ID: 972289092

View in Genome Browser
Species Human (GRCh38)
Location 4:37674483-37674505
Sequence TTTTGCCTTTAGAAGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 433
Summary {0: 1, 1: 0, 2: 4, 3: 41, 4: 387}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972289089_972289092 4 Left 972289089 4:37674456-37674478 CCTTTTTCTTTTGGTGGTTGTTC 0: 1
1: 0
2: 4
3: 73
4: 591
Right 972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG 0: 1
1: 0
2: 4
3: 41
4: 387
972289085_972289092 14 Left 972289085 4:37674446-37674468 CCAATGCTTCCCTTTTTCTTTTG 0: 1
1: 0
2: 7
3: 87
4: 1059
Right 972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG 0: 1
1: 0
2: 4
3: 41
4: 387
972289088_972289092 5 Left 972289088 4:37674455-37674477 CCCTTTTTCTTTTGGTGGTTGTT 0: 1
1: 0
2: 7
3: 160
4: 1600
Right 972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG 0: 1
1: 0
2: 4
3: 41
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972289092 Original CRISPR TTTTGCCTTTAGAAGGAGGA TGG Intronic
900356347 1:2266621-2266643 TTTGGCCTTTCCAGGGAGGAGGG + Intronic
902644989 1:17791711-17791733 ATTTGCCTGTGGAACGAGGAGGG + Intronic
904794710 1:33050775-33050797 TTATGCCTTTAGAGGGAAGGGGG - Intronic
905953977 1:41976875-41976897 TTGTGCCTTGAGAGGGAGCACGG + Intronic
907817548 1:57935156-57935178 TCTTGCCATGAGAAGAAGGAGGG + Intronic
908086090 1:60635890-60635912 TTTTTCCTTTAGAAGGAAAATGG - Intergenic
908511640 1:64854370-64854392 TTCTTCCCTTAGAAGGAGGAAGG - Intronic
908711411 1:67019677-67019699 TTTTGCCTTTTTAAGGAAGCAGG + Intronic
908800424 1:67874394-67874416 TTTAGCCTTGAGCAGGAGTAGGG + Intergenic
909335135 1:74464618-74464640 TTTTGCCTTTAGGAAAAGAATGG - Intronic
909848756 1:80433814-80433836 TTATGCCTATGGAAAGAGGAGGG - Intergenic
911536472 1:99106195-99106217 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
911988062 1:104656960-104656982 TTCTGCCTTTGGAAAGAAGAGGG - Intergenic
912106946 1:106290767-106290789 TTTTGCTATTAGAGGGAGGAAGG + Intergenic
912811177 1:112795750-112795772 TCTTGCCTCTAGAGGAAGGAAGG + Intergenic
912945370 1:114080002-114080024 TTTTGCCCACAGAAGGAGAAAGG - Intergenic
913153793 1:116073983-116074005 TTTTGCTTTTAGAGGAAGAATGG + Intergenic
914679964 1:149932118-149932140 TCTGCTCTTTAGAAGGAGGAGGG - Intronic
915689167 1:157670327-157670349 TGTGGCCTTTAGAAGGATTAAGG - Intergenic
915930866 1:160060179-160060201 TCCTCCCTTAAGAAGGAGGATGG + Intronic
917071247 1:171153220-171153242 TTGTGCCTTTCGAAGGAAAAAGG - Intronic
918411340 1:184261061-184261083 TGTAGCCTTTAGCAGGAGGCAGG - Intergenic
918442066 1:184577380-184577402 TGTTGCCTTCAGAAGGAAGGCGG + Intronic
919008526 1:191929615-191929637 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
919691334 1:200531142-200531164 TTTTGTCTGTTGCAGGAGGAGGG - Intergenic
919845414 1:201639364-201639386 TTCTGGCTTTAAAAGAAGGAAGG + Intronic
920034622 1:203057952-203057974 TTCTGAGTTGAGAAGGAGGAGGG + Intronic
920044809 1:203126506-203126528 TTCTGCCTTTAGGGGGAGCAAGG - Intronic
920405350 1:205705090-205705112 TTTTCTTTTTAGAAAGAGGAAGG + Intergenic
920744970 1:208617562-208617584 CTTTGCCCTTAGAAAGGGGAGGG + Intergenic
920815103 1:209323987-209324009 CTCTGCCTTAAGAAGGAGGGTGG - Intergenic
921283180 1:213586881-213586903 TTTGGGCTGTAGAAGAAGGAAGG + Intergenic
921982232 1:221271427-221271449 TTTTACCTTGAGAAGGATGTGGG + Intergenic
922070178 1:222184416-222184438 CTTTGCCTTCAGCAGAAGGAAGG + Intergenic
922637073 1:227184955-227184977 TTCTCCCTTTTGAAGGAGGCAGG - Intronic
923921540 1:238569895-238569917 TTTAACCTTGAGAAGGAGGAAGG + Intergenic
924653591 1:245951910-245951932 TTTTGCATTTAGATGTAGGGGGG - Intronic
1064360187 10:14657356-14657378 TTTTGCCTTGAGAAGGTGTCAGG - Intronic
1065200057 10:23304184-23304206 TTGTGCCTTCAGAAGCAGGTTGG + Intronic
1065396626 10:25245990-25246012 TTATCCCATTAGAAGCAGGAAGG + Intronic
1065838759 10:29682624-29682646 TGTTGCATTTAGAAGGAAGAAGG + Intronic
1065982289 10:30911901-30911923 TCTGGCATTTGGAAGGAGGAGGG - Intronic
1067495781 10:46758822-46758844 GTTTGCCTTTAGAATGAAGAAGG + Intergenic
1067598873 10:47581568-47581590 GTTTGCCTTTAGAATGAAGAAGG - Intergenic
1067948534 10:50708151-50708173 GTTTGCCTTTAGAATGGAGAAGG - Intergenic
1068199586 10:53765688-53765710 TTTGGCCTGAAGCAGGAGGATGG + Intergenic
1068414193 10:56696752-56696774 TTTGTGCTTAAGAAGGAGGAAGG - Intergenic
1068419708 10:56774604-56774626 TTTTGCATTTAATAGGAGGTAGG - Intergenic
1069214383 10:65801251-65801273 TTTTTCCCTTAGTAGGTGGAAGG + Intergenic
1069933516 10:71899805-71899827 CTCTGCCTTTAGAAAGGGGAGGG - Intergenic
1070883855 10:79873146-79873168 GTTTGCCTTTAGAATGGAGAAGG - Intergenic
1071107443 10:82115036-82115058 TTTTGCTATTAAAAGCAGGAAGG - Intronic
1071650411 10:87389448-87389470 GTTTGCCTTTAGAATGGAGAAGG - Intergenic
1071681394 10:87709408-87709430 TTTTATCATTAGAAGGAGGCTGG + Intronic
1072133672 10:92522248-92522270 TTTTGCATAGAGAAGTAGGAAGG - Intronic
1072484053 10:95837542-95837564 TTATGCCTTTAGAAAGAAAAGGG - Intronic
1074396257 10:113100366-113100388 ATCTGCCTTTAGAAGGCAGAAGG + Intronic
1074679689 10:115892271-115892293 TATTTCCTTTGGAAGGAGTATGG + Intronic
1075340015 10:121639501-121639523 TTTTGGCTACAGAAGGAAGAAGG - Intergenic
1076109814 10:127851728-127851750 TTCTGCAGCTAGAAGGAGGATGG + Intergenic
1076839028 10:133036247-133036269 TCTTGCTTTTGGGAGGAGGAAGG - Intergenic
1078291439 11:10014220-10014242 TTTTGCCTATAGATGGAGCTAGG + Intronic
1078313164 11:10266785-10266807 TTTGGCCTTTAAACGGAAGAGGG + Intronic
1078977282 11:16493471-16493493 TTTTTCCCTTTGGAGGAGGAAGG + Intronic
1079062595 11:17262460-17262482 TTTTTCCTTTAGAAAGAGAATGG - Intronic
1079183562 11:18215411-18215433 CTTTGCCTTTAAAAAGGGGAGGG + Intronic
1079917629 11:26390304-26390326 TTTTCCCTCTAAAAGGAGGAGGG - Intronic
1080417519 11:32082776-32082798 TTTATCCTTTAGAAGGATTAAGG - Intronic
1081320763 11:41689253-41689275 TTTTGCCATTAAAAGGAGGATGG + Intergenic
1081684938 11:45035804-45035826 TTTAGGCTTTAGAAGTAGGGTGG + Intergenic
1083252622 11:61478039-61478061 TTTTCCTTTTAGCAGGTGGAGGG - Intronic
1083914528 11:65732122-65732144 TTTTGCTGTTAGAAGGGGAAGGG + Intergenic
1086007057 11:82049123-82049145 CTCTGCCTTTGGAAAGAGGAAGG + Intergenic
1086462744 11:87021925-87021947 TTTTGCATTTAGAAAAAGAAGGG - Intergenic
1087252353 11:95917234-95917256 TTTTTCCTTTGTAAGGAAGATGG - Intronic
1087350145 11:97020631-97020653 TTTTGCCTGTAGAAGGGAGAGGG + Intergenic
1088719624 11:112580503-112580525 TTTTGCCTTTGGATGGGAGATGG - Intergenic
1088781391 11:113137143-113137165 TCTTTCCTTTAAAAGGAGGTGGG + Intronic
1089001177 11:115053695-115053717 TTTTGCCCATAGAAGGTGGTTGG - Intergenic
1090022100 11:123137390-123137412 ACTCGCGTTTAGAAGGAGGAAGG + Intronic
1090229544 11:125091777-125091799 TTCTGCCTTCATAAGGAAGAAGG - Intergenic
1091042762 11:132297408-132297430 TCTTGCACATAGAAGGAGGAGGG - Intronic
1091200835 11:133779557-133779579 TTCTGCCTTCTGAATGAGGATGG - Intergenic
1091302360 11:134515609-134515631 TTCTGTCTCTAGCAGGAGGACGG - Intergenic
1093131363 12:15395293-15395315 TTTGGCCCTTGGAAAGAGGAAGG + Intronic
1093832927 12:23787084-23787106 TTTTGATCTTAGATGGAGGAAGG + Intronic
1093967854 12:25345970-25345992 TTTTGCTTTTGGAAGGAGACTGG - Intergenic
1093993605 12:25617450-25617472 GTTGGCCTTTAGCAGGAGAATGG + Intronic
1094087927 12:26614186-26614208 TTTTTCCCTTAGAAGATGGAGGG - Intronic
1094198921 12:27778436-27778458 TTTTACCTTAGGAAGGAGAAAGG - Intergenic
1094605101 12:31943028-31943050 TTTTGCCTTTGGGAGAAGAAGGG + Intergenic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1098056223 12:66508491-66508513 TTTTTCCTTTTGAGAGAGGAAGG - Intronic
1098207858 12:68132334-68132356 CTCTGGCTTTAGAAAGAGGAGGG - Intergenic
1098279888 12:68851857-68851879 TCATGACTTTAGAAGGGGGAAGG - Exonic
1099342275 12:81452170-81452192 TTTTGCCTTGAAAAGCAAGATGG + Intronic
1101425269 12:104583114-104583136 TGTTGCCTTGATAAGCAGGAAGG - Intronic
1102382894 12:112482774-112482796 GTTTGGCTTTTGGAGGAGGAAGG + Intronic
1102500291 12:113347412-113347434 TTTTGACTTCAGCAGGAGCATGG - Intronic
1102943559 12:116964869-116964891 TTTTTCCTTAATAGGGAGGAGGG - Intronic
1104662075 12:130618438-130618460 TTTTGTCTTTACCAGGAGGAGGG - Intronic
1106470612 13:30050924-30050946 TTTCTCCTTTGGAAGGAGGGCGG - Intergenic
1106879296 13:34112045-34112067 TTTTTCATTTAGAAGGAGCTTGG + Intergenic
1107793474 13:44026435-44026457 TTATGTCATTATAAGGAGGAAGG + Intergenic
1109460163 13:62645748-62645770 TCTTGGCTTTAGAAGGAGCCAGG - Intergenic
1109645113 13:65244098-65244120 GTTTGCTTCTAGCAGGAGGATGG - Intergenic
1109977206 13:69854033-69854055 TTTTGCCTCTAGGATCAGGATGG - Intronic
1110501359 13:76231750-76231772 CTCTGCCTTTGGAAAGAGGAGGG + Intergenic
1112618821 13:101034418-101034440 CTTTGCCTTTGGAAAGGGGAAGG - Intergenic
1112975167 13:105308817-105308839 TTTTGGCTTTAGCAGAAGGAAGG + Intergenic
1113217468 13:108059425-108059447 TTTTGACTTGAGAATGATGAAGG - Intergenic
1113384512 13:109836339-109836361 TTTTGTCATTAGAAAGTGGATGG - Intergenic
1113825589 13:113250687-113250709 TTTTGCCTTGAGAAGTACCATGG - Intronic
1114984976 14:28216035-28216057 ATTTACCTTAAAAAGGAGGAAGG - Intergenic
1115344916 14:32332318-32332340 TTTTCCAATTAGAATGAGGAGGG - Intronic
1115749133 14:36470780-36470802 TTTAGGCTTTAGATTGAGGAAGG + Intergenic
1119985926 14:79137242-79137264 TTTGGCCTTCAGCTGGAGGAAGG + Intronic
1120534802 14:85681331-85681353 TTTTGTCTATAGCATGAGGAAGG + Intergenic
1120571900 14:86128951-86128973 TTGTGCCTTTTGAAGTAGGAAGG - Intergenic
1121675638 14:95750508-95750530 TTATGACTTCAGAGGGAGGAAGG + Intergenic
1122081462 14:99270533-99270555 TTTTGCAAATAGCAGGAGGAGGG + Intronic
1123671849 15:22666539-22666561 TTTAGCCTTAAGCAGAAGGATGG + Intergenic
1124146908 15:27136442-27136464 TTTTAACTTTAGAGGGTGGAAGG + Intronic
1124171848 15:27381330-27381352 TCATGCCTTCAGAAGGAGGAGGG - Intronic
1124323893 15:28739751-28739773 TTTAGCCTTAAGCAGAAGGATGG + Intergenic
1125805977 15:42494166-42494188 TTTGGCCTTGACAGGGAGGAAGG - Intronic
1126557268 15:50003526-50003548 TTTTTCCTTTAAAATCAGGATGG - Intronic
1127035246 15:54908712-54908734 CTGTGCCTTTGGAAAGAGGAGGG + Intergenic
1127354594 15:58186208-58186230 TGTTCCCTTTAGAAGTAGGGAGG - Intronic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1131790056 15:95954736-95954758 TTTTGCTTTTAGAAGGCAGGTGG - Intergenic
1131960914 15:97789357-97789379 TTTTGGCTTTGGAAAGAGGTGGG + Intergenic
1132336939 15:101053686-101053708 ATTTGCCTGTAAAAGGAGGATGG + Intronic
1134024393 16:10942796-10942818 TTTCTCCTTTAAAAGGAGGCGGG + Intergenic
1134324021 16:13190336-13190358 TTTAGTCTTTAGAATGATGATGG + Intronic
1137641279 16:50032521-50032543 TTTTGCCTCTGCAGGGAGGAAGG + Intronic
1138355038 16:56370926-56370948 TTCTGACTATAGAAGGAGCAGGG + Intronic
1138886433 16:61085322-61085344 TTTGGCATATAGGAGGAGGATGG - Intergenic
1139704929 16:68734760-68734782 TTTTGTCTTTTGATGGAGGACGG + Intergenic
1140646575 16:77038092-77038114 TTCTGCCTTTGGAAGGGGGAGGG - Intergenic
1142366155 16:89650847-89650869 TTTTGCCATCTGCAGGAGGAGGG - Intronic
1143046214 17:4081970-4081992 TATTGACTCTTGAAGGAGGAAGG - Intronic
1143253745 17:5540838-5540860 TTTGGCCTTGGGAAGAAGGAAGG + Intronic
1143402453 17:6655340-6655362 GCTTGCCTTTAGATGGAGGTTGG + Intergenic
1143840793 17:9730216-9730238 TTTTCTCTTAAGAAGGAGAATGG + Intergenic
1144180254 17:12745085-12745107 TTCTGCTTTTAGAAGGAACAGGG + Intronic
1145779188 17:27550819-27550841 TCTAGTCTTGAGAAGGAGGATGG + Intronic
1146167620 17:30601722-30601744 TTTTCCATTTAGAAAAAGGAAGG - Intergenic
1146220028 17:31009644-31009666 TTTTCCATTTAGAAAAAGGAAGG - Intergenic
1146636678 17:34511591-34511613 TGTTGCCACTAGAAGGAGGAGGG + Intergenic
1146833521 17:36090566-36090588 CTTTGCCTCTGGGAGGAGGAAGG - Intergenic
1149513413 17:57260923-57260945 TTCTGCCATGAGAAGGAGCAGGG - Intronic
1150039616 17:61845743-61845765 TTTTGCATACAGAAGCAGGATGG - Intronic
1151623113 17:75259259-75259281 TTTTGCCTTTAGTTGGATGGAGG - Intronic
1152183420 17:78839938-78839960 AAGTGACTTTAGAAGGAGGAGGG - Intronic
1153466487 18:5394235-5394257 TGTTGCCATCAGAAGGAGAAAGG + Intronic
1155139199 18:23028655-23028677 TTCTGCCTTTAAATGGAGTAAGG + Intergenic
1155533855 18:26795255-26795277 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1155782015 18:29849254-29849276 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1156025954 18:32655412-32655434 CTTTGCCTTTTGAAAGGGGAAGG - Intergenic
1156294651 18:35778556-35778578 TATTTCATTTAGAGGGAGGATGG + Intergenic
1156674219 18:39508092-39508114 TATTGCCTTAGGAAGGAAGAAGG - Intergenic
1156939105 18:42743304-42743326 TTTTGCCTTTAACAGTTGGATGG - Exonic
1157332091 18:46711544-46711566 TGTTGCCTTTGGGAGGGGGAAGG - Intronic
1157372309 18:47126398-47126420 TTTTTCCTTAAGAAGGAGATGGG + Intronic
1157898566 18:51491572-51491594 TTTTCCCTTTAGAATAAGCAAGG - Intergenic
1158633157 18:59133563-59133585 TTTTTCGTCTAGAAAGAGGAAGG + Intergenic
1158665970 18:59433109-59433131 TTTTGCAGAGAGAAGGAGGAAGG + Exonic
1160174472 18:76581251-76581273 TTTTACCTTTTGAAGGAGTGTGG + Intergenic
1161469380 19:4448642-4448664 TCTAGCCTTGAGAAGGCGGAAGG - Intronic
1164270946 19:23671154-23671176 TTTTCCCTTCAGGAAGAGGAAGG - Intronic
1164605745 19:29596663-29596685 CTTTTCCTTGATAAGGAGGAGGG + Intergenic
1165444722 19:35850545-35850567 CTTTTCCTCTAGAACGAGGAGGG - Intronic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
1168122442 19:54259408-54259430 CTTTGCCTTAAGAAAGGGGAGGG - Intronic
1168438277 19:56340027-56340049 TTTTGGGTTTGGATGGAGGAGGG - Intronic
926326489 2:11788639-11788661 TTTTGCCTTGATAAGGAAGAGGG - Intronic
926644766 2:15277811-15277833 TTGTGCTTTTAGAAGGGGAAAGG + Intronic
926742712 2:16125855-16125877 TTGTGCCTGTAGGAGGAGGCTGG + Intergenic
927366295 2:22300738-22300760 TTTTGATTTGAGAAGGTGGATGG + Intergenic
928302606 2:30139729-30139751 TTCAGCCTTAAGAAGGAAGAAGG - Intergenic
928876340 2:36044314-36044336 TTTTGGTTTTAGAAAGATGATGG + Intergenic
929388598 2:41442095-41442117 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
929968716 2:46554829-46554851 TTATGCCATTTGAAAGAGGATGG - Intronic
930170133 2:48243337-48243359 TTTTGCCTTTAGAATGTTGAAGG - Intergenic
931789767 2:65654491-65654513 TTTTGCCTTGCTAAGGAGGAGGG - Intergenic
932865722 2:75339713-75339735 TTTTCCCCTTAAATGGAGGAAGG - Intergenic
933370979 2:81415226-81415248 TTTTGCCTTTAAAAGTATGAAGG + Intergenic
934513833 2:94971601-94971623 TGTTGCCTGTAGAAGGTGGGAGG - Intergenic
935065526 2:99643958-99643980 TGTTGCCTTTGCAAGGAGAAAGG - Intronic
935453487 2:103237990-103238012 TTTTGCCTCTTGAATGAGAACGG + Intergenic
937011997 2:118571268-118571290 TTTTGCCTTCAGAAAGAGTCGGG - Intergenic
937147583 2:119660603-119660625 CTTTGGCCTTAGAAGGAGAATGG - Intronic
938692295 2:133802707-133802729 TCATGCCTTTGAAAGGAGGAGGG + Intergenic
938837583 2:135122595-135122617 ATTTTCCTTTATAAGGGGGAAGG + Intronic
939164818 2:138629159-138629181 TTTTGCCATTAGAGGGATGTGGG - Intergenic
939914290 2:148020841-148020863 CTTTCCCTTAGGAAGGAGGAGGG + Intronic
940503727 2:154527117-154527139 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
941220383 2:162771914-162771936 TGTTGCCTTGAGAAAGAGAAAGG - Intronic
942352388 2:175065837-175065859 TTTTGCCTTTGGAATGGGTAGGG + Intergenic
942896837 2:181067280-181067302 TTTTCTCTTTGGAAGGAGGTAGG + Intronic
943341122 2:186683459-186683481 TTTTACATTTAAAAGGAGGATGG + Intergenic
943728228 2:191274066-191274088 TTTTACCTTGAGAATGAGGTAGG + Intronic
944654769 2:201866618-201866640 TCTTGTCTTTGGAAGGAGAAGGG + Intronic
947323512 2:228949079-228949101 TTTTGCCTTTAGTAAGAGATAGG + Intronic
948017764 2:234703828-234703850 TTTTGCCTTTACAAGGAGCAAGG + Intergenic
948136836 2:235642753-235642775 TCTTGCTTTTAGAAGGAGGGGGG + Intronic
1168836126 20:878488-878510 TTTTCCCTCTAGCAGGTGGAGGG - Intronic
1169030284 20:2401337-2401359 TGTTGCCTCCAGGAGGAGGATGG - Intronic
1169465503 20:5834864-5834886 TTGTGCCTTTACATGGTGGAAGG + Intronic
1169923666 20:10760452-10760474 TCTTGTCACTAGAAGGAGGAAGG + Intergenic
1169941288 20:10940535-10940557 TTTGTCCTACAGAAGGAGGATGG + Intergenic
1170753398 20:19172654-19172676 TGATGGCTTTAGCAGGAGGAAGG + Intergenic
1170895780 20:20413078-20413100 TTTTGCATTGATAATGAGGAAGG - Intronic
1171246269 20:23612214-23612236 TTTTGACTTCAGAATGAGGATGG - Intergenic
1173004099 20:39126640-39126662 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1173291247 20:41717168-41717190 TTTACCCTTTAGAGGGAGGGTGG + Intergenic
1173338693 20:42135112-42135134 TCTTGCCTTTAGCAGAAGGGAGG + Intronic
1173352087 20:42254529-42254551 TTTTGCCTTTAGATAGATAAAGG + Intronic
1175473324 20:59249787-59249809 TTTTGGTTTAAGATGGAGGATGG + Intronic
1176152001 20:63596191-63596213 CTGTGCCTTTAGAAGGAGGAAGG - Intronic
1177200045 21:17944034-17944056 GCTTGACTTTAGAAGGATGATGG + Intronic
1177543874 21:22531603-22531625 TTTTGCCTTTTGAAGTTGTAAGG - Intergenic
1177578689 21:22992076-22992098 TTTTGCTTGTAGAAGGTTGAAGG + Intergenic
1177778685 21:25599197-25599219 GTTTGCCTTTGTAATGAGGATGG - Intronic
1178523278 21:33303789-33303811 TCTGGCCTTTGGCAGGAGGAGGG + Intergenic
1179247349 21:39645358-39645380 CTTTGCCTTTGGAGGGAGGCAGG + Intronic
1184984025 22:48117265-48117287 ATTTGCCTATGGAAGGAAGAAGG + Intergenic
953317669 3:41943750-41943772 TTTGGCTTTTGGAAGGAGCATGG - Intronic
955653678 3:61221737-61221759 TTCTTCCTTTAGAATGAGGCAGG - Intronic
957697610 3:83661610-83661632 TTTTTCTTTTAGAAATAGGATGG - Intergenic
958141188 3:89564494-89564516 TTTTGCCTTTGGAAAAGGGAGGG + Intergenic
958876741 3:99625111-99625133 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
959234702 3:103705123-103705145 TTTTTCATTTATAGGGAGGAGGG - Intergenic
959463179 3:106651438-106651460 TTTTGCCTTTTTAGGCAGGATGG + Intergenic
959636084 3:108572362-108572384 TTTTGCATTTGGTATGAGGAAGG + Intronic
960185877 3:114638204-114638226 TTTTTCCGTTACAAAGAGGAAGG + Intronic
961321416 3:126078916-126078938 TTTTGCCATGAAGAGGAGGAGGG - Intronic
962031883 3:131609478-131609500 TTTAGGCTTTAGAAGAAGGTGGG + Intronic
962862578 3:139418599-139418621 TTCTGCCTTTGTAAAGAGGAGGG - Intergenic
963425917 3:145123193-145123215 TTTGGCCTTACGAAAGAGGAGGG - Intergenic
963763298 3:149307580-149307602 CTCTGCCTGTAGAAAGAGGAAGG - Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964774679 3:160262706-160262728 TTTTGTCTTTAGGAGGAAAAGGG + Intronic
964787480 3:160414149-160414171 TTTTGCCTTTCTAAGTTGGAGGG - Intronic
964952724 3:162316806-162316828 CTCTGCCTTTAGAAAGTGGAGGG - Intergenic
964959235 3:162403721-162403743 TTTTGCCTTTGGAAGAGGAAGGG + Intergenic
965253345 3:166370073-166370095 TTATGCATTGAGGAGGAGGAGGG - Intergenic
965357036 3:167688444-167688466 TTTTTTCTTTAGAAAGGGGAGGG - Intronic
965664907 3:171082861-171082883 TTTTGATTCAAGAAGGAGGAAGG - Intronic
965666534 3:171099817-171099839 ATTTGCCTTTAAAGGTAGGAGGG + Intronic
965750548 3:171970711-171970733 TTTTGCATTTGGAGGGAGAAAGG - Intergenic
966312985 3:178615508-178615530 CTTTGCCTTTGGAAAGGGGAGGG - Intronic
966441803 3:179953585-179953607 TTTTGTTTTGAGAAGCAGGAGGG + Intronic
966491137 3:180529764-180529786 TTCTGCCTTTAAAAAGAGAAGGG + Intergenic
968327162 3:197828174-197828196 TTGTGACTTTAGAATTAGGAAGG - Intronic
970852802 4:20621665-20621687 TTGTGTCTTTATAAGCAGGAAGG - Intergenic
971767749 4:30855050-30855072 ATTTGCCTTCTGAAGGCGGAAGG + Intronic
972289092 4:37674483-37674505 TTTTGCCTTTAGAAGGAGGATGG + Intronic
972734015 4:41822570-41822592 TTTTCCCTATAGAATGTGGAGGG + Intergenic
973138464 4:46735677-46735699 TTTTGCCTGTAGGAGGGGGAAGG - Intronic
974275025 4:59708332-59708354 TTTTGTCTTAAGAAGCAAGAAGG + Intergenic
976750216 4:88445559-88445581 CTTTGCCTTCAGGAGGGGGAGGG - Intergenic
976814032 4:89125889-89125911 TTTTAGCATTAAAAGGAGGAAGG - Intergenic
978030976 4:103939470-103939492 CTCTGCCTTTGGAAAGAGGAAGG + Intergenic
979407793 4:120335773-120335795 TATTGCTTTTAAAAGGAGGGGGG - Intergenic
979744082 4:124188077-124188099 TTTTAACTTTAGAAGTAGAATGG - Intergenic
980455514 4:133036335-133036357 TATTGCCTGTAGAAGTAGGTAGG + Intergenic
981298056 4:143156006-143156028 ATCTGCCTTTAGAAAGGGGAGGG - Intergenic
982287168 4:153747476-153747498 TTGTGACTTTATAATGAGGATGG + Intronic
982680394 4:158421290-158421312 TTTTACATTTAGAAGGAGACTGG + Intronic
985708408 5:1414602-1414624 TTTTTCCTTGTGAAAGAGGAAGG - Intronic
986956914 5:13162718-13162740 GTTTGACTTGAGAAGGAAGAGGG - Intergenic
987496524 5:18652549-18652571 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
987911749 5:24155488-24155510 GTTTGACTTTAGAAAGTGGAAGG + Intronic
989280084 5:39631196-39631218 TTTAGCCTTAAAAAGGAGGTGGG - Intergenic
989472544 5:41837061-41837083 TTTTGGATTTAGAAGCAGGGTGG - Intronic
990802421 5:59619863-59619885 TTTGGCTGTTAGAGGGAGGAAGG + Intronic
991275740 5:64844397-64844419 AGTTGCCTTGAGAAGGAAGATGG + Intronic
991510311 5:67369104-67369126 TTTTGCTTTTAAAAGAAGTAGGG - Intergenic
991602831 5:68370659-68370681 TTATGCCCTGGGAAGGAGGAAGG + Intergenic
992417231 5:76563282-76563304 ATTTAAATTTAGAAGGAGGAGGG + Intronic
992533217 5:77671991-77672013 GTTTGCTTTTAAAAGGAGCAGGG + Intergenic
993090035 5:83413958-83413980 TTATTCCTTTAAAAGCAGGAGGG - Intergenic
993163629 5:84321583-84321605 TTTTTCCGTCAGAAGGATGAGGG - Intronic
993310860 5:86330492-86330514 TTTTGTCTTTATAATAAGGATGG - Intergenic
993623742 5:90198538-90198560 TTTTTCCTTCTGAAAGAGGAAGG + Intergenic
993798018 5:92293974-92293996 GAGTGCCTTTAGAGGGAGGATGG + Intergenic
993855067 5:93064170-93064192 ATGTGTCTTTAGAAGGAGAAAGG - Intergenic
993976588 5:94490003-94490025 TTTTACTTTTAGAAGAAGTATGG + Intronic
994477571 5:100290449-100290471 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
994633885 5:102320446-102320468 CTTTGCCTTTGGAAAAAGGAGGG - Intergenic
994686027 5:102953367-102953389 TTTAGCCTTTACAAGGAGGGGGG + Intronic
995558172 5:113352281-113352303 TTTTGCCCTTTGAAGCATGATGG + Intronic
995798747 5:115968725-115968747 TTATACCGTCAGAAGGAGGAGGG - Intronic
996594540 5:125185626-125185648 TTTTGCCTTTGGAAAGGGGAGGG + Intergenic
996820313 5:127619407-127619429 CTTTGCCCCTACAAGGAGGAGGG - Intergenic
996931600 5:128896002-128896024 CTTTGCCTGTAGAAAGAGGAGGG - Intronic
998695265 5:144631055-144631077 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
999001744 5:147931325-147931347 GTATGCCTTTAAAAGAAGGAGGG - Intergenic
1000270279 5:159677442-159677464 CTCTGCCTTTGGAAAGAGGAGGG + Intergenic
1001031437 5:168266177-168266199 GTTTCCCTTCAGGAGGAGGATGG + Intergenic
1001111096 5:168896909-168896931 TTCTGCCTTTCAAAGGAGGCTGG + Intronic
1001112189 5:168905864-168905886 TTTTGACTTTGGAAAGAAGAAGG + Intronic
1002553094 5:180012199-180012221 TTTTTCCGCTAGAAAGAGGAAGG + Intronic
1002679026 5:180946423-180946445 TTTAGCCTTTAAAAAAAGGATGG + Intronic
1002689730 5:181042348-181042370 TTTTGCCTGGGGAAGGAGTAAGG - Intronic
1002781571 6:370630-370652 ATATGCCTTTAGAGGGAGCAAGG + Intergenic
1002872817 6:1182651-1182673 TATTTCCTTTGGATGGAGGAAGG + Intergenic
1002917914 6:1543996-1544018 TTTGGTCTTTAGAATAAGGATGG + Intergenic
1003682878 6:8273017-8273039 CTTTACCTCTATAAGGAGGATGG + Intergenic
1004069951 6:12288773-12288795 TTTTGATTTTAGAAGGAGGAGGG + Intergenic
1004649082 6:17591202-17591224 ATTTTCCTTGAGAAGGAGGAAGG - Intergenic
1004690177 6:17987064-17987086 GTTTGGTGTTAGAAGGAGGAGGG + Exonic
1005267413 6:24126431-24126453 TTATGCATGAAGAAGGAGGAAGG - Intronic
1005307565 6:24528711-24528733 TTTTTTCTTGAGATGGAGGATGG + Intronic
1006558198 6:34887375-34887397 TTTTGTCTTTATAGGAAGGAGGG - Intronic
1007081549 6:39108698-39108720 TTTTGCCGTTTGTAGTAGGAGGG - Intronic
1008707497 6:54181243-54181265 TTTTGCCTGTGGAAAGGGGAGGG - Intronic
1010249204 6:73691161-73691183 TTTTGCCTTTAGAAAAATGATGG - Intergenic
1010719535 6:79266892-79266914 TTTTGCATATAGCATGAGGAAGG - Intergenic
1011097438 6:83682083-83682105 TGTGGCCTTAGGAAGGAGGAAGG - Intronic
1012332600 6:98011631-98011653 TTGTGCTTCTAGCAGGAGGAGGG - Intergenic
1012475187 6:99609026-99609048 TTTTTCCGTTTGAAGGATGACGG + Intronic
1012551334 6:100466916-100466938 TTTTGCCTTCAGAAGCAAGATGG + Intergenic
1012761675 6:103310156-103310178 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1014739650 6:125133593-125133615 TTTTGCTTATAGCATGAGGAAGG - Intronic
1015375050 6:132500901-132500923 TTTCACCTTGAGAAGGAGGAAGG - Intronic
1015436194 6:133191929-133191951 TTTTGCCTTTTTATGAAGGATGG - Intergenic
1015477825 6:133673055-133673077 TTTTGACTTTAGAAAGACAAAGG + Intergenic
1017313436 6:153001651-153001673 TTATGCCCTGAGAAGGATGAGGG - Intronic
1017571949 6:155754541-155754563 TTTTCCTTTTAGAAGGATAATGG + Intergenic
1018186783 6:161272285-161272307 TTTTGGCTTTAGCAGCCGGAAGG + Intronic
1020372821 7:7452960-7452982 TTTTTCCTTGAGGAGGAGCATGG - Intronic
1020382533 7:7562778-7562800 TTTTGCTTTTAGATGGAGGCTGG - Intergenic
1020415168 7:7937283-7937305 TTTTTTTTTTTGAAGGAGGACGG + Intronic
1020519928 7:9173082-9173104 TTCTGCCTTTGGAAAGGGGAAGG - Intergenic
1024377265 7:48654026-48654048 TGGTGCCTTTAGAAGCTGGAAGG + Intergenic
1027630375 7:80596828-80596850 TTTTGCTCTAAGAAAGAGGATGG + Intronic
1028133315 7:87202482-87202504 GTCTTCCTTTAGAATGAGGAAGG + Intronic
1028489988 7:91400391-91400413 TTGTGCCTTTAGATGCATGAAGG - Intergenic
1028493175 7:91436714-91436736 CATTGCCTTTAGGAGGAGGGAGG - Intergenic
1028542809 7:91962341-91962363 TTTTGTCTTTTGGTGGAGGAGGG + Intronic
1029223607 7:99009156-99009178 TTTTGCCCTTGGTAGGAGGCAGG + Intronic
1031200033 7:118670628-118670650 TTTTTTCTTGAGACGGAGGACGG + Intergenic
1031231566 7:119114220-119114242 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1031914944 7:127554201-127554223 CTATGCCTTTAGAGGGAGCATGG - Intergenic
1032781563 7:135168635-135168657 TTGAGCTTTTAGAAGGTGGAGGG - Intronic
1033794661 7:144833473-144833495 TTTTGTTTTGAGATGGAGGATGG + Intronic
1034317557 7:150147548-150147570 TATTTCATTTATAAGGAGGATGG - Intergenic
1034775199 7:153819677-153819699 TATTTCATTTATAAGGAGGACGG + Intergenic
1035059279 7:156057075-156057097 TTTTGCCTTGAGAAGGCCTAGGG + Intergenic
1036213446 8:6861098-6861120 TTTAGACGTTAGAAGGAAGATGG + Intergenic
1036784422 8:11676622-11676644 TCTTGCCTTTAGATTGAGGTAGG - Intergenic
1037189695 8:16108753-16108775 TTTTGCCTTTTTAAGTTGGACGG + Intronic
1037865994 8:22442397-22442419 TTTTGGTATTAGAAGGAGAAAGG + Intronic
1038298610 8:26320950-26320972 TCTTGACTTTGGGAGGAGGATGG + Intronic
1038815756 8:30902370-30902392 TTTTGCTTTTTGCAGGGGGAGGG + Intergenic
1038822729 8:30967704-30967726 TTTTGCCATTACAAGGAGGCCGG - Intergenic
1038871835 8:31503747-31503769 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1039002282 8:32995091-32995113 CTCTGCCTTTAGAAAGGGGAGGG - Intergenic
1039282055 8:35996936-35996958 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1039427898 8:37501898-37501920 TTGTGCCTTTAGAAGTTTGATGG - Intergenic
1040275674 8:46012486-46012508 TTTTGCCTGTTGAAGGACCAAGG + Intergenic
1041269754 8:56099815-56099837 TTTTGACTTTAGAAAGTGGCTGG + Intergenic
1041611866 8:59859866-59859888 TATTGTCTTTTGAAGGAGCATGG + Intergenic
1041644494 8:60237738-60237760 TTTTGCCTTTGGAGGGAGAATGG - Intronic
1041902216 8:62994789-62994811 TTTTCCCTTTACAAGGAAGGTGG + Intronic
1043669468 8:82863892-82863914 TTATTCTTTTAGAAGGGGGAAGG - Intergenic
1044431231 8:92109629-92109651 CTCTGCATATAGAAGGAGGATGG - Intergenic
1044622797 8:94206949-94206971 TTTTGCCTTTTGTATGAGAAAGG + Intronic
1044669805 8:94667817-94667839 TTTTGCGTTCAGTAGGAGTATGG + Intronic
1045042503 8:98239428-98239450 ATTTACTTTCAGAAGGAGGAGGG + Intronic
1045090027 8:98732128-98732150 TTTTGCCTTTTGGAGGAGGCGGG - Intronic
1045590001 8:103582696-103582718 CTCTGCCTTTGGAAAGAGGAGGG + Intronic
1046349052 8:112981929-112981951 TTTTACCCTAAGAAGGAGAATGG + Intronic
1047207634 8:122816176-122816198 TTTAGCCTTTTGATGGTGGAAGG - Intronic
1047354896 8:124111264-124111286 TTTTCCCTTTAGGAGGTGTAAGG - Intronic
1047623865 8:126635724-126635746 TTTGTCCTTTTGGAGGAGGAGGG - Intergenic
1047698454 8:127426975-127426997 TTTTCCCTTTAGGAGGAAAAGGG - Intergenic
1047705256 8:127492813-127492835 TTTTGGCTTTTGAAGGTGAAAGG - Intergenic
1048332363 8:133479478-133479500 ATTTGCCTTTATAATGAGCAGGG + Intronic
1048700677 8:137085529-137085551 TTTGGCCTCTAGAAGGAGCCTGG + Intergenic
1049671318 8:143871313-143871335 TTGTGCCTCCAGAAGGATGAGGG + Exonic
1050977854 9:11964977-11964999 TTGTGCCTCTAGATGGAGAAAGG + Intergenic
1051108457 9:13607807-13607829 TTTGGGGTTTAGAAGGAGGTGGG - Intergenic
1051769884 9:20565887-20565909 TTTTTCCTTGAGTAGGAGGAAGG - Intronic
1052046652 9:23801824-23801846 TTTTGCATTTTAAAGGGGGAAGG + Intronic
1056560876 9:87728015-87728037 GTTTGCCTCTAGAATGAAGAAGG + Exonic
1056566021 9:87772867-87772889 ATTTGCCTCTAGAATGAAGAAGG + Intergenic
1056574510 9:87844568-87844590 GTTTGTCTTTAGAATGAAGAAGG + Intergenic
1056732199 9:89176344-89176366 TTTTGCTTTTTAAAGAAGGAAGG - Intronic
1057664870 9:97037605-97037627 GTTTGCCTCTAGAATGAAGAAGG - Exonic
1058138361 9:101332590-101332612 ATTTGCCATTACTAGGAGGAGGG - Intergenic
1059045979 9:110867220-110867242 TTTGGCTTTTGGAAGGTGGAGGG + Intergenic
1059663273 9:116422408-116422430 TTTTGACTTAAGATGGAGAAGGG + Intergenic
1059906157 9:118989199-118989221 TTTTGACCTTAGAAAGTGGAGGG + Intergenic
1186439793 X:9575931-9575953 TTTTACCTTTAAATGGAGGAGGG + Intronic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187610531 X:20938779-20938801 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1187956218 X:24521633-24521655 TTTGGCCTTTAGAATGAGGGAGG - Intronic
1188634742 X:32415123-32415145 TTTTGCCTTTAGCCAGAGGAAGG - Intronic
1189030646 X:37446244-37446266 TATTGCCTTAATAAGGATGAAGG - Intronic
1189156936 X:38767520-38767542 TTTAGCATTTAGCAGGAGTAAGG + Intergenic
1189737772 X:44089068-44089090 TTTTGGATGAAGAAGGAGGAGGG + Intergenic
1190374284 X:49774368-49774390 CTCTGCCTGTGGAAGGAGGAGGG - Intergenic
1191703805 X:64071273-64071295 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1192027194 X:67466272-67466294 TTCTGCCTTTGGAAAGGGGAGGG + Intergenic
1192812614 X:74560374-74560396 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
1193063638 X:77233664-77233686 CTATGCCTTTAAAAAGAGGAGGG + Intergenic
1193438782 X:81513071-81513093 CTCTGCCTTTAGAAAGGGGAGGG + Intergenic
1193504917 X:82330376-82330398 TTTTGCCTGTGGAAAGGGGAGGG - Intergenic
1193957874 X:87885510-87885532 CTCTGCCTTTGGAAAGAGGAGGG - Intergenic
1194157824 X:90415306-90415328 CTCTGCCTTTGGAAAGAGGAAGG - Intergenic
1194318840 X:92417644-92417666 TTTTACCTTTAGAGTGAGCAAGG - Intronic
1194329174 X:92560045-92560067 CCTTGCCTTAAGAAGAAGGAAGG - Intronic
1194370869 X:93069884-93069906 TTTTGCCTTTGGAAAATGGAGGG + Intergenic
1196143570 X:112292330-112292352 TTTTTCATTTATAAGGAGAAAGG - Intergenic
1196226253 X:113170975-113170997 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196579124 X:117359013-117359035 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1196591003 X:117485201-117485223 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1196865414 X:120066376-120066398 CTTTGCCTTTGGAAAGGGGAGGG + Intergenic
1196877680 X:120169904-120169926 CTTTGCCTTTGGAAAGGGGAGGG - Intergenic
1196963848 X:121033700-121033722 TAGAGCCTTTAGAAGGAGCATGG + Intergenic
1197535877 X:127689072-127689094 TTTTGCCTTTGAAAAGTGGAGGG - Intergenic
1197661473 X:129178668-129178690 TTCTGCCTTTGGAAAGGGGAGGG - Intergenic
1198180638 X:134205039-134205061 TTTTGCCTTCACATGGTGGAAGG + Intergenic
1198726802 X:139686635-139686657 TTTTGGCTTTAGCAAGTGGATGG - Intronic
1198841083 X:140858868-140858890 TTTTGCCTGTGGAAAGGGGAAGG + Intergenic
1199756489 X:150869854-150869876 TTTGGCCTTTTGGAGGAAGATGG + Intronic
1200504156 Y:3992275-3992297 CTCTGCCTTTGGAAAGAGGAAGG - Intergenic
1200626973 Y:5530799-5530821 TTTTACCTTTAGAGTGAGCAAGG - Intronic
1200678664 Y:6181774-6181796 TTTTGCCTTTGGAAAATGGAGGG + Intergenic