ID: 972290665

View in Genome Browser
Species Human (GRCh38)
Location 4:37686877-37686899
Sequence AAGCCGGGCCGGGATTACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972290651_972290665 15 Left 972290651 4:37686839-37686861 CCGGCCGTGCCTCTACTTGCCAG No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290658_972290665 -9 Left 972290658 4:37686863-37686885 CCCGCTTCCTTTCCAAGCCGGGC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290649_972290665 22 Left 972290649 4:37686832-37686854 CCGTGGCCCGGCCGTGCCTCTAC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290653_972290665 11 Left 972290653 4:37686843-37686865 CCGTGCCTCTACTTGCCAGGCCC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290647_972290665 26 Left 972290647 4:37686828-37686850 CCCACCGTGGCCCGGCCGTGCCT No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290650_972290665 16 Left 972290650 4:37686838-37686860 CCCGGCCGTGCCTCTACTTGCCA No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290655_972290665 -4 Left 972290655 4:37686858-37686880 CCAGGCCCGCTTCCTTTCCAAGC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290648_972290665 25 Left 972290648 4:37686829-37686851 CCACCGTGGCCCGGCCGTGCCTC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290646_972290665 30 Left 972290646 4:37686824-37686846 CCTGCCCACCGTGGCCCGGCCGT No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290654_972290665 6 Left 972290654 4:37686848-37686870 CCTCTACTTGCCAGGCCCGCTTC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data
972290659_972290665 -10 Left 972290659 4:37686864-37686886 CCGCTTCCTTTCCAAGCCGGGCC No data
Right 972290665 4:37686877-37686899 AAGCCGGGCCGGGATTACGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972290665 Original CRISPR AAGCCGGGCCGGGATTACGC GGG Intergenic