ID: 972282557

View in Genome Browser
Species Human (GRCh38)
Location 4:37617070-37617092
Sequence CTAGATTAGCATGAATCTAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972282557 Original CRISPR CTAGATTAGCATGAATCTAT TGG (reversed) Intronic
906342739 1:44995002-44995024 CTAACTTATCATGGATCTATTGG - Intergenic
915717919 1:157961927-157961949 CTATATTAACATGAATATACTGG - Intergenic
916238765 1:162617589-162617611 CTAGATTACCAAGAATATGTAGG + Intergenic
917277994 1:173351318-173351340 CTAGATTGGCATGATTGGATAGG - Intergenic
917715518 1:177733280-177733302 TTACATTTGCATGAATTTATGGG - Intergenic
921228661 1:213046513-213046535 CTAGATTCTCAAGAATATATTGG + Intergenic
924033142 1:239907832-239907854 CTACATCATCATGAATCGATGGG + Exonic
1064796848 10:19021760-19021782 ATAGGTGAGCATGAATCTAGGGG + Intergenic
1064801789 10:19083395-19083417 CTAGATTTGCAGGAATATGTTGG + Intronic
1068109460 10:52662244-52662266 CCAGATTAGGAGGAATCTAGAGG + Intergenic
1071954829 10:90746383-90746405 CTATATTTGCATGCATCCATAGG - Intronic
1072241616 10:93500613-93500635 CTAAATTACCAAGAAGCTATAGG - Intronic
1074074178 10:110105910-110105932 CTTGATTAACATGAAGCTAAAGG - Intronic
1078963364 11:16306258-16306280 GTAGATTTACATGAAGCTATAGG - Intronic
1078993873 11:16676932-16676954 CTAGATTACCAGGAATATGTGGG + Intronic
1087911189 11:103755510-103755532 CTAGAGCAGCATGATTTTATAGG + Intergenic
1093658038 12:21720303-21720325 TTAGATGAGCAGGAATCTAGAGG - Intronic
1097493867 12:60303857-60303879 CTAGATTAACTTTACTCTATTGG + Intergenic
1098681501 12:73361680-73361702 CTAGAATAGCATTGATTTATGGG + Intergenic
1099673067 12:85719095-85719117 CTAGATTCCCAGGAATATATTGG + Intergenic
1105236402 13:18558752-18558774 CCAGATGACCATGAAGCTATGGG - Intergenic
1105294167 13:19073738-19073760 CCACATTAACATGAATCTTTGGG - Intergenic
1106644281 13:31616102-31616124 CTACATTTGCATGAAGCTATTGG - Intergenic
1107627389 13:42303657-42303679 CAAGATTAACATGAATCTGAGGG - Exonic
1108472680 13:50783361-50783383 ATAGATTAGAATCAAGCTATTGG - Intronic
1114148367 14:20005794-20005816 CTTCATCAGCATGAATCTGTTGG - Intergenic
1115665815 14:35544697-35544719 TTAGATTAGCCTGAAATTATAGG - Intronic
1117860514 14:60087797-60087819 ATAGATAAGGATGAATCTCTGGG - Intergenic
1126057555 15:44745012-44745034 CTAGATTACCAGGAATATGTGGG - Intronic
1128115945 15:65105564-65105586 CTTGATTTGCATGATTTTATGGG - Intronic
1128216436 15:65937444-65937466 TTGCATTAACATGAATCTATCGG - Intronic
1132166803 15:99601182-99601204 GTAGACTAGCATCAATCAATTGG - Intronic
1145353176 17:22107768-22107790 CTTAATTAGCATACATCTATTGG + Intergenic
1148362610 17:47025058-47025080 ATAGATTAGATTGGATCTATTGG - Intronic
1149215699 17:54351472-54351494 CTGGATTTGGATGAATTTATTGG - Intergenic
1150316893 17:64176317-64176339 CTAGATTAGAAGGAAAATATGGG - Intronic
1153467158 18:5400648-5400670 CTAAATTAGCACGACTCTACAGG + Intronic
1154513136 18:15131168-15131190 CCAGATGACCATGAAGCTATGGG + Intergenic
1155344841 18:24847977-24847999 CTAAATGGGCATGAATGTATAGG - Intergenic
927324161 2:21783932-21783954 CAATATTAGCATGAATCAAAGGG + Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
929301728 2:40311099-40311121 ATAGATTAGTATCAATCTATAGG + Intronic
933129206 2:78651904-78651926 CTATATGAGCTTGAGTCTATCGG - Intergenic
935893715 2:107710302-107710324 CTAGATTCCCATGAATATGTCGG - Intergenic
937071990 2:119071396-119071418 CTAGGTTCTCATGATTCTATAGG + Intergenic
938513385 2:131975781-131975803 CCAGATGACCATGAAGCTATGGG + Intergenic
945703627 2:213201800-213201822 TTAGATTAGGATGAATTTAGAGG + Intergenic
1174888987 20:54369244-54369266 ATATATTACTATGAATCTATGGG + Intergenic
1176701043 21:10050158-10050180 CTAGATTAGAATGAAACAAATGG + Intergenic
1176780394 21:13187037-13187059 CCAGATGACCATGAAGCTATGGG - Intergenic
1177978068 21:27876106-27876128 CCAGATGACCATGAAGCTATGGG - Intergenic
1181019241 22:20090126-20090148 CTGGATGAGCCTGACTCTATGGG + Exonic
951828215 3:26893300-26893322 CTCCATTAGCCTGAATCTCTGGG + Intergenic
952705624 3:36374704-36374726 CTAGATGTGCATGCATATATGGG - Intergenic
957144242 3:76402462-76402484 GTAGATTAGCAAGAACTTATGGG + Intronic
957784374 3:84862616-84862638 TTAGAATAGCATGAATATACTGG - Intergenic
957861915 3:85963875-85963897 CATGAATAGCATTAATCTATGGG - Intronic
970640915 4:18065019-18065041 CTAGATTCACAGGAATATATTGG + Intergenic
970822215 4:20231058-20231080 CCAGATTGGCATTAATATATTGG - Intergenic
972282557 4:37617070-37617092 CTAGATTAGCATGAATCTATTGG - Intronic
972882143 4:43438059-43438081 CTTGTTCACCATGAATCTATTGG - Intergenic
973612976 4:52654985-52655007 CCAGTTAAGCATGAATCTAATGG - Intronic
974163070 4:58165566-58165588 CTATTTCAGAATGAATCTATTGG - Intergenic
975185479 4:71397231-71397253 ATAGATTAGCATGTATGTAAAGG + Intronic
978498668 4:109385880-109385902 CTAGGTCAGCAGGAGTCTATGGG + Intergenic
980373191 4:131906483-131906505 CTAGATTAGAATGAAACAAATGG + Intergenic
986630299 5:9766212-9766234 CTAGATAATCCTGAATCTGTAGG + Intergenic
991360970 5:65819529-65819551 GAAGATTAGCATGTATCTTTTGG - Intronic
994430803 5:99658637-99658659 CTTGACTAGCATGCATATATTGG + Intergenic
1001306667 5:170579696-170579718 CTAGATTGGAACGAATCTCTTGG - Intronic
1001725735 5:173897617-173897639 ATAGATTAAAATGAAACTATTGG - Intronic
1001751010 5:174131483-174131505 CCAAATTAGCAGGAATCTGTAGG - Intronic
1004263545 6:14129555-14129577 CTAAATAATCAAGAATCTATGGG - Intronic
1005490948 6:26346515-26346537 CTGGATTAGAATGAAGCTAGAGG - Intergenic
1009755446 6:67933589-67933611 ATAGATTGGAATCAATCTATTGG + Intergenic
1010760157 6:79713482-79713504 CTAGATTTGCATGCATTTTTTGG - Intergenic
1014131840 6:117844196-117844218 CAATTTTAGCATGAATCTAAAGG + Intergenic
1014239807 6:119004165-119004187 GTAGATTAGCATGAATCAAGTGG + Intronic
1014335575 6:120130820-120130842 CCAGATATGCATGAATATATTGG + Intergenic
1017559124 6:155607794-155607816 CTACAGTAGCTTGAGTCTATAGG - Intergenic
1018115245 6:160577440-160577462 CTAGAATACTATGAATCTACTGG - Intronic
1018118452 6:160611889-160611911 CTAGATTGGTAGGAATCTGTAGG - Intronic
1018120854 6:160634080-160634102 CTAGATTGGTAGGAATCTGTAGG - Intronic
1022424006 7:30250449-30250471 CTTGATTAGCATCACTCTAAAGG + Intergenic
1026540908 7:71279232-71279254 CTAGATTAGGATGAATCCAGTGG - Intronic
1026540951 7:71279531-71279553 CTAGATTAGGATGAATCCAATGG - Intronic
1048246987 8:132816086-132816108 CTAAATTAACATGAATATATTGG + Intronic
1050646180 9:7721952-7721974 ACAGATTATTATGAATCTATGGG - Intergenic
1053638186 9:40036657-40036679 CTAGATTAGAATGAAACAAATGG + Intergenic
1053767897 9:41428563-41428585 CTAGATTAGAATGAAACAAATGG - Intergenic
1054318979 9:63633260-63633282 CTAGATTAGAATGAAGCAAATGG + Intergenic
1054546565 9:66340067-66340089 CTAGATTAGAATGAAACAAATGG - Intergenic
1055257703 9:74391847-74391869 GTGGAGTAACATGAATCTATAGG + Intergenic
1055547148 9:77390356-77390378 CTAGTTTAGCAGGAATCTCTTGG + Intronic
1202786058 9_KI270719v1_random:20215-20237 CTAGATTAGAATGAAACAAATGG + Intergenic
1186836620 X:13444683-13444705 CTAGAATTACATGAATCGATAGG - Intergenic
1189282805 X:39830963-39830985 ATAAATTATGATGAATCTATGGG + Intergenic
1197154749 X:123258266-123258288 ATAAATTAGCATGAATAAATTGG - Intronic
1197303608 X:124812439-124812461 TTAGAGTTGCATGGATCTATAGG - Intronic
1197426445 X:126302866-126302888 TTAGATTACCAGGACTCTATTGG - Intergenic
1198184883 X:134244204-134244226 CTGGAATAGCAGGAATTTATAGG + Intronic