAGCTGG + Intronic
1079370418 11:19847472-19847494 CTAGATGCACTGAGGGAAGAAGG - Intronic
1080873541 11:36257655-36257677 CAACATGCAGGGAGGGGAACAGG - Intergenic
1081293604 11:41357531-41357553 CTTGATTCTGGGAGGGAAGAAGG + Intronic
1081501381 11:43669996-43670018 CTTAAGGGAGGGAGGGAAGCTGG + Intronic
1081702050 11:45158365-45158387 GGAGCTGCAGGGAGGGAGGCAGG - Intronic
1082008956 11:47437805-47437827 AAAGAGGCAGGGAGGGGAGCTGG + Exonic
1083063457 11:59898548-59898570 ACAGTTCCAGGGAGGGAAGCTGG + Intergenic
1083161770 11:60858818-60858840 TGAGATGCAGGGCAGGAAGCAGG + Intergenic
1084604705 11:70165683-70165705 CTAGAAGCAGGGAGAGAAGGAGG + Intronic
1084746792 11:71175629-71175651 CAAGATGGAGGAAGGGAAACTGG + Intronic
1084839535 11:71833784-71833806 CTAGATGCTGAGAAGGAAGAGGG - Intronic
1084902647 11:72321401-72321423 CAAGATGCAGCATGGGAAGCTGG - Intronic
1085164738 11:74388139-74388161 CCAGATGCTGGAAGGGAAGGAGG + Intronic
1085406317 11:76265154-76265176 GCAGATGCTGTGAGGGAAGCTGG - Intergenic
1085695395 11:78700232-78700254 TAGGATGCAGGGAGGGCAGCAGG + Intronic
1085998209 11:81947968-81947990 TGAGAGGGAGGGAGGGAAGCGGG + Intergenic
1086405931 11:86499000-86499022 CATGATTCTGGGAGGGAAGCTGG + Intronic
1088674622 11:112180568-112180590 CTAGAAGCAGGGTGGGAAGGAGG + Intronic
1088726213 11:112637391-112637413 TGAGATGCAGGGAGGGATGATGG - Intergenic
1088979714 11:114851296-114851318 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1089083537 11:115797758-115797780 CTGGAGGCAGGGAGGTCAGCTGG + Intergenic
1089108672 11:116036613-116036635 CTAGAGGCAGGGGCGGGAGCAGG - Intergenic
1089854961 11:121535505-121535527 CCAGATGCAGAGAGAGAGGCTGG + Intronic
1090274503 11:125410082-125410104 CTAGAAGGAGGGAGGGGGGCAGG + Intronic
1090914141 11:131148100-131148122 CCAAATGCAGGGAGGAAAGTGGG - Intergenic
1091634395 12:2186229-2186251 CTAAATGCCGGGAGGGAACCAGG - Intronic
1092017428 12:5170743-5170765 CTAGCTGGAGGGAGGGGAGGAGG + Intergenic
1092067728 12:5605748-5605770 CAAGGTGCAGGGAGGGGAGGAGG + Intronic
1093082811 12:14832602-14832624 CTAGGTGCAGGGAAGGAAATAGG - Intronic
1094118092 12:26938720-26938742 CTAAATCCAGGGACGGGAGCAGG + Intronic
1094514476 12:31119203-31119225 CTAGAGCCAGGGGGGGAAGAGGG - Intergenic
1094514807 12:31120233-31120255 CTAGAGCCAGGGGGGGAAGAGGG - Intergenic
1095629505 12:44358163-44358185 CTAGAGGCAGGGAGGGAGGGAGG + Intronic
1096098985 12:48957432-48957454 CTAGGTGGAGGGAAGGAAGGAGG - Exonic
1096714165 12:53481180-53481202 TTTCATGGAGGGAGGGAAGCTGG + Exonic
1096750999 12:53758822-53758844 CCAGACTGAGGGAGGGAAGCGGG - Intergenic
1096782530 12:53999484-53999506 TGAGATACAGGGAGGGAAGGAGG - Intronic
1096864574 12:54554662-54554684 GTGGCTGGAGGGAGGGAAGCAGG + Intronic
1097220089 12:57444194-57444216 CTAGCTGCAGGGAAGAAAGAGGG + Intronic
1097712819 12:62934406-62934428 CGAGAAGCAGGGAGAGAAGAGGG + Intronic
1100578157 12:95912447-95912469 CTAGAAGCAGGGAAGGATGGGGG + Intronic
1101325993 12:103716396-103716418 AAAGATACAGGCAGGGAAGCTGG + Intronic
1101433218 12:104644238-104644260 CCAGATGCAGGGAAGGTAGGGGG - Intronic
1101682769 12:106985667-106985689 CTAGAGGCAGTGAAGGCAGCTGG - Exonic
1101976350 12:109362952-109362974 TTAGATGCAGGGAGTGAAGTTGG + Intronic
1104402129 12:128484961-128484983 AAAGAGGCAGGGAGGGAAGGAGG + Intronic
1106476809 13:30105886-30105908 CTAGAAGCTGTGAGGGAAACAGG - Intergenic
1106682089 13:32018419-32018441 CGAGATGGGAGGAGGGAAGCAGG + Intergenic
1107835571 13:44410102-44410124 CCACGTGGAGGGAGGGAAGCAGG - Intergenic
1110362926 13:74648197-74648219 CTGGATGGAGGGAGATAAGCTGG - Intergenic
1112498609 13:99925164-99925186 CTAGAGGCAGGCAGGGCACCTGG - Intergenic
1112506831 13:99980755-99980777 CTGGAGGGAGGGAGGGAGGCCGG + Intergenic
1113072710 13:106436928-106436950 CCAGAAGCAAGGAGAGAAGCTGG + Intergenic
1113186122 13:107687301-107687323 CTGGATGGAGGGAGGGAAGGAGG + Intronic
1113518618 13:110922012-110922034 CCAGAAGCAGGGATGGAAGCTGG + Intergenic
1113654322 13:112058436-112058458 CTAGGTGCAGGGGAGGAGGCCGG - Intergenic
1113922943 13:113924355-113924377 CCAGATGCCGGGAGGGAGGACGG + Intergenic
1114277725 14:21162625-21162647 CTACAGGCTGGGAGGGAACCCGG + Intergenic
1114339151 14:21724668-21724690 AGAGAGGCAGGGAGGGAAGGAGG - Intergenic
1115149169 14:30264004-30264026 CTATATGGAGGGACGGAAGGAGG + Intergenic
1116389381 14:44374918-44374940 CAGGAAGCAGGAAGGGAAGCAGG - Intergenic
1117857707 14:60052198-60052220 TTACATTCAGGGAGGGAAGAAGG + Intronic
1117912105 14:60646650-60646672 TGAGATGGAGGGAGGGGAGCTGG + Intronic
1118766087 14:68910082-68910104 CTCGGTGGAGGGAGGGATGCCGG + Intronic
1119198028 14:72731969-72731991 CTAGAAGCAGGCAGGGCAGGAGG + Intronic
1119217864 14:72882956-72882978 CTCGATGTAGGGAGGGAGTCAGG + Intronic
1120134520 14:80850047-80850069 ATAGAGGGAGGGAGGGAAGGAGG + Intronic
1120162538 14:81161351-81161373 TAAGAAGCAGGGAGGGAACCGGG - Intergenic
1120177689 14:81312626-81312648 CTAGATGCTGGGAGGCAAGAGGG - Intronic
1121430932 14:93888038-93888060 ACAGAGGGAGGGAGGGAAGCAGG - Intergenic
1121732117 14:96194271-96194293 CTGCATGCAGGGAGGGCAGAAGG + Intergenic
1122126438 14:99581070-99581092 CTGGAGGCAGGGAGGCCAGCTGG + Intronic
1122406536 14:101504346-101504368 CAAGATGCTGGGAGGTAACCAGG + Intergenic
1122816611 14:104317111-104317133 CAGGATGGCGGGAGGGAAGCAGG - Intergenic
1122974653 14:105166123-105166145 CAAGAGGCAGGGAGGTGAGCTGG + Intronic
1124067816 15:26362536-26362558 CTAGAAGCTGGGAGGGGAGATGG + Intergenic
1124333109 15:28837257-28837279 CTAGGTCCAGGGAGGACAGCTGG - Intergenic
1124590496 15:31049343-31049365 CTAGAAAAAGGGAAGGAAGCGGG - Intronic
1125750076 15:42021905-42021927 CTGAATGCAGGGATGGAACCTGG + Intronic
1126066184 15:44827927-44827949 ATGGATGGAGGGAGGGAAGGAGG - Intergenic
1126093648 15:45072636-45072658 ATGGATGGAGGGAGGGAAGGAGG + Intronic
1126370168 15:47937830-47937852 CGAGATGGAGGAAGGGAGGCAGG + Intergenic
1127080645 15:55375379-55375401 CCAGAGGCAGGAAAGGAAGCGGG + Intronic
1127629713 15:60815588-60815610 CTGGCTGCAGTGGGGGAAGCTGG - Intronic
1127630060 15:60819922-60819944 CTGGAAGCAGGCAGGGAAGCAGG - Intronic
1128078509 15:64842652-64842674 CTAGCTGTAGGGAAGGAATCGGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1129326927 15:74805096-74805118 ACGGATGCAGGGAGGGCAGCAGG + Intergenic
1129941011 15:79496580-79496602 CTAGATGCTGGGAATAAAGCAGG + Intergenic
1130353654 15:83111532-83111554 ATAGAAGGAGGGAGGGAAGGGGG - Intronic
1130963512 15:88680817-88680839 CCAGATGCAGAGTGGGAAGGAGG + Intergenic
1132037238 15:98494684-98494706 CTAGATGCAGGGAAGGCTGTTGG - Intronic
1132080520 15:98861028-98861050 ATAGATGGAGGGAGGGAGGGAGG - Intronic
1132609361 16:807579-807601 CTAAATGCAGGGACAGAAGACGG - Exonic
1132613290 16:828370-828392 CAGGAGGCAGGGAGGGACGCTGG + Intergenic
1133839301 16:9394145-9394167 AGAGAGGGAGGGAGGGAAGCAGG - Intergenic
1133899396 16:9959308-9959330 CTAGGTTTAGGGATGGAAGCTGG - Intronic
1135640275 16:24113813-24113835 CTGAATGCAGACAGGGAAGCAGG - Intronic
1138194865 16:55044626-55044648 CTAGATGGAGGGGTGGAGGCTGG - Intergenic
1138416806 16:56876357-56876379 CTAGAGGCAGGGTGGGAGGCTGG + Intronic
1138496993 16:57415062-57415084 CGAGCTGCAGGGAGAGGAGCGGG - Exonic
1140035954 16:71371507-71371529 CTAGAAGCCAGGAGGGAGGCAGG - Intronic
1140557453 16:75938082-75938104 CTAGAGGAAGGGAGGGAAGAGGG - Intergenic
1141510809 16:84510905-84510927 CTACATGGAAGGAGGGTAGCAGG + Intronic
1141526579 16:84615558-84615580 CTGAATTTAGGGAGGGAAGCTGG + Intronic
1142024922 16:87807259-87807281 CTGGAAGCAGGGAGGGAGGAGGG + Intergenic
1142359241 16:89619007-89619029 GGAGCTGCAGGGAGGGGAGCGGG - Intronic
1142359269 16:89619068-89619090 GGAGCTGCAGGGAGGGGAGCAGG - Intronic
1142359281 16:89619098-89619120 GGAGCTGCAGGGAGGGGAGCAGG - Intronic
1142359308 16:89619159-89619181 GGAGCTGCAGGGAGGGGAGCGGG - Intronic
1142359377 16:89619310-89619332 GGAGCTGCAGGGAGGGGAGCGGG - Intronic
1142359463 16:89619492-89619514 GGAGCTGCAGGGAGGGGAGCAGG - Intronic
1143316676 17:6038207-6038229 ATAGATGCAGGGACTTAAGCGGG + Intronic
1143363914 17:6393155-6393177 CGTCACGCAGGGAGGGAAGCTGG + Intergenic
1143520493 17:7441595-7441617 CTGGCTGCAGGGTGGGAAGGGGG + Intronic
1143726141 17:8847939-8847961 CAATAAGCAGGGAGGGATGCTGG - Intronic
1143975208 17:10824414-10824436 CTAGATGCAGAGATAGAGGCAGG + Exonic
1144275960 17:13668187-13668209 CTGGGAGCAGGGAGTGAAGCTGG - Intergenic
1144890520 17:18491539-18491561 CTAGAGACTGGGAGGGAAACTGG + Intronic
1145141697 17:20452779-20452801 CTAGAGACTGGGAGGGAAACTGG - Intronic
1145794209 17:27646137-27646159 CTAGAGACCGGGAGGGAAACTGG + Intronic
1145809010 17:27753678-27753700 CTAGAGACCGGGAGGGAAACTGG + Intergenic
1146434260 17:32828639-32828661 CTACATGCAGAGAGGGAGGGAGG + Intronic
1146820903 17:35983001-35983023 ATGGATGGAGGGAGGGAAGCAGG - Intergenic
1147401170 17:40180856-40180878 CAAGGTGCAGGGAGGGAGCCAGG - Intronic
1147419267 17:40314134-40314156 CCAGAGGTAGGGAGGGAGGCAGG + Intronic
1147469211 17:40642475-40642497 CTACAGGCTGGGAGGGAACCCGG - Exonic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150645730 17:66976456-66976478 CTGGAAGGAGGGAGGGAAGTTGG - Intronic
1151055853 17:71030891-71030913 CTTGAGGAAGGAAGGGAAGCAGG - Intergenic
1151813641 17:76460063-76460085 CTGGATGCAGAGGGGGAAGGGGG - Intronic
1151933855 17:77249321-77249343 CTAGATGCAGGGGGGCCAGGAGG - Intergenic
1152155543 17:78630268-78630290 CTCCATGCAGGGAGGGAATTGGG - Intergenic
1152942515 17:83180382-83180404 CTGGAGGCAGTGAGGGCAGCAGG + Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1157713632 18:49867060-49867082 CAAAATCCAGGGAAGGAAGCTGG + Intronic
1159748541 18:72270696-72270718 CCACATGCGGGGAGGGAAGAAGG + Intergenic
1160529539 18:79555427-79555449 CAAGCTTGAGGGAGGGAAGCCGG - Intergenic
1160863278 19:1246549-1246571 CAAGAGGCAGGGAGGGAGGTGGG + Intergenic
1161329390 19:3678976-3678998 CAAGATGGAGGGAGGGATGGAGG + Intronic
1161610188 19:5238047-5238069 CTGGGTGAAGGGAGGGAAGAGGG + Intronic
1161785115 19:6319735-6319757 CTAGATACAGGGTGGGGAGGGGG - Intronic
1161884295 19:6981818-6981840 CTAGAAGAAGGGATGTAAGCAGG - Intergenic
1162459453 19:10805860-10805882 CAAGATGCCGGGGGGGAAGAAGG - Intronic
1162775037 19:12974452-12974474 CCAGTTGCAGGGAGGGTAGATGG + Exonic
1163238375 19:16043198-16043220 ATGGATGCAGGGAGGGATGGAGG + Intergenic
1163284725 19:16339209-16339231 ACAGATGCAGGGAGGGAGGTTGG - Intergenic
1163621544 19:18363788-18363810 CCAGATGCAGGGAGGAAAATGGG - Exonic
1163829453 19:19540828-19540850 CAGGATGCAGGGAGAAAAGCAGG + Intronic
1164609247 19:29621089-29621111 GTGGATGCAGGGAGGCCAGCGGG - Intergenic
1164670368 19:30068940-30068962 ATAAATGGAGGAAGGGAAGCAGG - Intergenic
1165053448 19:33158102-33158124 CCAGCTCCAGGGAGGGAAGTGGG + Intronic
1166012284 19:39951359-39951381 CTAAGGGCAGGGTGGGAAGCAGG - Intergenic
1166841796 19:45701918-45701940 CCAGCTGCAGGGAGGGATGGAGG + Intronic
1167172734 19:47843978-47844000 CTGGATGCTGAGAGGGAAGGCGG - Intergenic
1167635722 19:50654265-50654287 AGAGATGGAGGGAGGGAAGAAGG - Intronic
925346387 2:3174967-3174989 CTGGAGGCAGGTGGGGAAGCAGG + Intergenic
925350401 2:3197445-3197467 CGAGACGGAGGGAGGGAAGAGGG - Intronic
926037302 2:9645787-9645809 CATGATGCAGGGAGGGAGGAGGG - Intergenic
926133269 2:10318853-10318875 CAAGCTTCAGGGAGGGTAGCAGG - Intronic
926225680 2:10965355-10965377 CCTGGTGCAGGGAGGGCAGCAGG - Intergenic
928089784 2:28367058-28367080 CCAGATGCAGGCAGAGAGGCTGG - Intergenic
928398343 2:30960255-30960277 CTCTAATCAGGGAGGGAAGCAGG + Intronic
928549439 2:32357018-32357040 GGAGAAGCAGGGAGGGAGGCGGG - Exonic
928923783 2:36555207-36555229 TAAGACACAGGGAGGGAAGCGGG - Intronic
929473904 2:42225703-42225725 CTATCTGCAGGGAGGGAAGAAGG - Intronic
929779570 2:44949191-44949213 CTAGGGGCAGGGACGGAAGAGGG - Intergenic
930405846 2:50954636-50954658 AGAGAAGCAGGCAGGGAAGCTGG + Intronic
932221172 2:70000033-70000055 CTCGAAGCAGGGAGGCCAGCAGG - Intergenic
933211786 2:79579203-79579225 ATAGAGGGAGGGAGGGAAGGAGG - Intronic
933654003 2:84872533-84872555 CTAGAGGGAGGGAGGGAAGAAGG + Intronic
934064616 2:88329484-88329506 ATGGGTACAGGGAGGGAAGCAGG - Intergenic
934559692 2:95306760-95306782 CTTGGTGCTGGGAGAGAAGCTGG - Intronic
934613993 2:95760298-95760320 GCAGCTGCAGGGAGGGGAGCTGG - Intergenic
935217760 2:100988293-100988315 CTAGAGGCAAGGAGTGAAGCTGG - Intronic
935953161 2:108349414-108349436 ATGGATGCAGGGATGGATGCAGG + Intergenic
936370162 2:111897123-111897145 CTGTATGCTTGGAGGGAAGCGGG - Intergenic
937583383 2:123516610-123516632 TTGGATGCAGAGAGGGAAGGGGG - Intergenic
937768811 2:125694923-125694945 CTGGCTGCAGGGAGAGAAGAAGG + Intergenic
938262497 2:129905747-129905769 CTGGATGCAGGGATTGAAGCTGG - Intergenic
938791884 2:134683709-134683731 GTAGACGCTGGGAGGGAAGGAGG + Intronic
939819803 2:146943951-146943973 ATACATGCAGGGAGGAAAGCAGG - Intergenic
941543890 2:166821009-166821031 CTAGATGAAGGGAGGCTAGTTGG + Intergenic
942211756 2:173678243-173678265 CAAGAGGGAGGGAGGGAAGAAGG + Intergenic
944719054 2:202404776-202404798 CCAAAAGCAGGGAGGGAAGAGGG - Intronic
945958226 2:216105963-216105985 CAAGAGGGAGGGAGGGAAGGAGG + Intergenic
946498286 2:220218520-220218542 ATAGATTCAGGGAGAGAAGGAGG + Intergenic
946508365 2:220326129-220326151 ACAGAGGCAGGGAGGGAAGAAGG - Intergenic
946680547 2:222210540-222210562 CTAGGAGCAGGGAGGGGAGAGGG - Intronic
948230942 2:236348990-236349012 CAGGATGGAGGGAGGGAAGGTGG - Intronic
948341387 2:237255352-237255374 CCAGATGGAGTGGGGGAAGCTGG + Intergenic
1168937239 20:1675966-1675988 AGGGAGGCAGGGAGGGAAGCAGG - Intergenic
1169075281 20:2756279-2756301 TAAAATGCGGGGAGGGAAGCTGG - Intronic
1169117426 20:3074838-3074860 CTAGATGCAGGGATAGATGTGGG - Intergenic
1169819249 20:9690623-9690645 CTAGATCCAGGGTGGGAAGCAGG - Intronic
1170168625 20:13386583-13386605 CTGGATGGAAGGAGGGAAGAAGG - Intergenic
1170940962 20:20847832-20847854 ATGGATGCAGGGATGGGAGCCGG + Intergenic
1171201104 20:23242963-23242985 GTAGATACAGGGAAGGAAACTGG + Intergenic
1171301452 20:24064462-24064484 CTAGTTGCAGGGAAACAAGCTGG + Intergenic
1173577729 20:44123908-44123930 CTTGATTCAGGGAGGGACCCTGG - Intronic
1173749563 20:45466793-45466815 CTAGTTGCAGAGAGGGAGGATGG + Intergenic
1173851074 20:46218728-46218750 TTGGAAGCAGGGAGGGCAGCAGG + Intronic
1174299021 20:49568515-49568537 TTATATGCGGGGAGGGAAGAGGG + Intergenic
1174466941 20:50725006-50725028 CTAGAGGCACGGAGGGGAGGAGG - Intergenic
1175812381 20:61865152-61865174 CCGGATGCAGCGAGGGATGCAGG - Intronic
1176056597 20:63152249-63152271 CAAGATGGAGCCAGGGAAGCCGG + Intergenic
1176286855 21:5022974-5022996 CTGGAAGGAGGGAGGGAAGGCGG + Intronic
1176649003 21:9528955-9528977 ATAGATGGAGGGAGGAAAGAGGG - Intergenic
1178520997 21:33288489-33288511 CTAGGTGCAGAGAGGGATACTGG - Intronic
1179375720 21:40848342-40848364 CCAGATGCAGGGACAGAATCAGG - Intergenic
1179870326 21:44240501-44240523 CTGGAAGGAGGGAGGGAAGGCGG - Intronic
1181161718 22:20963710-20963732 CCAGATGGAGGGCTGGAAGCAGG - Intergenic
1181365803 22:22376212-22376234 GGAGATGCAGAGAGGGAAGACGG - Intergenic
1181545212 22:23598609-23598631 CTAGGAGGAGGGAGGGCAGCTGG - Intergenic
1181801313 22:25349331-25349353 CTAGGAGGAGGGAGGGCAGCTGG + Intergenic
1181815098 22:25431272-25431294 CTAGGAGGAGGGAGGGCAGCTGG + Intergenic
1181961013 22:26621912-26621934 TTATAGGCAGGGAGGGAAGAGGG - Intergenic
1182175782 22:28286734-28286756 CTAGATCAAGGAAGGGAACCAGG + Intronic
1183288352 22:36982129-36982151 GGAGATGCAGGGAGGGGAGTGGG - Intergenic
1183529794 22:38347203-38347225 CTAGAAGCAAGGAGGGATGAGGG + Intronic
1184717602 22:46290790-46290812 CTAAGTGGAGGGAGGCAAGCTGG - Intronic
1185050883 22:48553418-48553440 TAGGATGGAGGGAGGGAAGCAGG + Intronic
949884177 3:8681282-8681304 AAAGATCCAGGGAGGGAAGAGGG - Intronic
950456759 3:13097332-13097354 CTGGAAGCAGGGAGGGAAAAAGG - Intergenic
950565463 3:13767308-13767330 CGAGGTGCAGGGGGAGAAGCGGG - Intergenic
951526239 3:23655737-23655759 CTAGAAACAGGGATGGAAGAAGG - Intergenic
952061417 3:29515530-29515552 CTAGATGCAGGAAGACAGGCTGG + Intronic
952913776 3:38214634-38214656 CTAGATTCATGGAGTAAAGCAGG + Intronic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953510965 3:43538720-43538742 CTAGATGCAGAGGGGGATGCAGG + Intronic
954087372 3:48256134-48256156 CTAGAGGCAGGCAGGGCAGTTGG - Intronic
954304648 3:49719189-49719211 CTAGGTGCAGGGCGCGCAGCTGG + Exonic
955353779 3:58213728-58213750 CAGGGTGCAGGGAGGGATGCAGG + Intronic
956784941 3:72634772-72634794 CAAGACACAGAGAGGGAAGCTGG - Intergenic
957572158 3:81960923-81960945 CTAGAAGCTCGGAGGGAAGCAGG - Intergenic
958724679 3:97890013-97890035 CCAGAGGCAGGTATGGAAGCAGG + Intronic
959180910 3:102979462-102979484 CTCAAAGCAGGGAGGGTAGCAGG + Intergenic
960415631 3:117381909-117381931 CTAGCTGCATGGAGGGTAGGGGG + Intergenic
960607963 3:119527810-119527832 CAAGATGCAGAGAGAGAAGGAGG - Exonic
962874618 3:139526368-139526390 CTATATGCTGGGAGGGATGACGG + Intronic
962932694 3:140052491-140052513 CTAGAATCAGGGTGGGGAGCAGG - Intronic
964016679 3:151956132-151956154 CTAGAGGCTGGTAGGGAAGGAGG - Intergenic
964310964 3:155391897-155391919 CTGCATGCAGGGAGTGAAGTAGG - Intronic
964691375 3:159453838-159453860 CTAGAATCAGAGAGGCAAGCAGG - Intronic
967059914 3:185862889-185862911 CCAAAAGCAGGGAGGGAAGAAGG + Intergenic
967130807 3:186469195-186469217 CTTGCAGCAGGGAGGGAAGATGG - Intergenic
967268337 3:187711977-187711999 AGAGATGAAGGGAGGGAAACAGG + Intronic
967940938 3:194766071-194766093 TCAGATGCAGGGAGGGAGGGAGG + Intergenic
968086902 3:195877901-195877923 GAAGAAGCAGGGAGAGAAGCGGG + Intronic
968657557 4:1785260-1785282 CTGGGAGCAGGGAGGGGAGCTGG + Intergenic
969780622 4:9399788-9399810 CTAGATGCTGAGAAGGAAGAGGG - Intergenic
969867816 4:10086868-10086890 GCAGATGCAGTGTGGGAAGCAGG + Intronic
970566162 4:17334395-17334417 CTAGTGGCAGGGAGGCAGGCAGG - Intergenic
971287930 4:25308184-25308206 AAAGATGGAGGGAGGAAAGCAGG + Intergenic
972276269 4:37560676-37560698 CTAGATGCAGGGAGGGAAGCTGG - Intronic
979017751 4:115455847-115455869 CTAGCTGCAGGACTGGAAGCTGG + Intergenic
979313701 4:119234387-119234409 TGAGATGGAGGGAGGGAAGCAGG + Intronic
985487543 5:159895-159917 CTGGAGGCCGGGAAGGAAGCGGG - Intronic
985541348 5:489011-489033 GCAGATGCGGGGAGGGAAGCCGG - Intronic
986391892 5:7294779-7294801 CTAGGTCCAGGGAGGACAGCTGG - Intergenic
986516807 5:8573091-8573113 GAAGAGGCTGGGAGGGAAGCTGG - Intergenic
986936647 5:12896269-12896291 CTAGAGGGAGGGAGGGAGGATGG + Intergenic
987336462 5:16901795-16901817 CTAGATGCAGAGAGGGCAATAGG + Intronic
988847266 5:35140931-35140953 CTAGATGTAGGAGGGGAGGCTGG - Intronic
989253017 5:39337551-39337573 CTAGATGCAGGTGTGAAAGCAGG - Intronic
989773048 5:45167959-45167981 GTAGGTGAAGGGAGGGAGGCAGG - Intergenic
994951556 5:106470177-106470199 CCAGAAGCTGGGAGGGAAGCAGG + Intergenic
996383395 5:122885239-122885261 GGAGAGGCAGGGAGGCAAGCAGG - Intronic
996739661 5:126787310-126787332 CTAAGTGCAGGGAGGTAAGTAGG + Intronic
998077477 5:139248253-139248275 CTTTATGGAGGGAGGGAAGGAGG + Intronic
998129218 5:139642994-139643016 CTAGCAACAGGGAGGGGAGCAGG - Intergenic
998225749 5:140324998-140325020 CAAGATGCTGGGTGGGAAGAAGG + Intergenic
998821915 5:146064879-146064901 AAAGATGCAGGGAGGGAGGGAGG + Intronic
999885149 5:155914288-155914310 CTAGATGCTGGGAGGCAATCCGG - Intronic
1000232227 5:159326783-159326805 CTATAAGAAGGGAGAGAAGCAGG + Intronic
1000334883 5:160234828-160234850 GCAGATGGAGGGCGGGAAGCTGG + Exonic
1000767433 5:165309435-165309457 CCAGAAGGAGGGAGGGAAGGAGG + Intergenic
1001220901 5:169900044-169900066 CTAAATGGAGAGAGGGAAGGAGG - Intronic
1001985779 5:176073626-176073648 CTAGCCCCAGTGAGGGAAGCTGG - Intronic
1002231092 5:177764498-177764520 CTAGCCCCAGTGAGGGAAGCTGG + Intronic
1002264246 5:178019250-178019272 CTAGCCCCAGTGAGGGAAGCTGG - Intronic
1003116441 6:3286814-3286836 CTGGGTGCAGGGAGGGAAGCTGG - Intronic
1003308458 6:4948651-4948673 CTACATGCAGGGTGCTAAGCAGG - Intronic
1004696982 6:18042981-18043003 CTAGATGCAGGGTGAGAACTCGG + Intergenic
1004917046 6:20341842-20341864 ACACCTGCAGGGAGGGAAGCAGG + Intergenic
1006080873 6:31565681-31565703 GTAGATACTGGGAGAGAAGCAGG - Intergenic
1006292939 6:33154360-33154382 ATAGATGCAGTGTGGGAAACTGG - Intergenic
1006421494 6:33936825-33936847 CTAGCAGCAGCAAGGGAAGCTGG - Intergenic
1006668167 6:35712709-35712731 CAACATGCAGGGTGGTAAGCTGG + Intronic
1006780859 6:36631511-36631533 CTGGCTCCAGGGAGGGAAGATGG - Intergenic
1006789615 6:36691153-36691175 CTAGAGGCAGTGAGGAAAGGAGG + Intergenic
1007264021 6:40584002-40584024 CAAGAGAAAGGGAGGGAAGCAGG + Intronic
1007341897 6:41195927-41195949 CAAGATGCAGGATGGGGAGCTGG + Intronic
1007686727 6:43671549-43671571 CTAGAGGCAGGCAGGGCAGTTGG - Exonic
1007830550 6:44635013-44635035 CCAGTTGCAGGGAGGGGAGTGGG + Intergenic
1007916905 6:45569531-45569553 CTGGATGGAGGGAGGGAGACTGG + Intronic
1012796546 6:103769563-103769585 CCAGAGGAAGGAAGGGAAGCTGG - Intergenic
1014015886 6:116529452-116529474 CTAACTGTAGGGTGGGAAGCAGG - Intronic
1015893954 6:137998505-137998527 AAAGAAGCAGGGAGGGAAGAAGG + Intergenic
1016123970 6:140376447-140376469 CTAGAGGGAGGGAGGGAGGGAGG - Intergenic
1017771747 6:157649741-157649763 CCAGAGGCAGGGATGGCAGCTGG + Intronic
1017791635 6:157804927-157804949 CCAGAAGCAGGGAGGGAGCCAGG + Intronic
1018565000 6:165142071-165142093 CTAGAGGCAGGGAGGCCAGGAGG + Intergenic
1018781069 6:167066088-167066110 CTAGCTCCAGGGAGGGGAGAGGG + Intergenic
1018859307 6:167699183-167699205 CCAGCTGCAGGGAGGCCAGCTGG + Intergenic
1019918933 7:4150636-4150658 CTGAATGTAGGGAGGGAGGCAGG + Intronic
1020093570 7:5355116-5355138 CTAGCTGCAGGGAGGCCAGAAGG - Intronic
1022613244 7:31899009-31899031 ACAGAGGCAGGGAGGGGAGCAGG - Intronic
1023239408 7:38127791-38127813 CTGGATGGAGGGAAGGAAGGAGG - Intergenic
1023830540 7:44036653-44036675 CAAGGTGCGGGGAGGGGAGCGGG - Intergenic
1024047174 7:45592740-45592762 CGAGCTGCAGGGAGAGAAGGAGG - Exonic
1025934299 7:66022341-66022363 CTAGAGGGAGGGAGGAAAGAAGG + Intergenic
1026178217 7:68016351-68016373 ATGGATGGAGGGAGGGAAGAGGG - Intergenic
1026461769 7:70620857-70620879 CAAGGGGCAGGGAGGGAAACTGG + Intronic
1026534754 7:71230416-71230438 CAAGAAACAGGGAGGGAAGTTGG + Intronic
1026991304 7:74587523-74587545 CTAGACGCAGGCAGGGAGCCAGG - Intronic
1027769996 7:82394314-82394336 CTAGATGAAGGGAGGGAAGAAGG + Intronic
1028739519 7:94257613-94257635 CTAGATGGAGCCAGGGAAGGAGG - Intergenic
1029673122 7:102047570-102047592 CTAGAGGTAGGGAGGGAGGGAGG + Intronic
1029675361 7:102064823-102064845 CTAGAGGGAGGGAGGGAGCCTGG - Intronic
1029740867 7:102490967-102490989 CAAGGTGCGGGGAGGGGAGCGGG - Intronic
1029758861 7:102590140-102590162 CAAGGTGCGGGGAGGGGAGCGGG - Exonic
1032431039 7:131861777-131861799 CTAGAAGCAGGAAGGGACTCTGG - Intergenic
1032854671 7:135824493-135824515 TTAGATGCAGTGAGGGATGCAGG + Intergenic
1033004891 7:137551015-137551037 GTAAAGGCAGGGAGGGCAGCAGG + Intronic
1033463170 7:141565687-141565709 CTGGATGCAGGGAATGAAGGAGG - Intronic
1034266886 7:149785411-149785433 CTGGATCCAGGGAAGGCAGCTGG - Intergenic
1034395371 7:150820338-150820360 GTGGCTGCAGGGAGAGAAGCTGG + Intergenic
1034518379 7:151599860-151599882 CAAGAGGCAGGGAGGTAGGCGGG - Intronic
1035028502 7:155842724-155842746 CCAGAAGCAGGGAGTGAAGAGGG + Intergenic
1035743919 8:1947902-1947924 CTCTATGCTTGGAGGGAAGCAGG - Intronic
1036278057 8:7373721-7373743 CTAGATGCTGAGAAGGAAGAGGG - Intronic
1036343466 8:7938171-7938193 CTAGATGCTGAGAAGGAAGAGGG + Intronic
1036656588 8:10681159-10681181 CTTGGCGCAGGGAGGGAAGGTGG + Intronic
1036681762 8:10879486-10879508 ATAGCTGCAGTGAGGGCAGCGGG - Intergenic
1036838807 8:12098930-12098952 CTAGATGCTGAGAAGGAAGAGGG + Intergenic
1036860595 8:12345173-12345195 CTAGATGCTGAGAAGGAAGAGGG + Intergenic
1036906764 8:12713820-12713842 TAACATGCAGGGAGGGAAGGGGG + Intergenic
1037542696 8:19887732-19887754 CTAGATCCAGGAATGGAAGTGGG - Intergenic
1037687203 8:21151292-21151314 CCATATGCAGGGAGCGAACCTGG + Intergenic
1039096005 8:33886136-33886158 CTACAGGGAGGGAGGGAAGAGGG + Intergenic
1039365924 8:36927929-36927951 CTAGAGGGAGGGAGGGAGGAAGG + Intronic
1040562627 8:48537926-48537948 CTAGCTGCCTGGAGGGAGGCAGG + Intergenic
1041273312 8:56131194-56131216 CTACATCCAGGGCAGGAAGCTGG - Intergenic
1041437437 8:57858128-57858150 CTGGGAGCAGGGAGGGAGGCAGG + Intergenic
1041635220 8:60134990-60135012 CTACAGGCAGGGAGAGCAGCAGG - Intergenic
1041684036 8:60626059-60626081 CTAAATGCAGTGTGGGATGCTGG + Intergenic
1042865016 8:73349395-73349417 AGGGATGCAGGGAGAGAAGCAGG - Intergenic
1043614762 8:82112310-82112332 CTAGGGACAGGGAGGGAAGGAGG - Intergenic
1043982041 8:86654357-86654379 CTTGATGCAATGAGAGAAGCAGG - Intronic
1046472803 8:114700737-114700759 CCAGAGGCTGGGAGGGAAGCAGG - Intergenic
1047306842 8:123659393-123659415 ATAGATGGATGGAGGGAAGATGG - Intergenic
1047351530 8:124078994-124079016 CCAGAAGCTGGGAGGGAGGCAGG - Intronic
1048394286 8:133999014-133999036 CTAGATGCAGGAAGGGTAGGAGG + Intergenic
1049312155 8:141938935-141938957 CTAGGTGCTGGGAGGCAGGCCGG + Intergenic
1050269731 9:3929619-3929641 TTAGAGGCAGGCAGGCAAGCAGG + Intronic
1050511319 9:6399002-6399024 CATGATTCAGAGAGGGAAGCTGG - Intergenic
1052484056 9:29072953-29072975 AGAGATGGAGGGAGGGAAGGAGG - Intergenic
1052733971 9:32321254-32321276 CCAGAGGCTGGGAGGGTAGCTGG + Intergenic
1052903775 9:33817145-33817167 CGAGAAGCAGGGAGGGAGGGAGG - Intergenic
1052956273 9:34255364-34255386 CGAGATACAGGGAGGGAGACAGG + Intronic
1052981224 9:34451181-34451203 CTGGCTGCAGGGAGGGACTCTGG - Intronic
1053737151 9:41108763-41108785 CAAGAGCCAGGGAGGGAAGAGGG - Intergenic
1054691197 9:68322554-68322576 CAAGAGCCAGGGAGGGAAGAGGG + Intergenic
1054844399 9:69777726-69777748 CCAGATGCAGAGAATGAAGCTGG - Intergenic
1055619065 9:78104829-78104851 GAAGATGAAGGGAGGGAAGAAGG - Intergenic
1055767624 9:79681732-79681754 CTGGAGGCAGGGAGGGAAGGAGG + Intronic
1056838385 9:89976855-89976877 CCAGATGTAGGAAGGGCAGCTGG + Intergenic
1056932910 9:90893485-90893507 GTAGATGAAGGGAGAGAAGGAGG + Intronic
1057133951 9:92673483-92673505 ATAGAGGAAGGGAGGGAAGAAGG + Intergenic
1058688128 9:107495733-107495755 GTAGAGGCAGGGAGGGAGTCAGG + Intergenic
1059031750 9:110705437-110705459 CTAGATGGAGGAAGTGAAGGGGG + Intronic
1060488619 9:124065519-124065541 CTGAATGGAGGGAGGGAGGCAGG + Intergenic
1062088005 9:134658525-134658547 CTAGCTGCAGGAAGGGGAGGTGG - Intronic
1062201841 9:135307096-135307118 TTACCTGCAGGGAGGGAAGGTGG - Intergenic
1062554097 9:137106286-137106308 GTGGATCCAGGGCGGGAAGCAGG + Exonic
1062723763 9:138059379-138059401 CTAGGTCCTGGGAGGGAGGCAGG + Intronic
1203626739 Un_KI270750v1:32504-32526 ATAGATGGAGGGAGGAAAGAGGG - Intergenic
1185768008 X:2741566-2741588 CTAGCTGCAGGGAGAGTATCTGG - Intergenic
1187400110 X:18951569-18951591 AGAGATGGAGGGAGGGAAGAAGG + Intronic
1188005842 X:25015346-25015368 CTGGAAGCAGGGAGGGAGGGAGG + Intronic
1188482856 X:30652890-30652912 CCAGATGCAGGGAGGTGGGCGGG + Intergenic
1188506059 X:30886014-30886036 TTTGAAGCAGGGAGGGAAGTAGG + Intronic
1189225917 X:39413168-39413190 CTTGATGCAGTGAGAAAAGCAGG + Intergenic
1189280313 X:39816395-39816417 CTAGAGGCAGGCAGGCCAGCCGG + Intergenic
1189487629 X:41445413-41445435 CTTGCTGCAGGGAGAAAAGCAGG - Intergenic
1190378170 X:49811644-49811666 CTGGTTGTAGGGAGGGGAGCAGG + Intergenic
1190984890 X:55491224-55491246 CTTTATGCAGGCAGGGAGGCAGG + Intergenic
1192219570 X:69188223-69188245 GTACATGGAGGGAGGGAAGGAGG - Intergenic
1192326021 X:70133246-70133268 CTAAGTGCACGAAGGGAAGCCGG + Intergenic
1192549834 X:72045108-72045130 CTAGATGCTGGGAAGGCTGCTGG - Intergenic
1196974183 X:121140665-121140687 CTTGAAGCAGGGAGGGAGGCTGG + Intergenic
1198106583 X:133467900-133467922 CTAAATGGAGGGAGTGAAGTAGG - Intergenic
1198578992 X:138042555-138042577 ATAGAGGGAGGGAGGGAAGAAGG + Intergenic
1198963844 X:142207714-142207736 CTAGAAGGAGGCAGGGAAGTGGG - Intergenic
1199341271 X:146680061-146680083 CTGGATACAGGGAGGGAGGGTGG - Intergenic
1199872536 X:151912497-151912519 CGAGATCCACGGAGGGAAGCAGG + Intronic