ID: 972287585

View in Genome Browser
Species Human (GRCh38)
Location 4:37663592-37663614
Sequence GCTTCCTTACAGATGCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972287585_972287591 16 Left 972287585 4:37663592-37663614 CCTCGCAGCATCTGTAAGGAAGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 972287591 4:37663631-37663653 ATTCGCAGATGAGGAAAATGAGG 0: 1
1: 4
2: 86
3: 1019
4: 5538
972287585_972287592 23 Left 972287585 4:37663592-37663614 CCTCGCAGCATCTGTAAGGAAGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 972287592 4:37663638-37663660 GATGAGGAAAATGAGGCACACGG 0: 3
1: 81
2: 444
3: 1370
4: 3112
972287585_972287593 24 Left 972287585 4:37663592-37663614 CCTCGCAGCATCTGTAAGGAAGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 972287593 4:37663639-37663661 ATGAGGAAAATGAGGCACACGGG 0: 1
1: 6
2: 142
3: 618
4: 1859
972287585_972287586 7 Left 972287585 4:37663592-37663614 CCTCGCAGCATCTGTAAGGAAGC 0: 1
1: 0
2: 0
3: 8
4: 94
Right 972287586 4:37663622-37663644 ATTACCCCCATTCGCAGATGAGG 0: 1
1: 2
2: 8
3: 72
4: 378

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972287585 Original CRISPR GCTTCCTTACAGATGCTGCG AGG (reversed) Intronic
900345514 1:2208550-2208572 GCTGCCCCACAGATGCTGCAGGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
906202807 1:43970954-43970976 TCTTCCCTGCAGCTGCTGCGTGG + Exonic
907340916 1:53735799-53735821 GCGTCCTTAAAAATGCTGCGAGG - Intergenic
910029915 1:82706522-82706544 GCTTTCTTCCAGGTGCTGCAGGG - Intergenic
910844749 1:91594307-91594329 TCTTTCCTACAGATGTTGCGAGG - Intergenic
912604271 1:110972366-110972388 TCTTCCTTACACAGGCTGGGTGG + Intergenic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1075348584 10:121703411-121703433 GCTTCCTACCACAAGCTGCGTGG + Intergenic
1076250786 10:128982464-128982486 GCTTCCAGACAGAGGCTGCCAGG + Intergenic
1081567504 11:44269152-44269174 GCTTCCTCACAGACGCTGCCTGG + Intronic
1081665781 11:44916378-44916400 GCCTCCTCACAGATGCTCTGTGG - Intronic
1083785031 11:64939757-64939779 TTTTCCTTACAGATTCTGAGTGG - Exonic
1085704070 11:78770346-78770368 GCATCCTTACACATGCTGTTTGG - Intronic
1086328102 11:85725222-85725244 GCTGCATTACAGAAGCTGTGTGG - Intronic
1090469888 11:126970948-126970970 TCTCCCTTACAGTAGCTGCGAGG + Intronic
1092083931 12:5740259-5740281 CCCTCCTTTCAGGTGCTGCGTGG - Intronic
1096874502 12:54616684-54616706 GCTGCCTTAAAAATGCTCCGGGG + Intergenic
1099877907 12:88431933-88431955 GCTTCCTTTAAGATTCTGCGAGG - Intergenic
1101761052 12:107659468-107659490 GTATCCTCAGAGATGCTGCGTGG + Exonic
1102018426 12:109663951-109663973 GCTTCCTCAAACATGCTGCTGGG - Intergenic
1106597022 13:31152922-31152944 CCTTCTTTACAGATGCTGAGAGG - Exonic
1107800014 13:44097344-44097366 GCTTCCTTATAGATAATGGGAGG + Intergenic
1108317133 13:49247933-49247955 GTTGCCTTACAGTTGCTGAGAGG + Exonic
1117161977 14:52998564-52998586 GCTTCATTCCAGAGGCTGAGAGG - Intergenic
1117825630 14:59699873-59699895 TCTTCCTTAGAGATGCTGTGTGG - Intronic
1120185607 14:81390855-81390877 GCTTCCTTAAAGCCTCTGCGGGG - Intronic
1129260967 15:74367043-74367065 GCTTCCTTACAGATGGCTGGCGG + Intronic
1129878832 15:78994143-78994165 GCTTCCTTTCAGCTGCCGAGAGG + Intronic
1130111240 15:80967363-80967385 GCTTCCTTACAAATTCTCTGAGG - Intronic
1132231592 15:100188492-100188514 GCTTCCTTCCATATTCTACGTGG + Intronic
1132339017 15:101066287-101066309 GCTTCCTTACAGGTCATGTGGGG + Intronic
1134180181 16:12041557-12041579 GCTTCCTTCCAGAGGCTTCAGGG + Intronic
1135306930 16:21375307-21375329 GCTTCCTTCCAGAGGCTTCAGGG + Intergenic
1136303672 16:29354448-29354470 GCTTCCTTCCAGAGGCTTCAGGG + Intergenic
1142669960 17:1483492-1483514 GATTCCTCACAGATGTGGCGCGG + Intronic
1153314003 18:3704227-3704249 GCTTCCTTTCAGGTGTTGCAGGG + Intronic
1155358495 18:24977419-24977441 GCATCCCTACAGAAGCTGGGTGG - Intergenic
1157572897 18:48724616-48724638 CCTTCCCTACAGCTGCTGGGCGG + Intronic
1158706615 18:59798055-59798077 ACTGCCTTACAGATTCTGGGGGG + Intergenic
1160200788 18:76793645-76793667 GATTCCTGAAAGATGCTGAGAGG - Intergenic
926771889 2:16385465-16385487 GCCTCCTTACAGATGTTGACAGG - Intergenic
929039920 2:37734310-37734332 GTTTTCTTCCAGATGCTGGGAGG + Intronic
948724000 2:239920641-239920663 GCTTCCTTCCAGAAACTGTGTGG - Intronic
948995827 2:241577731-241577753 GCTTCCTGCCAGATGCTTCTTGG + Intergenic
1170581397 20:17702163-17702185 GCTTCCTCACACAAGCTGGGAGG - Intronic
1172591117 20:36118840-36118862 TCCTCCTTACAGCTGCTGTGAGG - Intronic
1172659073 20:36554972-36554994 GCTTGCTCACAGGTGCTGCGTGG - Intergenic
1173941829 20:46917560-46917582 CATTCCTTGGAGATGCTGCGGGG + Intronic
1176937059 21:14879665-14879687 TCTTCCTTACAGCTGTTGAGAGG - Intergenic
1179532857 21:42032067-42032089 CTTTCCTTACAGATGTTGTGAGG + Intergenic
1180183667 21:46129184-46129206 GCTCCCTTGCAGATGCACCGTGG + Intronic
1184651389 22:45920865-45920887 GGTTCCTTGCAGAGGCTGCCGGG + Exonic
1184661597 22:45967939-45967961 GCTTCCCTTCAGAGGCAGCGCGG + Intronic
950635102 3:14308652-14308674 GCTGCCTTCCAGATGCTGCTGGG - Intergenic
950789516 3:15461364-15461386 GCTTCCTCCCAGTTGCTGCAGGG + Intronic
952276283 3:31880309-31880331 GTTCCCTGACAGATGCTGCCAGG - Intronic
955289244 3:57675634-57675656 GCTTCCTTGCAGGGGCTGTGGGG - Intronic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
960681001 3:120247497-120247519 GCTTCCTAAGAGATACTGCCTGG + Intronic
962360021 3:134732142-134732164 GTTTCTTTACAGATGATGAGAGG - Intronic
963312193 3:143721310-143721332 TCTTCCTTCCACATGCTGTGAGG - Intronic
968713342 4:2136857-2136879 GCTTCATTCCAGAGGCTGCAAGG - Intronic
969117600 4:4881385-4881407 GCTTCCTGAGAGAAGCTGCATGG + Intergenic
970345431 4:15148247-15148269 CCTTCGGCACAGATGCTGCGGGG - Intergenic
972287585 4:37663592-37663614 GCTTCCTTACAGATGCTGCGAGG - Intronic
972365096 4:38367180-38367202 GCTGCCTTCCAGATGCTAGGAGG + Intergenic
973219888 4:47713355-47713377 TCTTCCTTAAAAATGCTGAGTGG - Intronic
976444471 4:85114761-85114783 GCTTCCTGCCAGAGGCTGCCGGG - Intergenic
979107437 4:116705674-116705696 CCTTCCTTGCAGAGGCTGCAGGG - Intergenic
979507093 4:121510699-121510721 TCTTCCTTACACATCCTGAGAGG - Intergenic
980498637 4:133618696-133618718 GCTTCCTTTCAGATGCTCATGGG - Intergenic
984844293 4:184097060-184097082 GCTTCCTTTCAAATGCTTCTTGG - Intronic
985613234 5:902560-902582 GATGCCTCACAGAAGCTGCGAGG - Intronic
987419461 5:17701690-17701712 AGTTCCTTACAGATGCTGGGTGG + Intergenic
992416357 5:76555922-76555944 GGCACCTTACAGATGCTGTGGGG + Intronic
995589081 5:113679827-113679849 ACTCCCTTACAGAAGCTGAGAGG + Intergenic
996560549 5:124823888-124823910 GCATCCATACAGATTCTGCTAGG - Intergenic
997926784 5:138037641-138037663 GTTTCCTTACTGATGGTGCAAGG - Intronic
999425968 5:151488114-151488136 GCGTCCTTAAAGATGGTGAGGGG - Exonic
1003992910 6:11504891-11504913 TTTTCCTTACATATGCTGCAAGG + Intergenic
1005888896 6:30120181-30120203 GCTGCCTTCCAGATGCGGGGAGG + Intergenic
1007688661 6:43683200-43683222 GCTGGCTCACAGTTGCTGCGTGG - Intronic
1010155795 6:72791100-72791122 TCTTCCGTAGAGAAGCTGCGAGG + Intronic
1010515275 6:76765644-76765666 GCTTCCTTACAGATCCAACTTGG + Intergenic
1013864272 6:114675788-114675810 GTTTCCTTACTGATTCTGGGGGG - Intergenic
1015753613 6:136585811-136585833 GCTTCCTTAAAGAAGCAGTGTGG - Intronic
1019610153 7:1932409-1932431 GCTTCCTGAGAGACGGTGCGGGG + Intronic
1020493313 7:8816479-8816501 GCTTGCTCACAGATTCTGAGAGG - Intergenic
1021343435 7:19491511-19491533 GCTTCCTTTCAACTGTTGCGTGG - Intergenic
1023850540 7:44147640-44147662 GCATCCTTACAGCTGCTGACCGG + Exonic
1024593612 7:50913290-50913312 GCTTTCTTAGTGAAGCTGCGTGG + Intergenic
1031805518 7:126302333-126302355 GCCACCTTGCAGATGCTGCCAGG + Intergenic
1032428775 7:131843625-131843647 GCTTTCCTACGGATACTGCGAGG + Intergenic
1037008230 8:13807956-13807978 GCTTCCTTACTGAAGTTGCCAGG - Intergenic
1038032823 8:23659534-23659556 GCTTCTTCACAGATGCTGGAAGG + Intergenic
1044523599 8:93226805-93226827 GCTTCCCTACAAGTGCTGTGAGG + Intergenic
1048230512 8:132635967-132635989 GGTTCCTTCCAGGGGCTGCGAGG - Intronic
1058681522 9:107444505-107444527 GCCTCTTTTGAGATGCTGCGAGG - Intergenic
1059336674 9:113573432-113573454 GCTTCCTCACGGCTGCTACGGGG - Intronic
1194052925 X:89094342-89094364 GCTTCCTTACAAGAGCTGAGAGG - Intergenic
1195313865 X:103658953-103658975 GCTGCCTTCCAGATGCTCTGGGG - Intergenic
1198637541 X:138715892-138715914 GCTTCCTTACAGCTCCTCTGAGG - Intronic