ID: 972304094

View in Genome Browser
Species Human (GRCh38)
Location 4:37815077-37815099
Sequence CCTCAAATGGTGGAGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972304094_972304099 -9 Left 972304094 4:37815077-37815099 CCTCACTCCTCCACCATTTGAGG No data
Right 972304099 4:37815091-37815113 CATTTGAGGACACAGTGAGAAGG 0: 4
1: 231
2: 743
3: 1654
4: 2737
972304094_972304102 20 Left 972304094 4:37815077-37815099 CCTCACTCCTCCACCATTTGAGG No data
Right 972304102 4:37815120-37815142 TCAGCAGACAGTGAATCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972304094 Original CRISPR CCTCAAATGGTGGAGGAGTG AGG (reversed) Intergenic
No off target data available for this crispr