ID: 972278568

View in Genome Browser
Species Human (GRCh38)
Location 4:37582066-37582088
Sequence AGGGAGAGTACAGTGATTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 551
Summary {0: 1, 1: 2, 2: 9, 3: 109, 4: 430}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972278568_972278578 26 Left 972278568 4:37582066-37582088 CCCCAAATCACTGTACTCTCCCT 0: 1
1: 2
2: 9
3: 109
4: 430
Right 972278578 4:37582115-37582137 ACGACATGCAGCCACTGCCAAGG 0: 1
1: 1
2: 2
3: 21
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972278568 Original CRISPR AGGGAGAGTACAGTGATTTG GGG (reversed) Intronic
902435053 1:16393133-16393155 AGGGAGAGGAAAGTGATGAGAGG + Intronic
902804646 1:18853501-18853523 AGGAAGTGAACAGTTATTTGAGG + Intronic
905120882 1:35681008-35681030 AGACAGATTGCAGTGATTTGGGG - Intergenic
905739816 1:40360692-40360714 AAGGAGAGCACAGTGATTGTGGG + Intronic
905740222 1:40363792-40363814 AAGGAGAGTGCAGTGATTGTGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
909146501 1:71940068-71940090 AGGGGGAGTTCAGTGAAGTGAGG + Intronic
909582462 1:77253467-77253489 AGGGAGAGTGAAGTGATTGTGGG + Intergenic
909584198 1:77270795-77270817 TGGGAGAGTAGAGTGTTTTAGGG - Intergenic
910087192 1:83417553-83417575 AGGAAAAGTACAGAGATTGGAGG - Intergenic
910384225 1:86664350-86664372 AGGCAGAGCACAGTGATTACAGG + Intergenic
910384430 1:86665570-86665592 AGGCAGAGCACAGTGATTACAGG - Intergenic
910422437 1:87080768-87080790 GGGGAGAGCACAGTGATTGCGGG + Intronic
910470525 1:87547745-87547767 AGGGAGAGGACAGTGACTGTGGG - Intergenic
910724845 1:90327793-90327815 AGGGAGAATGCAGTGATTGTGGG + Intergenic
910801255 1:91149060-91149082 AGGGGGAGCACAGTGATTGTGGG - Intergenic
912559898 1:110543224-110543246 ATGGACATTACAGTGATTTATGG - Intergenic
912626329 1:111207418-111207440 GCTGAGACTACAGTGATTTGAGG - Intronic
912643821 1:111372275-111372297 AGGGAGAGCACAGTGATTGTGGG + Intergenic
912871407 1:113310480-113310502 AGGGAGAGCACAGGGATTGTGGG + Intergenic
915493174 1:156263041-156263063 AGGGAGAGAACATTGAGTAGAGG - Intronic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
915941362 1:160120515-160120537 AGGGAGTGGACAGGGTTTTGTGG - Intronic
917306127 1:173627467-173627489 AGGGAGAGCACAGTGACTGTGGG + Intronic
917397037 1:174604346-174604368 AGGGAGAGGACAGTGATTGTGGG - Intronic
917632752 1:176905967-176905989 AGGAAGAGACCAGTGATGTGAGG + Intronic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
918377930 1:183927907-183927929 AGGGAAAGTTTAGAGATTTGCGG + Exonic
919835372 1:201569621-201569643 AGGGAAGGTACAGTGATTCTGGG + Intergenic
921746123 1:218742679-218742701 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
922123586 1:222700104-222700126 ATGTAGTATACAGTGATTTGGGG + Intronic
922377032 1:224979326-224979348 AGGGAGAGTGCAGTGCTTGTGGG + Intronic
922531565 1:226349134-226349156 TGGGAGAGGACAGTGCTTTGTGG + Intergenic
923613206 1:235513549-235513571 AGGGAGAGTACTGTGAGTTGAGG + Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1063317547 10:5021102-5021124 ACGGAGAGAACAGGGGTTTGGGG - Intronic
1064987630 10:21226675-21226697 AGGGAGAGTAAAGTGATTGTGGG - Intergenic
1065259170 10:23907036-23907058 AGGCAGCGTACAGTCATTTATGG + Intronic
1065587016 10:27228643-27228665 AGGGAAAGTAATGTGGTTTGAGG - Intronic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067324464 10:45253729-45253751 GAGGAGAGCACAGTGATTGGAGG + Intergenic
1068169815 10:53378705-53378727 ACGGAGAGTGGAGTGATGTGGGG + Intergenic
1068665495 10:59671080-59671102 AGGGAGGGTACAGTCATTTGTGG + Intronic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1069555898 10:69398489-69398511 TGGATGAGTACAGTGATTGGGGG + Intronic
1070059556 10:72968675-72968697 AGGGAAAGTACAGTAACTGGGGG - Intergenic
1071002464 10:80845545-80845567 AGAGAGAGTAAAATGATCTGGGG + Intergenic
1071717620 10:88113235-88113257 AGGGAGAGGGGAGGGATTTGAGG + Intergenic
1072492500 10:95921317-95921339 AGGGAGAGTTAAGTGATTGGGGG - Intronic
1072857504 10:98964548-98964570 ATAGAGAGTAGAGTGATTAGTGG - Intronic
1073042669 10:100618077-100618099 AGAGAGAGGACAGTGCCTTGAGG - Intergenic
1073827212 10:107337478-107337500 AGGGAGATCACAGTGACTGGGGG - Intergenic
1074670051 10:115780154-115780176 AGGGAGAGCACAGTGATTGTGGG + Intronic
1074944491 10:118268181-118268203 AGTGAAAGGACAGTGATGTGTGG - Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1076633528 10:131867732-131867754 AGGGAGAGCGGAGTGGTTTGTGG + Intergenic
1077928049 11:6702061-6702083 AGAGAAGGTACAGTGATTAGAGG + Intergenic
1078690783 11:13578735-13578757 AGGGAGAGTGCAGGGATTGCGGG + Intergenic
1079416299 11:20239182-20239204 AAGGAGAGCACAGTGACTGGGGG - Intergenic
1079532894 11:21476796-21476818 AGGGAGAGCACAATGATTGTGGG + Intronic
1080317163 11:30963392-30963414 AGGAAGAGAAAATTGATTTGGGG - Intronic
1081245653 11:40763653-40763675 AGGGAAAGCACAGTGATTGTGGG + Intronic
1083516570 11:63264327-63264349 AGGGAGAGGAAAGCGGTTTGAGG - Intronic
1084605180 11:70168135-70168157 AGGGAGAGTCCAGAGCTGTGCGG - Intronic
1084739829 11:71132396-71132418 AGGGGGAGTATTGTGGTTTGGGG - Intronic
1084991841 11:72933167-72933189 GGGCAGAGGACAGTGGTTTGAGG - Intronic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1085727525 11:78967165-78967187 AGGGAGAGTCCAGGGAGTTGTGG - Intronic
1086847921 11:91774415-91774437 AGGGAGAGCACAGCGATTTTAGG - Intergenic
1086978716 11:93169047-93169069 AAGGAGGGTACACTGTTTTGGGG - Intronic
1087370595 11:97279249-97279271 AGGGACAGTGCAGGGATTGGAGG + Intergenic
1087507871 11:99050287-99050309 AGGCAAACTAAAGTGATTTGTGG + Intronic
1087600473 11:100308447-100308469 AGGAAGACCACAGGGATTTGAGG + Exonic
1088944582 11:114496313-114496335 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1090014824 11:123076673-123076695 AGGGAGAGTAGAGGGAGATGAGG + Intronic
1090210492 11:124917566-124917588 AGGGAGAGTGCAGTCATTGTGGG - Intergenic
1090439474 11:126713877-126713899 AGGGGGAGCACAGTGCTTGGAGG + Intronic
1091821532 12:3479162-3479184 AGGCAGAGGACAGAAATTTGAGG - Intronic
1092763317 12:11829098-11829120 AGGCCCAGTACAGTGCTTTGAGG - Intronic
1093941920 12:25064633-25064655 AGAAAAAGTAGAGTGATTTGTGG + Intronic
1095101014 12:38183924-38183946 AGAGAGAGCACAGTGACTGGAGG + Intergenic
1095407623 12:41885089-41885111 AGGGAGAGTAATGAGAATTGGGG - Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096973098 12:55683049-55683071 AGGGAGAGTATAGTGAGGCGAGG + Intronic
1097216781 12:57420252-57420274 AGAGAGAGGACAGTAATTAGAGG - Intronic
1097376236 12:58846324-58846346 AAGGAAAGTACACTGATCTGTGG + Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098032782 12:66271541-66271563 AGGAAGAGTTCAGTGCATTGCGG - Intergenic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1099491305 12:83292060-83292082 AGGGAGAGTGTAGTGATTGTGGG + Intergenic
1099635504 12:85206376-85206398 AGTGAGAGTGCAGGGATATGGGG + Intronic
1102260725 12:111441772-111441794 CGAGAGAGGACAGTCATTTGTGG - Intronic
1102328031 12:112005738-112005760 AGAGAGAATACAGAGATGTGTGG + Intronic
1102475112 12:113183852-113183874 GCGGAGAGTACAGTGAGCTGTGG - Intronic
1102574606 12:113848433-113848455 AGTGTGAGGACAGTGATTTGAGG + Intronic
1104284184 12:127408442-127408464 AGAGACAGTAAACTGATTTGTGG - Intergenic
1104572345 12:129935968-129935990 AGGGAGAGTACACTGAGTCCGGG + Intergenic
1106033776 13:26025759-26025781 TGGGAGAATTTAGTGATTTGTGG + Exonic
1107238159 13:38198140-38198162 AGGGAAAGTACACTCATCTGTGG + Intergenic
1107515819 13:41128168-41128190 AGGGAGAGAAATGTGTTTTGGGG - Exonic
1107753960 13:43599367-43599389 AGGGAGAGTGCAGTGATAGTGGG + Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1108741253 13:53340930-53340952 AGGGAGAATACAGTTATTTCAGG + Intergenic
1109936401 13:69291352-69291374 AATGAGAATACAATGATTTGGGG - Intergenic
1109961760 13:69640024-69640046 AGGGAGAGCACAATGATTGCGGG - Intergenic
1110448876 13:75618612-75618634 AGGGAGAGTAGAGTGATTATGGG - Intergenic
1111335459 13:86815765-86815787 AGGGAGAGTGCTGTGATTGTGGG + Intergenic
1111639193 13:90946625-90946647 AGGGAGAGCATAGTGATTGTGGG + Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1114417208 14:22552836-22552858 AGGGAGAGCGCAGTGAGCTGTGG - Intergenic
1114820428 14:26011235-26011257 AGAGAGAGTAAAGAGATTGGAGG + Intergenic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116238976 14:42316367-42316389 AGGAGAAGTACAGTAATTTGGGG - Intergenic
1116354700 14:43914009-43914031 AGGGACAGCACAGTGATTGTGGG + Intergenic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1116489938 14:45493316-45493338 AGGGAAAGCACAGCAATTTGAGG - Intergenic
1116888951 14:50249001-50249023 AGGGAGGGTACAGTGGCTGGGGG + Intronic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117208572 14:53470823-53470845 AGAGAGAGCACAGTGATTGTGGG - Intergenic
1118034282 14:61849623-61849645 AGGGAGAGCATAGTGATTGTGGG - Intergenic
1118431284 14:65720949-65720971 AGGGGGAGCACAGTGATTGTGGG - Intronic
1119377427 14:74206172-74206194 TAGCAAAGTACAGTGATTTGAGG - Intergenic
1120143120 14:80950693-80950715 AGGGAGAGGAAAGTGATAAGGGG + Intronic
1121472499 14:94166166-94166188 AGGGAGAGGGCAGTGAGATGGGG - Intronic
1121568086 14:94925577-94925599 AGGGAGGGTAAAAAGATTTGGGG + Intergenic
1122145456 14:99685963-99685985 AGGAAAATTACAGTGATTTCAGG - Intronic
1122593625 14:102873163-102873185 CAGGTGAGTGCAGTGATTTGAGG + Intronic
1122672637 14:103384443-103384465 AGGGAGAGTAGTGTGAGATGGGG - Intergenic
1123561835 15:21501487-21501509 AGGAAGATTTCAATGATTTGGGG + Intergenic
1124014957 15:25866135-25866157 AGGGAGCGTTCAGGGATTTCAGG + Intergenic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126596438 15:50388419-50388441 AGAGAGAGTAAAGTTATCTGGGG + Intergenic
1126706749 15:51413490-51413512 AGGGAGAGGACAGTAATTGTGGG + Intergenic
1126858189 15:52859161-52859183 AGGGAGAGCTCAGTGAGGTGAGG + Intergenic
1126894994 15:53248226-53248248 AGGAAAGGTACATTGATTTGGGG - Intergenic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1128068889 15:64781397-64781419 AGGGAGAGCTCAGGGATTTGGGG - Intergenic
1129237463 15:74232348-74232370 AGGGAGACTACAGCGCCTTGGGG + Intergenic
1129901509 15:79154713-79154735 AGCGAGACTAGAGTTATTTGAGG - Intergenic
1130007661 15:80116230-80116252 AGGGAGAAAACACTGATTTTTGG - Intronic
1134631934 16:15762648-15762670 AGGGGGAGGCCAGTGAGTTGGGG - Intronic
1135927486 16:26708352-26708374 TGGGAGAGGGCAGGGATTTGAGG - Intergenic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1137320910 16:47380629-47380651 AGGGAGAGTGGGGTGAGTTGTGG + Intronic
1137384068 16:48025321-48025343 AGGGAGAGAACAGGCAGTTGTGG - Intergenic
1137554702 16:49463265-49463287 AGGGAGAGTGCACTGAGGTGAGG - Intergenic
1138163002 16:54773802-54773824 AGGGAGTGTACAGAGCTTTGGGG + Intergenic
1138890836 16:61142466-61142488 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1141757285 16:85999739-85999761 AGAAAGTGTAAAGTGATTTGGGG - Intergenic
1142794272 17:2295250-2295272 AGGGAGAGCAGCGTGATTTATGG - Intronic
1143413585 17:6728429-6728451 AGGGAGAGTAGAGTGATTGTGGG + Intergenic
1143479303 17:7219493-7219515 AGGGAGGGTACAGTGGTGGGGGG - Exonic
1145069085 17:19787910-19787932 AGGGAGAGTGCAGCAATTTGGGG + Intronic
1145201016 17:20944751-20944773 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1145840910 17:27993596-27993618 TGGGAGACTACAGTGTGTTGAGG - Intergenic
1146098965 17:29960133-29960155 AGGGAGAGCACAGTGACTGTGGG - Intronic
1146412185 17:32596053-32596075 AGGCAGAGGAAAGTGAATTGTGG + Intronic
1148159080 17:45439879-45439901 GGGGAGGGTACAGTGAATTTGGG - Intronic
1148916233 17:50981609-50981631 AGGGAAAGAAATGTGATTTGGGG + Intronic
1149188436 17:54029953-54029975 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149416553 17:56465850-56465872 AGGGAATGTGCAGTCATTTGGGG + Intronic
1150541391 17:66103824-66103846 AGGAAGAGCACAGTGATTGTGGG + Intronic
1150870897 17:68910321-68910343 AGGGAGAGGACAGTCATTGTGGG + Intronic
1151249474 17:72822626-72822648 AGGGAGAGAAGGGTGATTTGAGG + Intronic
1151817444 17:76478250-76478272 AGAGGAAGTACAGTGCTTTGAGG - Intronic
1151902470 17:77025720-77025742 AAAGAGGGTACATTGATTTGGGG + Intergenic
1153326559 18:3826629-3826651 AAGGTGAGGACAGTGATTTGGGG + Intronic
1153356707 18:4144413-4144435 AGGGAGAACACAGTGATTGTGGG - Intronic
1155442038 18:25872235-25872257 AGGGGAAGTACAGGGATCTGGGG - Intergenic
1155443292 18:25884416-25884438 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1157608343 18:48940126-48940148 GGGGAGGGTACACTGTTTTGGGG - Intronic
1157879197 18:51304113-51304135 AAGGAGAGTGCAGTGATTGTGGG + Intergenic
1157941697 18:51935750-51935772 GGGGAAACTACAGTGATCTGGGG - Intergenic
1158123412 18:54075807-54075829 TGGGAGCGTTCAGTGATTTGAGG - Intergenic
1158592892 18:58792256-58792278 AGGGAGAGGACAATGATTCCGGG - Intergenic
1158874566 18:61720719-61720741 AGTGAAAGTACAGAGATTTATGG - Intergenic
1159303815 18:66613836-66613858 AGGAAAAGTACAGTGATTGAAGG - Intergenic
1159802680 18:72920395-72920417 AGGGAGAGCACAGTCATTATGGG - Intergenic
1160624540 18:80193984-80194006 ATGGAAAGTACAGAGATATGGGG + Intronic
1161467462 19:4439590-4439612 AGGGAGGGCCCAGTGACTTGAGG + Intronic
1163805798 19:19396529-19396551 ATGGAGAGTACAGTAAGGTGAGG - Intronic
1164505004 19:28852659-28852681 AGGGTGAGTAGAGTGCTTTGTGG - Intergenic
1166214097 19:41324589-41324611 TGGGACAATTCAGTGATTTGGGG - Exonic
1166301563 19:41914377-41914399 AGGGAGAGGGCAGTGAGGTGGGG - Intronic
1167007823 19:46787147-46787169 AGGGAGAAGAAAGTGATTTGGGG - Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
926320042 2:11743345-11743367 AGGGAGAGGACAGTGATCCTCGG - Intronic
926518750 2:13883412-13883434 AGGGAGAGCACAGTGATTGCGGG + Intergenic
928468050 2:31541776-31541798 ATGGACAGTACAGTGATTGTGGG + Intronic
928483956 2:31710992-31711014 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
928847610 2:35696689-35696711 AGGGAGAGCAAAGTGACTGGGGG - Intergenic
930288943 2:49468769-49468791 AGGGAGAGCACAGTGATTGTGGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
930778157 2:55196028-55196050 AGGAAGAGTGCAGTGATTGTAGG + Intronic
930895546 2:56441412-56441434 AGGTAGAGCACAGTGATTGTGGG - Intergenic
930981271 2:57528779-57528801 AGGGAGAGTTAAGTGATTGTGGG - Intergenic
931297116 2:60938089-60938111 AGGGAGGGGACTGTGAATTGAGG + Intergenic
933338275 2:80987575-80987597 AGGGAGAATTCCCTGATTTGGGG - Intergenic
934014677 2:87866911-87866933 AGGAAGGATACAGTGATTTAAGG + Intergenic
934039809 2:88118414-88118436 AGAGTAAGTACAGTGATTGGTGG - Intergenic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
935619278 2:105114605-105114627 GGGGAAAATACAGTGATTTTTGG + Intergenic
936511403 2:113150406-113150428 AGGGATAGTGCAGTGATTGCCGG - Intergenic
936703805 2:115045580-115045602 AGGGTGAGTGCAGTGATTGCGGG - Intronic
936940504 2:117879297-117879319 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
939171371 2:138700167-138700189 AGGGATAATAAAGGGATTTGGGG - Intronic
939304510 2:140393498-140393520 AGGAAGAGGACTGTAATTTGGGG + Intronic
940390376 2:153125883-153125905 ATGTAGAGTATAGTCATTTGAGG + Intergenic
940795252 2:158070867-158070889 AGGGAGAGCACAGTGACTGTAGG + Intronic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
941050794 2:160731415-160731437 AGGCAGGGTACAGAGAATTGGGG + Intergenic
941189136 2:162354811-162354833 ATGGAGAGTAAACTGATTTAAGG - Intronic
941228937 2:162884631-162884653 AGGAAGATTGCAGTGATCTGAGG + Intergenic
941742138 2:169046599-169046621 AGGGAGAGCACAGTGACTGTGGG + Intergenic
941746094 2:169088292-169088314 AGGGAGAGCACAGTGATTGTGGG - Intronic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943117607 2:183692442-183692464 AGGGAGAGCACAGTGAATGGGGG - Intergenic
943177104 2:184490663-184490685 AGGGAGAGCAGAGAGATTGGGGG + Intergenic
943844982 2:192634470-192634492 AGGGAGAGTACAGTGATTCTGGG + Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
943913010 2:193592441-193592463 AGGGAGAGGACCGTGACTGGGGG + Intergenic
943933490 2:193885306-193885328 AGGGAGAATAAAGTGACTGGTGG + Intergenic
943937979 2:193948754-193948776 AAGCAGAGGACAGAGATTTGTGG + Intergenic
943966598 2:194342029-194342051 TGGGAGAATACAGGGAATTGGGG + Intergenic
944133379 2:196370828-196370850 AGGGAGAATGCAGTGATTGTGGG - Intronic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
945727911 2:213495566-213495588 AGGGAGATTACATTGATTGAAGG + Intronic
946632601 2:221686882-221686904 AGGTAGAGTATAGAGATTAGAGG - Intergenic
947009273 2:225547616-225547638 AAGGAGAGTATAGTGATTGTGGG - Intronic
947247489 2:228065766-228065788 AGAGACAGTGCATTGATTTGAGG + Intronic
947505344 2:230704243-230704265 AGGGAGAGCACAGTGATTGCAGG - Intergenic
949030836 2:241796621-241796643 AGGGAGAGAACAGTGGGATGTGG - Intronic
1168748203 20:263170-263192 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1169988613 20:11474248-11474270 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1170311409 20:14996693-14996715 AAGGAGAGTGCAGTGATTGTAGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1174610795 20:51796903-51796925 ATTGATAGTACAGTGGTTTGTGG - Intronic
1174691686 20:52512472-52512494 AGGGAAAGGACACTGACTTGGGG - Intergenic
1175024045 20:55882704-55882726 AGGGAGATCAATGTGATTTGAGG + Intergenic
1175632274 20:60551207-60551229 AGAGAGAGTGCAGTGATTGTAGG - Intergenic
1177539734 21:22477109-22477131 AGGGAGAGTGCAGTAATTGTAGG + Intergenic
1178560158 21:33631346-33631368 AAGGAAAGTACTGTAATTTGAGG + Intronic
1179249958 21:39664313-39664335 AGGCAGAGTACGGAGGTTTGGGG - Exonic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1181744566 22:24946843-24946865 GGGGAGAGTATAGTGTTTTCTGG + Intergenic
1183096721 22:35556479-35556501 TGGGAGAGTCCAGTGAGTTGGGG + Intergenic
949828228 3:8185442-8185464 AGGGACAGTGCAATGATCTGTGG - Intergenic
949928484 3:9060074-9060096 AGGGGAAGGGCAGTGATTTGGGG - Intronic
950985155 3:17355735-17355757 AGGCTGAGTACTGTGTTTTGAGG + Intronic
951029399 3:17864124-17864146 AGGGAGAGCACAGTGACTGTGGG - Intronic
951129822 3:19029372-19029394 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
951279667 3:20732346-20732368 AGGGAGAGTGCAGAGATTGTGGG - Intergenic
951437096 3:22677188-22677210 AGGGATAGCACAGTGATTGTGGG - Intergenic
952087438 3:29842796-29842818 AGAGAGATTATAGTGATGTGAGG + Intronic
952093183 3:29916200-29916222 AGAGAGAGTACAGGGATATGAGG - Intronic
952725639 3:36581816-36581838 AGGGAGAGTACAGTAATTGTGGG + Intergenic
953405091 3:42656015-42656037 AGGGAGAGCAGAGAGATCTGGGG + Intronic
953643941 3:44736183-44736205 AAGGAGAGAACAGTGTCTTGGGG + Exonic
955585332 3:60471512-60471534 AAGGAGAGTGCAGTGATTGTGGG - Intronic
955761111 3:62283786-62283808 TAGGAGAGTACTATGATTTGAGG - Intronic
956728627 3:72177116-72177138 AGGGAGAGGACAGTGGGGTGAGG + Intergenic
957163880 3:76645609-76645631 AGGGAGAGGACTGTTATCTGAGG + Intronic
957485589 3:80858413-80858435 AGGGAGAGCACAGTGATTGAGGG + Intergenic
957965724 3:87320984-87321006 AGGGAGAGTACAGTGATTGTGGG + Intergenic
957971168 3:87384509-87384531 AGGCAGAGCACGGAGATTTGGGG - Intergenic
957976229 3:87448189-87448211 AGGAAGAGTAGAGTGATTTTGGG - Intergenic
958670522 3:97197976-97197998 AGGGAGAGCACGGTGATTGTAGG - Intronic
958760055 3:98296223-98296245 AGGGAGAGAACACTGATTGTGGG + Intergenic
959126059 3:102291325-102291347 AAGGAGAGCACAGTGATTGTGGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
959758450 3:109927833-109927855 AGGCAGAGTACTGGGCTTTGGGG - Intergenic
959868576 3:111300352-111300374 AAGGAGAGCACAGTGATTGTGGG - Intronic
960404029 3:117238062-117238084 AGGGACAGCACAGTGATTGTGGG + Intergenic
960471947 3:118076375-118076397 AGGGAGAGCATAGTGATTATGGG - Intergenic
961764931 3:129202432-129202454 AGGCAGAGCACAGAGATTTTGGG - Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962709018 3:138070126-138070148 AGGGAGGGGACAGGGACTTGGGG - Intronic
962827667 3:139111762-139111784 AGGCAGAGAGCAGGGATTTGGGG + Intronic
962997976 3:140650720-140650742 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
963528851 3:146447985-146448007 AGGGAGAACACAGTGATTGTGGG - Intronic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
963921270 3:150908179-150908201 AGGGAGGGTACAGAAATATGTGG + Intronic
964179222 3:153864281-153864303 AAGGAAAGCACAGTGATTTAGGG + Intergenic
964259037 3:154812391-154812413 AGGGAGAGCACAGTGATTGTGGG - Intergenic
964349690 3:155790661-155790683 GGGGAGAGTACATTGATTATGGG + Intronic
964583008 3:158260866-158260888 AGGGAAAGTACAGTGATTGTGGG - Intronic
964686664 3:159403487-159403509 AGAGAGAGTGCAGTGATTGAGGG + Intronic
965027096 3:163316168-163316190 AGTGAGAGCAAAGTGATTGGAGG - Intergenic
965379141 3:167966775-167966797 AGGGAAAGCACAGTGATTTTAGG + Intergenic
965596145 3:170413337-170413359 AGGCAGAGTACAGCTCTTTGTGG - Intergenic
965844395 3:172945580-172945602 AGGGAGAATACAGTAATTGTGGG + Intronic
966905900 3:184525720-184525742 AGGGAGAGGACTGGAATTTGGGG + Intronic
967463915 3:189780305-189780327 AAGAAGGGTACAGTGATTTGGGG - Intronic
967677360 3:192316458-192316480 AAGGAGAGTACAGTGGTTGTGGG + Intronic
967697061 3:192544177-192544199 AGGGAGAGCACAGTGATTGTGGG - Intronic
969197783 4:5576849-5576871 AGGCACAGGACAGTGATTTCAGG - Intronic
969224682 4:5787801-5787823 AGGGAGAGGAGAGTGAGGTGGGG - Intronic
970930408 4:21504689-21504711 AGTTAGAATACAATGATTTGGGG + Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971114509 4:23629280-23629302 ATGGTGAGTTCAGTGAGTTGGGG + Intergenic
972125399 4:35758931-35758953 AGGGAGATTGCAGTGATTGTGGG - Intergenic
972253678 4:37331879-37331901 AGGGAGAGTACAGTGATTGTGGG + Intronic
972271200 4:37512035-37512057 AGGGAGAGCACAGTGATTGTGGG - Intronic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
972726444 4:41749928-41749950 AAGGAGCGAGCAGTGATTTGTGG + Intergenic
973255816 4:48112152-48112174 AATGAGAGAACAGTGATTTCAGG - Intronic
973287945 4:48440428-48440450 AGGGAGAGCACAGTGACTGTGGG - Intergenic
973348443 4:49082258-49082280 AGGGAAAGTGCAGTGATTGTGGG + Intergenic
973919938 4:55674326-55674348 AAGGAGAGTACAGTGATTGTGGG - Intergenic
975295139 4:72726123-72726145 AGGGAGAGCACAGTGATTGTGGG + Intergenic
975746578 4:77481024-77481046 AGGGAGAGTTTGTTGATTTGAGG + Intergenic
976721951 4:88177769-88177791 AGGGAGAGCACAGCGATTATGGG + Intronic
977134168 4:93281402-93281424 AGGGAGAGAACAGTCATTGCAGG + Intronic
977544609 4:98362713-98362735 AGGGAGAGAACAATAATTTGTGG - Intronic
977644389 4:99395645-99395667 AGGGAGAGTGCAGTGATAGTGGG + Intergenic
978233968 4:106434968-106434990 AGGCAAAGGACAGTAATTTGGGG + Intergenic
978654252 4:111048211-111048233 AGGGAGAGCACAGTGATTGTGGG + Intergenic
978925611 4:114239392-114239414 AGTGAGACTGCAGTGAGTTGTGG - Intergenic
979213391 4:118133372-118133394 AGGGAGAGCACAGTGACAGGGGG - Intronic
979565189 4:122146462-122146484 AAGGAGAGTGCAGTGATTGTGGG - Intergenic
979945725 4:126829535-126829557 AGGGAAAGCACAGTGATTGCGGG + Intergenic
979958243 4:126982121-126982143 AGAGAGAGTGAAGAGATTTGAGG + Intergenic
981140122 4:141258677-141258699 AGGGAGAACACAGTGATTGTGGG + Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
982074773 4:151727468-151727490 AGGGAGGTTACAGTGGTTGGTGG + Intronic
982280862 4:153682765-153682787 ATGCAGAGGACACTGATTTGTGG + Intergenic
982932570 4:161428075-161428097 AAGGAGAGTGCAGTGGTTTTAGG + Intronic
983276538 4:165624377-165624399 AGAGAAAGTACTGTGATTTGGGG - Intergenic
983338182 4:166422024-166422046 AGGGAGAGCACAGTGACTGTGGG - Intergenic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
983852353 4:172596977-172596999 AAGGAAAATACAGTAATTTGAGG + Intronic
984792437 4:183627022-183627044 ATGGGGAGTATGGTGATTTGTGG - Intergenic
985478553 5:92799-92821 TGGGACAGAACAGTGATCTGTGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986371533 5:7085365-7085387 AGAGTGAGTACAGTGCGTTGTGG + Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986714331 5:10511758-10511780 AGGGAGTGCACAGTGCTGTGAGG - Intronic
987105804 5:14637829-14637851 AGTGAGAGAAAAGAGATTTGAGG - Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987886184 5:23815904-23815926 AGGGAGAGTAAAGTGAGTGTGGG + Intergenic
988304892 5:29481293-29481315 ATGGAGTGCACAGTGGTTTGAGG - Intergenic
988994426 5:36701054-36701076 AGGGAGATGACAGGGATTGGAGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
991395410 5:66199280-66199302 AGGGAGAGTACAGCAATTGTGGG - Intergenic
991989547 5:72323975-72323997 AGCGAGAGAACATTGATTTCTGG - Intronic
992343860 5:75855963-75855985 ATAGAGAGTACAATGATCTGGGG - Intergenic
992531913 5:77660116-77660138 AGGGAAAGTGCAGTGATTGTGGG - Intergenic
992934418 5:81687191-81687213 AGGGAGAGCACAGTGACTGTGGG + Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
993932315 5:93954957-93954979 AGGGAGAGCACAGTGACTGTGGG - Intronic
995264709 5:110144686-110144708 AAGGAGAAGACAGTGATTAGGGG + Intergenic
995265185 5:110151839-110151861 AGGCAGAGCACAGTGACTGGGGG + Intergenic
995268742 5:110195729-110195751 AGGAAGAGTGCAGTGATTGTGGG - Intergenic
995278760 5:110308617-110308639 AGGGTGAGAGCAGTGAGTTGGGG - Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995573286 5:113503636-113503658 AGGGAGAGTGCAGTGATAGTGGG - Intergenic
996854202 5:127986939-127986961 AGGGAGAGTCCAAGGACTTGGGG + Intergenic
998182677 5:139956339-139956361 GGGGAGATTACTGTGAGTTGGGG - Intronic
998633920 5:143931481-143931503 AGGGAGAGCACAGAGACTGGAGG + Intergenic
999257947 5:150220275-150220297 GGGGAAAGAGCAGTGATTTGGGG - Intronic
1000419409 5:161021238-161021260 AGGGAGAGGATAGTGATGAGTGG + Intergenic
1001202467 5:169730694-169730716 AGGGATTGTTCACTGATTTGAGG - Intronic
1003177090 6:3760081-3760103 AGGGAAAATACAGTGGGTTGTGG - Intergenic
1003527358 6:6909479-6909501 AAGGAGAGCACAGGGCTTTGGGG - Intergenic
1003913300 6:10762038-10762060 AGGGAGAGGACAGGATTTTGAGG + Intronic
1004020008 6:11768854-11768876 TGGGAGAGCACAGAGATTCGTGG - Intronic
1005476199 6:26210352-26210374 AGGAAGAGTAGCGGGATTTGAGG - Intergenic
1006143849 6:31946592-31946614 AGGCAGAGTGCAGAGGTTTGAGG + Exonic
1006286088 6:33095617-33095639 AGAGAGAGTACATTGGGTTGAGG + Intergenic
1007626280 6:43247948-43247970 AGGGAGAGTACAGAAATCGGGGG + Intronic
1008090407 6:47288372-47288394 AGAGAAGGTACAGTGATTAGAGG + Intronic
1008440257 6:51524760-51524782 AGGGAGTGCACAGGGAGTTGAGG - Intergenic
1008744593 6:54654306-54654328 AGGGAAAATACAGTTATTTAAGG + Intergenic
1008900724 6:56612299-56612321 AGGGAGGTTACAGTGAGCTGAGG + Intronic
1009531771 6:64826899-64826921 AGGGAGACTACATTTATTTCTGG - Intronic
1009728137 6:67560547-67560569 AGGGAGAGCAAAGTGATTGTGGG - Intergenic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1009823750 6:68839901-68839923 AGGGAGAGCACAGTGATTGTGGG + Intronic
1010062272 6:71636478-71636500 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1010088564 6:71951746-71951768 TGGGAGAGTGCTGGGATTTGAGG - Intronic
1012305953 6:97657537-97657559 TGGGAGAGTGCATTGCTTTGTGG + Intergenic
1012716243 6:102675079-102675101 ATAGAGAGTTCAGGGATTTGTGG - Intergenic
1013855578 6:114568030-114568052 AGGGAGCGTACAGCCATTTAAGG - Intergenic
1013908450 6:115245936-115245958 AGGAAGAGTACAGCGATTGTGGG + Intergenic
1015392788 6:132701848-132701870 AAGGAAAGTACAGTGATTGTGGG + Intronic
1015664818 6:135617126-135617148 AGGAAGAGAACTTTGATTTGAGG + Intergenic
1016054843 6:139567520-139567542 AGGAAGAGCACAGTGATTGTGGG - Intergenic
1016119011 6:140324760-140324782 ATGGAGATTACAATGATTTTAGG + Intergenic
1016457463 6:144245762-144245784 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1017387244 6:153900692-153900714 AGGGAGAACACAGTGAACTGGGG + Intergenic
1017751245 6:157492208-157492230 AGGGAGACTACAGTGGCTGGGGG - Intronic
1020465469 7:8473692-8473714 AGGCAGTACACAGTGATTTGAGG + Intronic
1020574935 7:9913997-9914019 AGGGAGAGTGTAGTGATTGTGGG - Intergenic
1021021685 7:15607593-15607615 AGAGATGATACAGTGATTTGAGG - Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1021214740 7:17901609-17901631 AGGGAGAGCACAGTGATTATGGG - Intronic
1021539372 7:21740122-21740144 TGGTAGAGTACAGAGATTTTGGG - Intronic
1022542094 7:31146833-31146855 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1022749992 7:33214290-33214312 AGGGACAGCACAGTGACTTGAGG - Intronic
1022798037 7:33748577-33748599 AGAGAGAGTACAGGGAATGGAGG - Intergenic
1023023483 7:36031232-36031254 AGGGAGAGAACACTCACTTGTGG + Intergenic
1023352294 7:39332844-39332866 ATGGAGAGCTCAGTGTTTTGGGG + Intronic
1023479971 7:40623496-40623518 AGGGAGTATAAAATGATTTGTGG - Intronic
1023646163 7:42318271-42318293 AGGGAGAGTGCAGTGGTTGTGGG + Intergenic
1024369222 7:48560323-48560345 AGGAAGAGCACAGTGACTGGGGG - Intronic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025061536 7:55812848-55812870 AGGGAGAGTGAAGTGATTGTGGG + Intronic
1027304066 7:76874035-76874057 AGGAAAAGTACAGAGATTGGAGG - Intergenic
1027422522 7:78031168-78031190 AGGGAGAGAAAACTGATTAGTGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027826101 7:83118544-83118566 AGGGAGAGCAAAGTGATTGTAGG + Intronic
1028929664 7:96398414-96398436 AGGGAGAATGCAGTGATTGTGGG - Intergenic
1028972468 7:96874792-96874814 AGAGAGAGTGCAGTGATTGTGGG + Intergenic
1029738868 7:102480258-102480280 AGGGAGTGTACAGTGAGATCAGG + Intergenic
1031215328 7:118883095-118883117 AGGGAGAGCACAGTGATCGGGGG + Intergenic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031306148 7:120130320-120130342 AAGGAGAGTGCAGTAATTTTGGG + Intergenic
1031417366 7:121509826-121509848 GGGGAGAGCAGAGTGAGTTGGGG + Intergenic
1031565838 7:123296173-123296195 AGGGAGAGTAAAGTGATGATGGG + Intergenic
1031721809 7:125186645-125186667 AGAGAGAGCACAGTGATTGTGGG + Intergenic
1031732541 7:125316384-125316406 AGGGAGAGTACAGAGATTTTGGG + Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032391827 7:131560073-131560095 AGGGAGAATTCATTGTTTTGGGG + Intergenic
1032971909 7:137174567-137174589 AGGGAGAGCACAGAAATGTGAGG + Intergenic
1033502514 7:141966088-141966110 AAGGAGAGTGCAGTGATTGAGGG - Intronic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1034126286 7:148674826-148674848 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1036522561 8:9505496-9505518 AGGGAGAGGCCAGTAATTTTAGG - Intergenic
1037101097 8:15047588-15047610 AGAGAGAGTACAGGGATCTCAGG + Intronic
1039189288 8:34953760-34953782 AGGGAAAGAACAGTGCATTGAGG - Intergenic
1039211605 8:35222202-35222224 AGGGAGAGCACAGTGAATAAAGG - Intergenic
1041318275 8:56586865-56586887 ATGGAGAATAAAGTAATTTGGGG - Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1042250627 8:66752801-66752823 AGGGAGAGTAAAGGGAAGTGGGG + Intronic
1042713781 8:71748579-71748601 AGGCAGATTACAGTGAGCTGAGG + Intergenic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1043226919 8:77745201-77745223 AGGGAGGGTACAGAAATTGGAGG + Intergenic
1044279309 8:90337836-90337858 ATGGAAAATAAAGTGATTTGGGG + Intergenic
1044479851 8:92672440-92672462 AGGGAGAGGACTGTGAGTTTAGG + Intergenic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1044635550 8:94320205-94320227 AGGGAGAGCACAGTGATTGCAGG - Intergenic
1044639448 8:94363153-94363175 AGGCAGGGTGCAGTGATTTTTGG + Intergenic
1044987900 8:97771157-97771179 AAGGAGAGTTCAGAGATTAGAGG + Intergenic
1045592599 8:103614341-103614363 AGGGAGAGCATAGTGACTGGGGG - Intronic
1046504674 8:115122224-115122246 AGGGAGATTAAAGTGATTTGGGG - Intergenic
1046811542 8:118538558-118538580 AGGGAGAGCACAGTGATTGTGGG - Intronic
1047970699 8:130081780-130081802 ATGAAGAGCACATTGATTTGTGG - Intronic
1048053386 8:130840702-130840724 AGGTTGAATACAGTGTTTTGGGG + Intronic
1048118673 8:131554819-131554841 AGGGAGAGCACAGTGACTGTGGG + Intergenic
1048700810 8:137087263-137087285 AGAAAGAGTACAGAGATATGGGG - Intergenic
1049578307 8:143399690-143399712 AGGGCAAGGACAGTGATGTGTGG - Intergenic
1050145098 9:2559369-2559391 AGGGAGAGCACAGTAATTTAGGG + Intergenic
1050694029 9:8259636-8259658 AGGGAGAAAGCAATGATTTGTGG + Intergenic
1050730294 9:8701742-8701764 AGGGAGATTAAAATAATTTGGGG - Intronic
1051039219 9:12785665-12785687 AGGGAGAATACAGTGATTATGGG - Intronic
1051306618 9:15717181-15717203 AGGGAGAGCACAGTGATTGTGGG + Intronic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051880946 9:21839433-21839455 AGGCAAAATACAGTGACTTGGGG + Intronic
1051891147 9:21944336-21944358 AGTGAGAGTAAAATGATTAGTGG + Intronic
1052093881 9:24361733-24361755 AGGGAGAGCACAGTGATTGTGGG + Intergenic
1052450602 9:28625284-28625306 AGGGAGAACACAGTGACTTAGGG - Intronic
1052638015 9:31127498-31127520 ATGAAGAGGAAAGTGATTTGTGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1054982462 9:71222757-71222779 AGGCAGAGCACAGTGATTGTGGG + Intronic
1056230693 9:84539728-84539750 AGGGAGAACACAGTGATTGTGGG - Intergenic
1057289186 9:93789614-93789636 AGAGAGAGTTCAGTGATTATGGG - Intergenic
1057593665 9:96395676-96395698 AGGAAGAATTCAGTTATTTGGGG - Intronic
1058820773 9:108727679-108727701 AGGGAAAGCACAGTGATTGCTGG + Intergenic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1059838968 9:118191200-118191222 AGAGAGAGTACAGTGATTGTGGG + Intergenic
1059886566 9:118751080-118751102 AGGGACAGCACAGTGATTGTGGG + Intergenic
1060060756 9:120457310-120457332 AGGGAGAGTGCAGTGGGCTGTGG - Intronic
1061638142 9:131928557-131928579 AGGGAGAGCACAGCGACTGGGGG + Intronic
1062252044 9:135603188-135603210 AGGGGGAGCACAGTGGTTAGGGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1185750419 X:2606596-2606618 AGGAAAATTCCAGTGATTTGGGG + Intergenic
1185755848 X:2652309-2652331 AAGGAGACTACAGTGTTTGGGGG + Intergenic
1186602034 X:11048606-11048628 AGGGAGAGCACAGTGTCTGGGGG - Intergenic
1186606420 X:11097699-11097721 ATGGAGAGCACAGTGATCTGAGG - Intergenic
1187284781 X:17894545-17894567 TGAGAGAATGCAGTGATTTGGGG - Intergenic
1187504222 X:19865766-19865788 AGTGTGTGTACAGTCATTTGGGG - Intronic
1187579422 X:20592506-20592528 AGGAAGAGCACAGTGACTGGAGG - Intergenic
1187723890 X:22182388-22182410 AAGGAGAGTACGGTGATTGTGGG - Intronic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188585816 X:31773882-31773904 TAGGAGAGTAAAGTGATTGGTGG + Intronic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188864549 X:35299450-35299472 ACGGAGAGCACAGTGATTGTAGG + Intergenic
1188972404 X:36633562-36633584 AGGGAGAGCACAGTGATTATGGG - Intergenic
1189405609 X:40720355-40720377 AGGGAGAGAATAGTGACTGGGGG + Intronic
1189628051 X:42920737-42920759 AGGGAGAGCACAGTGATCGTGGG + Intergenic
1189884959 X:45533123-45533145 GGGGAGAGTACAGCAATTGGAGG + Intergenic
1189928962 X:45987563-45987585 AGGGAGAGTGGACTGATTTAAGG - Intergenic
1192374756 X:70548603-70548625 AGGGAGAGCACAGTGATTGTGGG + Intronic
1192544361 X:72001056-72001078 AGGGAGAGCACAGAGATGTGTGG - Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193150401 X:78118661-78118683 AGGGACAGTACAGTAATTTGGGG + Intronic
1193675981 X:84453416-84453438 AAGGAGAGTACAGTGATTGTGGG + Intronic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194196733 X:90903554-90903576 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1194327792 X:92541352-92541374 AGGGAGAGCACAGTGACCTAGGG - Intronic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194401837 X:93446935-93446957 AGGGCAAGTCCAGGGATTTGAGG - Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195037259 X:100981373-100981395 AGAGAGAGTGCAGTGATTGTAGG - Intronic
1195290155 X:103424428-103424450 AGGGAGAGCACAGTGATTGTGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1195601225 X:106751277-106751299 AAGGAGAGCACAGTGATTGTGGG + Intronic
1196217702 X:113072668-113072690 AGGGAGAGCTCAGTGATTGTGGG - Intergenic
1196368742 X:114951974-114951996 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1196384963 X:115139690-115139712 AGGGAGAGCACAGGGACTGGGGG + Intronic
1196512190 X:116524591-116524613 AGGGAGAGCACAATGATTGGAGG - Intergenic
1196584212 X:117410240-117410262 AGGGCTAGTGCAGTCATTTGGGG - Intergenic
1196780096 X:119376032-119376054 AGGGAGAGTTTATTGATTTGGGG + Intergenic
1197011478 X:121569974-121569996 AGGGAAAGTACAATGATTGTGGG + Intergenic
1197078296 X:122379061-122379083 AGGGAGAGCACAGTGACTGAAGG - Intergenic
1197177965 X:123504780-123504802 AGGGAGAGCACAGTGATTTGGGG + Intergenic
1197358898 X:125473222-125473244 AAGGAGTTTACAGTGCTTTGAGG - Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197670702 X:129273798-129273820 AGGGAAAGCACAGTGATTGTGGG - Intergenic
1198156001 X:133961454-133961476 TGGGAGAGTGTAGTGATCTGGGG - Intronic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1198947674 X:142032232-142032254 AGGGAGAATGCAGTGATTGTAGG - Intergenic
1199129801 X:144171600-144171622 AGGAAGGATACAGTGATTTAAGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1199457509 X:148045030-148045052 AGGGAGAGCACAGTGGTTGTGGG - Intergenic
1199464453 X:148120315-148120337 AGGGAGAGCAAAGTGATTGTGGG + Intergenic
1199795396 X:151191064-151191086 AGGGAGAGCAAAGTGATTGCGGG + Intergenic
1200302796 X:154995307-154995329 AGGGAGAGTAAATGGATTAGGGG + Intronic
1200542579 Y:4477755-4477777 AGAGAGAGCACAGTGACTGGCGG - Intergenic
1200636506 Y:5660570-5660592 AGGGAGAGCACAGTGACCTAGGG - Intronic
1201066970 Y:10106251-10106273 AGGGAGGGCACAGTGACTGGAGG + Intergenic