ID: 972307032

View in Genome Browser
Species Human (GRCh38)
Location 4:37840682-37840704
Sequence CTCTAAAATCAGATGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 210}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972307032_972307037 13 Left 972307032 4:37840682-37840704 CCCAGCTGCATCTGATTTTAGAG 0: 1
1: 0
2: 0
3: 24
4: 210
Right 972307037 4:37840718-37840740 CCTTGGCAAACTTTTCTTAAAGG 0: 1
1: 0
2: 2
3: 24
4: 214
972307032_972307038 14 Left 972307032 4:37840682-37840704 CCCAGCTGCATCTGATTTTAGAG 0: 1
1: 0
2: 0
3: 24
4: 210
Right 972307038 4:37840719-37840741 CTTGGCAAACTTTTCTTAAAGGG 0: 1
1: 2
2: 8
3: 86
4: 427
972307032_972307035 -4 Left 972307032 4:37840682-37840704 CCCAGCTGCATCTGATTTTAGAG 0: 1
1: 0
2: 0
3: 24
4: 210
Right 972307035 4:37840701-37840723 AGAGGCTGTAGATCAAGCCTTGG 0: 1
1: 0
2: 0
3: 17
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972307032 Original CRISPR CTCTAAAATCAGATGCAGCT GGG (reversed) Intronic
903082113 1:20819060-20819082 TTCTAAAATCTTATGGAGCTGGG - Intronic
903767166 1:25742284-25742306 CTCTAAAGCCAGATCCAACTTGG - Intronic
904918876 1:33990856-33990878 ATCCAAAATCAGATTTAGCTGGG - Intronic
905471150 1:38193062-38193084 CTCTGGAATCACATGCATCTGGG - Intergenic
906163169 1:43666193-43666215 CTATAAGAACAGAGGCAGCTTGG + Intronic
906322147 1:44823448-44823470 CTCTGAAGACAGATACAGCTCGG - Intronic
908068395 1:60432721-60432743 CTCTAAATACAGTTGCAGTTTGG - Intergenic
908654334 1:66371986-66372008 CTTTGGAATCAGATGAAGCTGGG + Intronic
909046606 1:70718186-70718208 CTCTGAAATCAGATGGAACTGGG - Intergenic
909440939 1:75695280-75695302 CCCTAAAATCAGATGCTTCTAGG + Intergenic
909559328 1:76992270-76992292 GACTAAAATCAGATGAAGCAGGG - Intronic
909561205 1:77010822-77010844 TTCTAAAAGCAGCTGCAGCCTGG + Intronic
911383432 1:97144776-97144798 CACTATAATCTGATGCAGCAAGG + Intronic
913482289 1:119300295-119300317 CTATGAAATGAGATGCAACTTGG + Intergenic
915841201 1:159214882-159214904 CTCTGAAATCAGTTACAGCTGGG + Intergenic
916685111 1:167137189-167137211 CTTTAAAATCAGATATAGCTAGG - Intergenic
916806021 1:168261972-168261994 CTCTAAAATCAGAGGATGTTTGG + Intergenic
920823040 1:209399280-209399302 CTCTAAACTAAGATGCTGCTGGG + Intergenic
921059837 1:211576634-211576656 CACCAAAATTAAATGCAGCTAGG + Intronic
922042244 1:221907822-221907844 CTCAAAAATCAGATGATGCTAGG + Intergenic
1067715726 10:48689962-48689984 CTTTAAAATCAGGTGGAACTAGG - Intronic
1069069401 10:63977936-63977958 GTCTATAATCAGAGCCAGCTGGG + Intergenic
1069987002 10:72291301-72291323 CTCTGAAGTCAGATACACCTGGG + Intergenic
1072161741 10:92773517-92773539 ATCTAAAATCAGCAGCAGATAGG - Intergenic
1074324194 10:112431867-112431889 CACTGAAAACAGATGGAGCTAGG - Intronic
1075544413 10:123343547-123343569 CTCTGGAAACAGATGGAGCTGGG + Intergenic
1077740059 11:4835758-4835780 CTATAAAATGAGGTGGAGCTGGG + Intronic
1079644939 11:22851469-22851491 CTCTAAATTTATTTGCAGCTAGG + Intronic
1080042280 11:27771356-27771378 CTTTGAAATCAGATGTATCTTGG - Intergenic
1081517654 11:43849005-43849027 CTTTAAAATAAAATCCAGCTGGG + Intronic
1082809846 11:57473238-57473260 CATAAAAATCAGATGCAGATGGG + Intronic
1084042964 11:66553256-66553278 CCCAAAAAATAGATGCAGCTGGG + Intronic
1084455686 11:69266923-69266945 CTGTAAATACAGATGAAGCTTGG - Intergenic
1086243080 11:84720039-84720061 CTACAAGAGCAGATGCAGCTCGG - Intronic
1086425635 11:86679845-86679867 CTTTAAAGTCAGATACATCTGGG + Intergenic
1089007560 11:115105275-115105297 CCCTCAAAGCAGGTGCAGCTGGG - Intergenic
1089174055 11:116535797-116535819 CTCTAGAATCAGAGACTGCTGGG + Intergenic
1089610092 11:119664241-119664263 CAGTGAAATCTGATGCAGCTGGG - Exonic
1090553343 11:127846924-127846946 CTCTACAATCATTTGCATCTAGG - Intergenic
1092354768 12:7785471-7785493 CTATAAAAACACAAGCAGCTAGG - Intergenic
1092387450 12:8047103-8047125 CTCTATAAACAAATGTAGCTTGG - Intronic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1094813058 12:34160867-34160889 CTCTGAAATCAGATGGAGGAAGG + Intergenic
1096649516 12:53055078-53055100 CTCTAAAATAAGGTGCAGGCCGG - Intronic
1097350914 12:58548192-58548214 CTCTACAATCAGTTTCAGCTGGG + Intronic
1097916227 12:65022961-65022983 CTCTAAAATCAGCTGCTATTAGG - Intergenic
1099043570 12:77686741-77686763 CTGTAAAGTCAGATGAACCTAGG - Intergenic
1100162710 12:91879219-91879241 CTTTGAAATCAGATGGAACTGGG + Intergenic
1101794387 12:107959354-107959376 CTCAAAAGTCAGATATAGCTGGG + Intergenic
1102517568 12:113460079-113460101 CTCTAAAATCCGTTACAGTTAGG + Intergenic
1102777313 12:115531729-115531751 ATCTAACATCAGATACACCTGGG + Intergenic
1103497877 12:121376784-121376806 CTATAAAATAAAATACAGCTGGG - Intronic
1104576788 12:129973223-129973245 CTCTCAAATTAGATGCATCCAGG - Intergenic
1105464371 13:20624097-20624119 CTCTGAAATTTGTTGCAGCTTGG + Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108361051 13:49668247-49668269 CTCTAAAATCATCTCCAGCTAGG - Intronic
1108446063 13:50510211-50510233 CTGTAACATCAGCTGTAGCTGGG + Intronic
1110961927 13:81637582-81637604 CTATAAAAGCAGCTGCAGTTGGG + Intergenic
1111054320 13:82927964-82927986 CTCTAAAATAAGATGCTGATGGG - Intergenic
1111272780 13:85909202-85909224 CTTTAAAATCAGAAGCATCCAGG + Intergenic
1112452282 13:99523444-99523466 ATCTAAAATAAGATAAAGCTGGG - Intronic
1112472547 13:99702014-99702036 CTCTAAAATCTGACACACCTGGG - Intronic
1114067197 14:19071441-19071463 CTCTAAAGCAAGATGGAGCTGGG + Intergenic
1114095065 14:19328587-19328609 CTCTAAAGCAAGATGGAGCTGGG - Intergenic
1114202872 14:20539227-20539249 CCATAAAAACACATGCAGCTAGG - Intergenic
1114501886 14:23175799-23175821 CACTAAAATCTGAAGCAACTGGG - Intronic
1116278255 14:42865707-42865729 CTCTAAAATGAAAAGCATCTAGG - Intergenic
1117630951 14:57690884-57690906 CTCTAAATACAGATGAAGCTTGG + Intronic
1121393786 14:93599904-93599926 CATTAAAACCAGATGCAGCTGGG + Intronic
1121899641 14:97682233-97682255 GTTAAAAATGAGATGCAGCTTGG - Intergenic
1122078579 14:99251596-99251618 CTGTAAATTCAGGTGCACCTGGG - Intronic
1127891961 15:63260126-63260148 CATAAAAATCAGAAGCAGCTGGG - Intronic
1130661855 15:85837093-85837115 TTCTAAAATGAGATGCAGGCCGG - Intergenic
1134379043 16:13707402-13707424 CTGTAAATACAGATGAAGCTTGG - Intergenic
1135642292 16:24131254-24131276 ATCTAAAATCAGAAGCAGAGAGG + Intronic
1138381586 16:56606702-56606724 CTCTAAAATCAGAGGATGTTTGG + Intergenic
1141213995 16:82007554-82007576 CTGTAGAGTCAGATGCACCTGGG - Intronic
1141350178 16:83287401-83287423 CTGTAAATACAGATGAAGCTTGG - Intronic
1141807832 16:86353772-86353794 CCCCAAACTCAGATGCTGCTAGG - Intergenic
1142115574 16:88354438-88354460 CTCCAGAATTAGGTGCAGCTGGG + Intergenic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1150455865 17:65305995-65306017 CTGTAAATACAGATGAAGCTTGG + Intergenic
1155367005 18:25058719-25058741 CTGTAAATACAGATGAAGCTTGG + Intergenic
1156029201 18:32692735-32692757 CTCTGAAATCAGATAGACCTAGG + Intronic
1163334139 19:16660548-16660570 CTCTAAAATGAGATCCTCCTGGG + Intergenic
1163677962 19:18664877-18664899 CTCTAAAATCAGAAGGGGCCCGG - Intronic
1166132359 19:40753691-40753713 CTCTAAAAACATATGCAGGCCGG - Intronic
1167957872 19:53082384-53082406 TTCTAAAATCAGATGTGGCCAGG + Intronic
1168493250 19:56829053-56829075 CTAAAAAGTCAGCTGCAGCTGGG + Intronic
924967017 2:87034-87056 TTCTAAAATAAAATTCAGCTGGG + Intergenic
926292556 2:11542336-11542358 CTCCAAGAGCAGATGCAGCCGGG - Intronic
926463324 2:13161020-13161042 CTCAAAAATTAGATGCAGGCAGG - Intergenic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
929341880 2:40829564-40829586 CTCTAAAATCAGAAGAACCTGGG + Intergenic
929622981 2:43376424-43376446 CTCTAACATCACATGTAGTTTGG - Intronic
931343436 2:61425103-61425125 CTAAAAAATCAGTGGCAGCTGGG - Intronic
931883391 2:66590091-66590113 GTCTGAAATTTGATGCAGCTTGG + Intergenic
933582965 2:84148007-84148029 CACCATAATCAGAGGCAGCTTGG + Intergenic
935670263 2:105549712-105549734 CTCTAAAATTATATGGAACTGGG - Intergenic
936381450 2:111990083-111990105 CACTAAAATCAGATGCACACAGG - Intronic
937745702 2:125411047-125411069 CTCAAAAATCAGCTTCAGGTGGG + Intergenic
938763857 2:134447595-134447617 CTCTGATATCAGATACAGCATGG + Intronic
939643346 2:144667231-144667253 CTGTAAAATGAGAGGCAGATAGG + Intergenic
939775667 2:146384594-146384616 CCCTAACATCATATGCAGTTGGG - Intergenic
939919742 2:148094923-148094945 CTTTGAAATCAGATTCACCTAGG - Intronic
940158792 2:150689211-150689233 CTTTAAAATCAGATAGACCTGGG - Intergenic
941195468 2:162445553-162445575 CTCTTAAATAATATTCAGCTTGG - Intronic
942778408 2:179612757-179612779 CTCTAAAATCAGCCCCAGGTGGG + Intronic
945229706 2:207573397-207573419 CTCTAAAAACAAAAGCATCTGGG - Intronic
945457182 2:210063761-210063783 CTGTAAAATCAAAAGCAGGTTGG - Intronic
945514829 2:210750181-210750203 CTTTAGAATCAGATTCAGCTGGG + Intergenic
946363508 2:219234052-219234074 CTCTCAATGCAGATGTAGCTGGG - Intronic
946821572 2:223634958-223634980 CTCTAAAGTTAGACTCAGCTTGG - Intergenic
947516726 2:230812059-230812081 CTCTAAATTCTGATCCAGTTTGG + Intronic
1171030108 20:21669414-21669436 CTCTGACTTCAGCTGCAGCTGGG + Intergenic
1171079652 20:22165782-22165804 CCTTAAAGTCAAATGCAGCTTGG - Intergenic
1171494136 20:25543252-25543274 CTTAAAAATCAGTTGCAGCCGGG + Intronic
1173337409 20:42124049-42124071 CTCTTTACTCAGATGCAGCGTGG - Intronic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1175084305 20:56445803-56445825 CTCCAAAAGCAGAGACAGCTGGG - Intronic
1175526030 20:59634251-59634273 CTCTGAAATCAGGCGGAGCTGGG + Intronic
1178475062 21:32930892-32930914 CTGTAAATACAGATGAAGCTTGG + Intergenic
1179010241 21:37551010-37551032 TTCCAAAATGATATGCAGCTGGG - Intergenic
1179831786 21:44001433-44001455 CTCTGATTTCAGGTGCAGCTGGG - Intergenic
1180485673 22:15794008-15794030 CTCTAAAGCAAGATGGAGCTGGG + Intergenic
1181829582 22:25549258-25549280 CTGTAAATACAGATGAAGCTTGG - Intergenic
1182125217 22:27811023-27811045 CTCTTAAATCACAGGGAGCTGGG + Intergenic
1182335045 22:29578470-29578492 CTTTGAAATCAGATGGACCTGGG - Intronic
1184643447 22:45884037-45884059 CTGTAATTTCAGATGTAGCTGGG + Intergenic
950762363 3:15243357-15243379 CTCCAAATGAAGATGCAGCTAGG + Intronic
952286038 3:31970641-31970663 CTTTAAAATGAGATGGAGGTGGG - Intronic
958160761 3:89814847-89814869 CTCTAAAATCAAAAGCAAGTAGG + Intergenic
960846572 3:122009368-122009390 CTTTAGATTCAGATACAGCTGGG + Intronic
961666060 3:128493680-128493702 CCATACAATCAGATGCAACTCGG + Intergenic
961741789 3:129037763-129037785 CCCTAAAATCAGATGTGGCTGGG + Intronic
963076854 3:141355260-141355282 CTCTAAAATCAGATTAAACTTGG + Intronic
964535194 3:157713877-157713899 CTTTCAAATCAGATGCAGTTTGG + Intergenic
966718939 3:183041921-183041943 ATTAAAAAACAGATGCAGCTTGG + Intronic
967080472 3:186045000-186045022 ATCTAAATTCTAATGCAGCTGGG - Intergenic
967707136 3:192664368-192664390 CTCTAAAATCAGAAGCGCCAAGG - Intronic
972120125 4:35691495-35691517 CTCTAAAAGTAGATAAAGCTAGG + Intergenic
972187530 4:36549399-36549421 CTCTATCAGCAAATGCAGCTTGG + Intergenic
972202582 4:36733158-36733180 ATTTAAAATCAGATGCAGTGTGG - Intergenic
972307032 4:37840682-37840704 CTCTAAAATCAGATGCAGCTGGG - Intronic
973992222 4:56421042-56421064 CTGTAAATACAGATGAAGCTTGG - Intronic
974566317 4:63581428-63581450 ATCTGGAAGCAGATGCAGCTTGG + Intergenic
975170392 4:71225790-71225812 ATCTCAGATCAGATGCAGATTGG - Intronic
976492647 4:85689682-85689704 TACTAAAATCAGTAGCAGCTGGG - Intronic
977705586 4:100066789-100066811 CTCTAGAATTAGATGCAACTGGG - Intergenic
979966983 4:127087208-127087230 CTGTAAAATCAGAAGCAAGTTGG - Intergenic
981980094 4:150781474-150781496 CTATAAATACAGATGAAGCTTGG + Intronic
983583478 4:169331709-169331731 TTAAAAAATCAGATGCAGCCAGG - Intergenic
983889587 4:173016649-173016671 CTGTAAAATCAAATGCAAGTTGG - Intronic
986899236 5:12412114-12412136 CTCCTAAAGCAGATACAGCTTGG - Intergenic
988005311 5:25402867-25402889 CTCTAAAAACAGCTCAAGCTAGG - Intergenic
988858846 5:35255998-35256020 CTCACAAATTAGATGGAGCTTGG + Intergenic
994671479 5:102766515-102766537 CTGTAAATACAGATGAAGCTTGG + Intronic
995215335 5:109588778-109588800 CTCTAAAGTCAGCAGCAGCAAGG - Intergenic
996257702 5:121426087-121426109 CTGTAAAATCAAAAGCAACTTGG + Intergenic
996313428 5:122133853-122133875 TTCTAAAATAAGCTGGAGCTGGG - Intronic
997147632 5:131454053-131454075 TTCTGAAATCAGATACACCTAGG - Intronic
999265687 5:150265346-150265368 CTCTACAAGCAGATCCCGCTGGG + Intronic
999544238 5:152609169-152609191 CTTTAAAGTCATATGTAGCTGGG + Intergenic
1001114162 5:168924806-168924828 CTCAAAACTCAAATGCAGCTGGG - Intronic
1001991343 5:176118161-176118183 CTCTAAGATCAGATACATTTAGG - Intronic
1002225531 5:177719974-177719996 CTCTAAGATCAGATACATTTAGG + Intronic
1002268318 5:178051231-178051253 CTCTAAGATCAGATACATTTAGG - Intronic
1003493281 6:6642151-6642173 CCCTAAAAGCATATGCTGCTGGG + Intronic
1003805018 6:9718399-9718421 TTTTAAAATCAGATGGAACTGGG + Intronic
1004327268 6:14686698-14686720 CTGTAAAAACAGATGAAGCCTGG + Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005140102 6:22621992-22622014 TTCTAAAATCATATTCAACTGGG + Intergenic
1005590649 6:27322521-27322543 CTATAAAATAAGGAGCAGCTGGG - Intergenic
1006483160 6:34314952-34314974 CTTTAAAATCAGAGGCACCTAGG - Intronic
1006669335 6:35720026-35720048 CTTTAAAACTAGAAGCAGCTCGG + Intronic
1007728269 6:43929981-43930003 CTCTTAACTCAGAGGCAGATGGG - Intergenic
1007844943 6:44746106-44746128 CTATAAAAACACATGCAGCCGGG - Intergenic
1007881189 6:45168618-45168640 ATTTAAAAACAGATGCAGCCAGG - Intronic
1009383848 6:63065710-63065732 CTCTAAAATTAGAGGCAGCAGGG - Intergenic
1011840391 6:91490476-91490498 CTCTAAATTTAGTGGCAGCTGGG + Intergenic
1012350710 6:98246689-98246711 CTCTAGATTCAGATGAAACTTGG + Intergenic
1016643689 6:146379763-146379785 CCCTTAAAGCAGATACAGCTTGG - Intronic
1016841397 6:148529110-148529132 CTGTGAAAACAGATGAAGCTTGG + Intronic
1017778045 6:157695005-157695027 ATCTATAATCAGACCCAGCTTGG + Intergenic
1020184334 7:5947411-5947433 CTGTAAAAACAGATGAAGGTAGG + Intronic
1020298583 7:6777355-6777377 CTGTAAAAACAGATGAAGGTAGG - Intronic
1021802569 7:24322058-24322080 CTCTCCAATTTGATGCAGCTAGG + Intergenic
1021906922 7:25343571-25343593 CTCTCAAGTCAGCTGCAGCCAGG + Intergenic
1026081506 7:67225660-67225682 CTCTAAAAGCAACTGCTGCTGGG - Intronic
1026224209 7:68426564-68426586 CTGTAAAGTCAGATGCTTCTGGG - Intergenic
1026234888 7:68518897-68518919 CTCTAGAGTCAGATGATGCTGGG + Intergenic
1026695571 7:72588348-72588370 CTCTAAAAGCAACTGCTGCTGGG + Intronic
1030188407 7:106786641-106786663 CTCTCCAATCAAATGGAGCTAGG - Intergenic
1034291381 7:149934773-149934795 CTCGAAACTCAGAGGCAGCGTGG - Intergenic
1034508581 7:151517066-151517088 CTTTAAAATCAAATGCGGCTGGG + Intronic
1034814717 7:154162121-154162143 CTCGAAACTCAGAGGCAGCGTGG + Intronic
1036720452 8:11170028-11170050 ATCTAACGTCAGATCCAGCTAGG - Intronic
1037488388 8:19372507-19372529 CTCCAAAAACAGATGCTGATGGG - Intronic
1038042844 8:23740565-23740587 CTTTAAAAAGAAATGCAGCTGGG + Intergenic
1039468408 8:37799068-37799090 CTCTGAATTCTTATGCAGCTGGG - Intronic
1040404593 8:47087420-47087442 CTGGAAAATCTGAGGCAGCTAGG - Intergenic
1041396726 8:57399228-57399250 CTCCAAAGTCAGGTGCAGGTGGG - Intergenic
1041473362 8:58235548-58235570 GTCTAAAATCAGTTTCAGCAGGG + Intergenic
1042461437 8:69073568-69073590 CTCTCAAATCAGATGGACCTGGG - Intergenic
1044856375 8:96480254-96480276 CTGGAATACCAGATGCAGCTGGG - Intergenic
1045713575 8:105015142-105015164 CTCTTAAACCAGAGGGAGCTTGG - Intronic
1046853052 8:118997626-118997648 CTTCAGAATCAGTTGCAGCTGGG - Intronic
1047734935 8:127756967-127756989 CTCTGGAATCAGATCGAGCTGGG - Intergenic
1048940054 8:139392754-139392776 TTCTAAATTCAAATGGAGCTTGG - Intergenic
1050426633 9:5518200-5518222 CTCTAAAATCAGACACATCTGGG - Intronic
1051723474 9:20064384-20064406 TTCTAAAATCAGATTGTGCTTGG + Intergenic
1051930539 9:22380232-22380254 TTCTAAAATGACATCCAGCTTGG + Intergenic
1052604825 9:30686407-30686429 CTATAAAGACACATGCAGCTGGG + Intergenic
1052839042 9:33275712-33275734 CTTTAAAATCAAATCCAGCCGGG + Intronic
1054580449 9:66907254-66907276 CTCTAAAATCATATGTATCCTGG + Intronic
1057920859 9:99095450-99095472 CTCTATAATTAGATGAAGATGGG + Intergenic
1057930967 9:99192610-99192632 CTCAAAAGTCAGCAGCAGCTTGG - Intergenic
1058114972 9:101074887-101074909 CTTTAGAATCAGATCCTGCTGGG - Intronic
1058951775 9:109910715-109910737 GACTAAAAGCAGATGCAGCAGGG + Intronic
1059412557 9:114141899-114141921 CTCTAGAATCAGATGGTTCTAGG + Intergenic
1061430840 9:130529839-130529861 CTCTGAAAGAAGATGCAGCCCGG - Intergenic
1061625666 9:131839291-131839313 CTCCAAGCTCAGCTGCAGCTGGG - Intergenic
1061969798 9:134038583-134038605 CTCAAAAATGAGTTGCAGCCTGG - Intronic
1186204826 X:7190389-7190411 CTGTAAATACAGATGAAGCTTGG + Intergenic
1190135509 X:47792999-47793021 CTCAAAAATCAGTTGAGGCTGGG - Intergenic
1191598374 X:62973776-62973798 CTGTAAAATCAAAAGCAACTTGG + Intergenic
1192157913 X:68760107-68760129 CTTTAAAGTAAGATGCAGCAAGG + Intergenic
1192813208 X:74567421-74567443 TCTTAAAATCAGATGGAGCTGGG - Intergenic
1195404907 X:104502152-104502174 CTCTAAACTTTGAGGCAGCTGGG + Intergenic
1195954092 X:110310505-110310527 CTCCCAAATTAGATACAGCTGGG + Intronic
1197803116 X:130372784-130372806 ATTTTAAAGCAGATGCAGCTTGG + Intronic
1198003984 X:132472475-132472497 CTCTCAACTAAAATGCAGCTGGG + Intronic
1201321950 Y:12709091-12709113 CTCTAATATAAAATACAGCTGGG - Intronic
1201721354 Y:17101036-17101058 CTGTAAACTCAGATGCTTCTTGG - Intergenic