ID: 972308314

View in Genome Browser
Species Human (GRCh38)
Location 4:37853817-37853839
Sequence TCAGAAACATTCAGGAGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972308314_972308323 29 Left 972308314 4:37853817-37853839 CCCCAACTCCTGAATGTTTCTGA 0: 1
1: 0
2: 2
3: 24
4: 240
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308314_972308319 18 Left 972308314 4:37853817-37853839 CCCCAACTCCTGAATGTTTCTGA 0: 1
1: 0
2: 2
3: 24
4: 240
Right 972308319 4:37853858-37853880 TAAACCATCTCCTGCAGAAATGG 0: 1
1: 0
2: 1
3: 14
4: 189
972308314_972308321 26 Left 972308314 4:37853817-37853839 CCCCAACTCCTGAATGTTTCTGA 0: 1
1: 0
2: 2
3: 24
4: 240
Right 972308321 4:37853866-37853888 CTCCTGCAGAAATGGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972308314 Original CRISPR TCAGAAACATTCAGGAGTTG GGG (reversed) Intronic
900387707 1:2418066-2418088 TCAGGAACCTGCAGGAGCTGTGG + Intergenic
900570465 1:3355745-3355767 TCTGAACCGTTCAGGGGTTGCGG + Intronic
901805863 1:11738160-11738182 TCAGAGCCCTTCAGGAGGTGGGG + Intronic
903425597 1:23251870-23251892 TCAGCAACTTTAAGGAGTAGGGG - Intergenic
903775633 1:25791699-25791721 TTTGAAACCTTCAGGATTTGTGG + Intergenic
906771182 1:48486214-48486236 TCAGAGACATTGAGTAGTTGTGG + Intergenic
907345018 1:53769819-53769841 TCAGAAAGATTCAGAAGTTAGGG + Intronic
908752825 1:67441086-67441108 TCAGACACTCTCAGGAGCTGTGG - Intergenic
908768752 1:67576853-67576875 TCAGGAACTTTCAGGAATGGTGG - Intergenic
909623947 1:77694981-77695003 TCAGTAACATTCAGACCTTGAGG + Intergenic
910351280 1:86300753-86300775 TCAGAAAAATGCAGGAGTGAGGG - Intergenic
911882622 1:103261020-103261042 ACAGAAACCTTAAGGAATTGGGG + Intergenic
916438245 1:164796823-164796845 TGAGAAACATTCAGCATGTGAGG + Intronic
916494643 1:165334975-165334997 TAAAAAACATTCAGGACTTGCGG - Intronic
916947437 1:169742918-169742940 GCAGAAATCTTCAGGAGTGGGGG + Intronic
917390806 1:174534101-174534123 TCTGAACAATGCAGGAGTTGGGG - Intronic
917840949 1:178977051-178977073 TCAGAAACATTCAGAAAATATGG + Intergenic
918952905 1:191162849-191162871 TCACAAACATACAGGATTTAGGG + Intergenic
921028818 1:211318260-211318282 TCAGAATCATTGAGGGCTTGTGG + Intergenic
922913714 1:229238919-229238941 TCAGAGACTTTCAAGACTTGTGG - Intergenic
1063357391 10:5413178-5413200 TGAGAAACAGTCAGGAGGCGAGG - Intronic
1064758730 10:18597083-18597105 TCAGAAACAGCCAGGGTTTGAGG - Intronic
1067130013 10:43555348-43555370 TCAGCCACGTACAGGAGTTGGGG + Intergenic
1069286742 10:66724065-66724087 TCAGAAACATTCTTGACTAGAGG - Intronic
1070947580 10:80406461-80406483 ACAGAGCCATTCAGGGGTTGAGG - Intergenic
1071754098 10:88516281-88516303 ACAGAAACATTCATGAGTTCTGG + Intronic
1071995280 10:91142250-91142272 TAAGAAACATTTAGCAGTTGTGG - Intergenic
1072104975 10:92265210-92265232 TCAGAAAAATCCAAGACTTGTGG + Intronic
1072412745 10:95218859-95218881 TCAAAAACATTCAGAATCTGGGG + Intronic
1074693065 10:116024550-116024572 TCAGAAATCTCCAGGAGTTCAGG + Intergenic
1079890056 11:26041252-26041274 TCAGAAACATACAGAAGTACAGG - Intergenic
1079907639 11:26268998-26269020 TCAGAAACATTGAGTTATTGAGG + Intergenic
1080144029 11:28957878-28957900 TCATAAACTTTCAGGAAGTGAGG - Intergenic
1081743371 11:45456418-45456440 TCAGAAATACTCAGAAGCTGAGG + Intergenic
1083780247 11:64913915-64913937 TCCGAAGCACTGAGGAGTTGGGG + Exonic
1084840467 11:71842496-71842518 TGAGAGACATACAGGAGTAGAGG + Intergenic
1086294045 11:85345499-85345521 TCTGAGACATACAGAAGTTGAGG + Intronic
1086626243 11:88957328-88957350 TCATAAACATTCAGAAGAGGAGG + Intronic
1086802983 11:91200428-91200450 ACAGAAACATTTAGGGATTGTGG + Intergenic
1087011044 11:93514309-93514331 TCAGAAACATTAAGCAGATCTGG + Intronic
1088158907 11:106843932-106843954 TTAGAAACTTTCAGGAAATGAGG + Intronic
1089077804 11:115752469-115752491 CCAGAAACATGCCGCAGTTGTGG + Intergenic
1092299350 12:7230668-7230690 TCAAAAACATTCAGAATCTGGGG + Intergenic
1093209290 12:16288571-16288593 TCAGGGACCTGCAGGAGTTGGGG + Intergenic
1094635391 12:32222358-32222380 TTAGAAAGATTCAGCAGTTAAGG - Intronic
1094810027 12:34127309-34127331 TCAGAAAGACTGAGAAGTTGAGG + Intergenic
1095235211 12:39786669-39786691 TCAGAAACTTTTAGGAATTGGGG + Intronic
1095885796 12:47187176-47187198 CCAGAAGCACTCAGGAGTTTAGG + Intronic
1098167708 12:67715151-67715173 TTAGAAACATTTTGGAGGTGGGG + Intergenic
1100772673 12:97940531-97940553 GCAACAACATTCAGGAGTAGAGG + Intergenic
1101058327 12:100943536-100943558 TTATAAACATTCAAGAGCTGAGG - Intronic
1101260522 12:103024995-103025017 TAAGAAAAATATAGGAGTTGGGG + Intergenic
1101355330 12:103971968-103971990 TCAGAAACATTGCAGAGTTCTGG + Intronic
1102602612 12:114043579-114043601 TCAGAAATACTCAAGATTTGGGG - Intergenic
1102653131 12:114457460-114457482 TCAGAATCATCCTGCAGTTGTGG - Intergenic
1104274239 12:127310053-127310075 TCATTAACATTCAGGAGCAGAGG + Intergenic
1104878844 12:132055365-132055387 TCAGAAACATTCAGCTGTTTAGG + Intronic
1105840279 13:24248117-24248139 TCAGAGACCTGCAGGAGTGGAGG - Intronic
1107746036 13:43509979-43510001 TCAGAAAGTTTCATGAGTAGTGG + Intronic
1108497227 13:51036876-51036898 TTAGAAAAATTGTGGAGTTGGGG + Intergenic
1108705006 13:52977400-52977422 TGAAAAAAATTCAGGAGTAGTGG - Intergenic
1109304456 13:60623299-60623321 TCAGAAACCTCCAGGAGAGGAGG + Intergenic
1111576576 13:90162371-90162393 CTAGAAACTTTCAGGAGTGGCGG + Intergenic
1111587780 13:90305299-90305321 CCCGAAATCTTCAGGAGTTGAGG + Intergenic
1114459703 14:22878588-22878610 TCACAAACATTCAGGGTGTGTGG + Exonic
1114636124 14:24187879-24187901 ACAGAAACTTTCAGGAGGTGTGG + Intronic
1117873537 14:60225549-60225571 TCAGAGAAATTTAGGGGTTGTGG - Intergenic
1118291949 14:64534888-64534910 TTAGGAAAATTCACGAGTTGGGG + Intergenic
1118430290 14:65712288-65712310 TCAGTAACATTCATGATTTATGG + Intronic
1118729097 14:68654292-68654314 CCAGAAGCATTCTGGAGTTTGGG + Intronic
1119470891 14:74898365-74898387 ACAGTAACATCCAGGAGATGAGG + Exonic
1119973617 14:79000776-79000798 TCAGGAATTTTCATGAGTTGGGG - Intronic
1120356996 14:83446728-83446750 TCAGGACAATTCAAGAGTTGTGG - Intergenic
1122104186 14:99439277-99439299 TCAGCAGCAGTCTGGAGTTGGGG - Intronic
1124593691 15:31076625-31076647 TCAGCAAGATCAAGGAGTTGAGG - Intronic
1124887635 15:33701772-33701794 TCAGAAACAGTCATGACTTGAGG + Intronic
1127044604 15:55012361-55012383 TCAGAAAGATTCAGTAGAGGTGG - Intergenic
1127618439 15:60710069-60710091 TCAGAAACACTCAGGGCTGGAGG + Intronic
1128661501 15:69504440-69504462 TAAGAAACAGTCAGGAGATTTGG - Intergenic
1129938954 15:79477317-79477339 TCAGAAACTTGCAGGAGATTGGG + Intergenic
1131437214 15:92432750-92432772 TCAGAAATATTGAGGAATGGAGG + Intronic
1132727664 16:1345808-1345830 TCAGCCACATCCAGGAGTTGTGG + Exonic
1133910174 16:10058764-10058786 TCAGAAACATTCAGAATTTGGGG - Intronic
1136268759 16:29136144-29136166 ACAGACAAATACAGGAGTTGGGG - Intergenic
1136610365 16:31362206-31362228 TGAGAAACAGCCAGGGGTTGGGG + Intronic
1137517246 16:49157256-49157278 CTAGAAACATTCTGGAGTTATGG - Intergenic
1138154267 16:54687959-54687981 TAAAAAACATACAGGGGTTGGGG + Intergenic
1138276421 16:55738141-55738163 CCAGAAACACTCAGGAGTTCTGG - Intergenic
1139317301 16:66084323-66084345 TCAGAAAAATTCGGGGGTAGAGG + Intergenic
1140232439 16:73128754-73128776 TCAGAAACAACCAGGATTTGGGG - Intronic
1140786528 16:78347510-78347532 TCAGGAACATGCAAGAGGTGTGG - Intronic
1141766457 16:86062835-86062857 ACAGAAACACACAGGAGCTGGGG + Intergenic
1142072064 16:88096510-88096532 ACAGACAAATACAGGAGTTGGGG - Intronic
1143385274 17:6525583-6525605 ACAGACACCTTCAAGAGTTGAGG - Intronic
1144862027 17:18310879-18310901 TCAGAAACAGTGAGAAGTTAGGG - Intronic
1146654694 17:34628425-34628447 TCTGAAACATCCAGGACTCGGGG + Intronic
1146816548 17:35947205-35947227 TCAGATAGATTCAGAAGTGGGGG + Intergenic
1147348387 17:39820905-39820927 TCAGAGAGCTTCAGGAGCTGGGG + Intronic
1147977775 17:44257904-44257926 TCAGACAGAGTCAGAAGTTGGGG + Intronic
1149391809 17:56198974-56198996 TTAGAATCATTTAGGAGTTCTGG + Intronic
1151008849 17:70470167-70470189 ATAGAAACATTAAGGAGGTGAGG - Intergenic
1152125303 17:78443173-78443195 TCAGAAGCTCTCAGGAGATGGGG + Intronic
1153382890 18:4457748-4457770 TTGGAAACAGTCAGGATTTGAGG + Intergenic
1153918537 18:9767413-9767435 TCAGAAATCTTCAGGTGGTGAGG - Intronic
1155188972 18:23412727-23412749 TCAGAAACAGGCAGCAGGTGGGG - Intronic
1156260595 18:35442231-35442253 CCAGAAACACTCCTGAGTTGTGG + Intergenic
1156821359 18:41376869-41376891 TCAGAAATTTTCAGTAGTTTAGG + Intergenic
1159147448 18:64472277-64472299 TCAGTAAAATTCATGATTTGTGG - Intergenic
1160289060 18:77573427-77573449 TCAGAGATAAACAGGAGTTGTGG + Intergenic
1163045141 19:14635830-14635852 TCATACACATTCAGGAGGTTTGG - Intronic
1163857412 19:19715380-19715402 TCAGAGAGATTGAGGGGTTGAGG + Intronic
1165813837 19:38628894-38628916 GAGGAAACATCCAGGAGTTGGGG - Intronic
1167511322 19:49896755-49896777 TGAGAAGCAGTCAGGAGCTGGGG - Intronic
925702944 2:6657219-6657241 TCAGAATCAATCAGGAGATGTGG + Intergenic
926544899 2:14227263-14227285 TCAGTAACATTCCCCAGTTGAGG - Intergenic
928917163 2:36484515-36484537 TAAGAAAAATTCAAGAGATGTGG + Intronic
930854785 2:56002893-56002915 TCAGAAACATTTTGGATTTATGG + Intergenic
932207698 2:69898082-69898104 TGAGAATGATTCAGGAGCTGGGG + Intronic
932249135 2:70224636-70224658 TCAGAAACAATCAGAAGTTTAGG + Intronic
932268761 2:70390638-70390660 TCAGACACTTTTAGGAGCTGGGG + Intergenic
932590854 2:73066170-73066192 TCAGCAACATTGAGAAGGTGGGG + Intronic
934048095 2:88188272-88188294 TCAGAACCATTCAGGGGATGGGG - Intergenic
934125009 2:88879851-88879873 ACAAAATTATTCAGGAGTTGTGG - Intergenic
936065535 2:109329282-109329304 TGAGAAACATCCTGGAGATGTGG + Intronic
939040461 2:137183201-137183223 ACAGAAACATTGAAGAGTTGAGG + Intronic
942069907 2:172306837-172306859 GGAGAAACATTCAGGAGTCCAGG - Intergenic
944160872 2:196658020-196658042 TCAGAAATAATTAGTAGTTGGGG + Intronic
946994937 2:225380641-225380663 TCAGAAGCTTTCAGAAGTTCAGG + Intergenic
947306168 2:228749889-228749911 ACAGAAAAATTCGGGAGCTGAGG + Intergenic
947532806 2:230923568-230923590 CCAGCAACATTCAGGCATTGGGG - Intronic
948016934 2:234698854-234698876 TCATATACATTTAGGAGTGGGGG - Intergenic
948462118 2:238134806-238134828 TCAGAAACATCCAGGAGAAAGGG + Intergenic
1174438512 20:50529676-50529698 TCACAAAGATCCAGGAGATGGGG - Intronic
1177040123 21:16097886-16097908 TTAGAAATATTAAGGATTTGAGG - Intergenic
1177809354 21:25908894-25908916 TCTGTATCATTCAGGAGTTCAGG + Intronic
1179637616 21:42723434-42723456 TGAGAAGCAGCCAGGAGTTGAGG + Intronic
1180223975 21:46378198-46378220 TCAGAACCATTCACGATTTCAGG - Intronic
1181865092 22:25848480-25848502 TCAGAATGAGTGAGGAGTTGTGG + Intronic
1181868255 22:25876412-25876434 TCAAGAACATTCAGGAATAGGGG - Intronic
1181921535 22:26324559-26324581 GGAGAGAGATTCAGGAGTTGAGG + Intronic
949358497 3:3206817-3206839 TCAAGAACATGCAGCAGTTGGGG + Intergenic
949635069 3:5973763-5973785 TCAGAAACCTGCAGGAAGTGAGG - Intergenic
952742831 3:36750785-36750807 TCAAAAACATTCACGATCTGCGG - Intergenic
953977602 3:47394135-47394157 TCAGAAAAATTCAGAAAATGGGG - Intronic
953993060 3:47498702-47498724 TTAGTAACATTCAGGAATTCAGG - Intronic
954818755 3:53306426-53306448 TCAGAAACATTAAAAAGTTGGGG + Intronic
955774135 3:62415484-62415506 TCAGGTGCATTAAGGAGTTGGGG - Intronic
957464910 3:80575516-80575538 TCAGAAACCTTCAGGTGTGTTGG - Intergenic
959025530 3:101236235-101236257 CCAGAAATACTGAGGAGTTGAGG + Intronic
959346786 3:105205018-105205040 CCAGAATCATTCAAGAGTTCTGG - Intergenic
960693045 3:120367398-120367420 TCAGAGACTTTCAGGGATTGGGG + Intergenic
960923682 3:122774821-122774843 TCAGAATGATTCAGAAGTTCTGG + Intronic
961085251 3:124061718-124061740 ACAGTAACAGTCAGGAGCTGAGG + Intergenic
961916464 3:130380142-130380164 AAAGGAACTTTCAGGAGTTGTGG + Intronic
962048354 3:131785382-131785404 GCAGAAACATGAAGGAGGTGAGG - Intronic
963390386 3:144655522-144655544 ACAGAAACACTCAGGAAGTGTGG + Intergenic
967068311 3:185939844-185939866 TTAAAAAAAATCAGGAGTTGGGG - Intergenic
967334187 3:188324284-188324306 GAAGAAACATTCAAGAGATGTGG - Intronic
967446361 3:189571315-189571337 TAAGAAAAATCCAGGAGTTGAGG + Intergenic
969781546 4:9408490-9408512 TGAGCAACATACAGGAGTAGAGG + Intergenic
970743772 4:19269734-19269756 TCCAAAACATTCAGGATCTGAGG + Intergenic
971403546 4:26299107-26299129 TCAAAAAAATAAAGGAGTTGGGG + Intronic
972308314 4:37853817-37853839 TCAGAAACATTCAGGAGTTGGGG - Intronic
974235437 4:59174912-59174934 TCAGACAAATTCAGAAGGTGGGG - Intergenic
976010700 4:80485316-80485338 TCAGAAAAATTCAGAATGTGAGG + Intronic
976033029 4:80780906-80780928 GCATAAACATTCATGAGTTTTGG - Intronic
976324456 4:83755072-83755094 TAAGAAAGATCCAGGGGTTGGGG - Intergenic
976540523 4:86269291-86269313 CCAAAAACATTAAGGAGTTTAGG - Intronic
976656037 4:87489627-87489649 GCAGAAGCATTCAAGAGCTGGGG - Intronic
979000481 4:115211130-115211152 TCAGAAAAATTCAGAAGCTTGGG + Intergenic
980446763 4:132920327-132920349 TCACAGGCATTCAGGAGATGAGG + Intergenic
981014061 4:139955126-139955148 TGAGTAACATTGAGGGGTTGGGG - Intronic
983229907 4:165118925-165118947 TCAGAAATAATCAGAAGATGGGG + Intronic
984109183 4:175589367-175589389 TCAAGAACACTCAGGAATTGTGG - Intergenic
984490585 4:180430322-180430344 TCACTAAAATTCAGGTGTTGAGG - Intergenic
986231446 5:5867882-5867904 TCAGAAATGTTCAGGAGGTGAGG - Intergenic
986351949 5:6888621-6888643 ACAGAAGCTTTCAGGAGCTGAGG - Intergenic
986792146 5:11172518-11172540 TCACAAACATTCAGCAATTTTGG + Intronic
987897912 5:23972284-23972306 TCAAAAACATTGAGGTCTTGTGG - Intronic
988264583 5:28930831-28930853 TCAGATACATTCTGGACTTTTGG - Intergenic
991351970 5:65728725-65728747 AAACAAAAATTCAGGAGTTGTGG + Intronic
992192993 5:74312450-74312472 TCTGAATCAATCAGGACTTGGGG + Intergenic
992898100 5:81264581-81264603 TCAGTAAATTTCAGAAGTTGTGG - Intronic
993141980 5:84045367-84045389 TCAGAAACTGTCAGAAGTAGAGG + Intronic
995452780 5:112320923-112320945 TCAGACACATTCATGGGTTGGGG - Intronic
996560149 5:124819858-124819880 TGAGAAACATTCAAGAAATGTGG - Intergenic
998822948 5:146073268-146073290 TCTGAAACCTTCAGCAGATGAGG - Intronic
999266040 5:150267380-150267402 ACAGCAACATTCTGGATTTGGGG - Intronic
999424018 5:151470741-151470763 TCAGAAACATTGAACAGTAGGGG - Intronic
999841733 5:155435184-155435206 CCACAAACATTCTGGAGTTTGGG - Intergenic
999909866 5:156185936-156185958 TCAGAACTCTTCAGGACTTGGGG + Intronic
1000118186 5:158172978-158173000 TCAGACACATACAAGTGTTGTGG + Intergenic
1000724170 5:164747830-164747852 TAAGAAAAATTCAGGAGATAAGG + Intergenic
1002820271 6:718283-718305 TCAGAAACATTGAGAGCTTGGGG + Intergenic
1002949327 6:1793546-1793568 TCAGAAACATCCAGGTGTCCTGG - Intronic
1002984422 6:2174945-2174967 GCAGAAGCCTTCAGGACTTGGGG + Intronic
1003004632 6:2369431-2369453 TCACACACATGCAGGACTTGAGG - Intergenic
1003065403 6:2900654-2900676 TCAGTAACATTCAGGGAGTGTGG - Intronic
1003238592 6:4321214-4321236 GCAAAAACTTTCAGGAATTGAGG + Intergenic
1003528045 6:6914300-6914322 TCAGAAAGTTGCAGGGGTTGGGG - Intergenic
1003974702 6:11331340-11331362 TCAGAAAAACTCATGATTTGTGG - Intronic
1005440081 6:25857963-25857985 TGGGAAACATTCAAGAGTTGAGG - Intronic
1006612786 6:35304682-35304704 TCAGAAACATTCAGTGAATGGGG + Intronic
1006818402 6:36870113-36870135 TCAGAAGCATTCAGGTTTTTGGG - Intronic
1010433863 6:75808600-75808622 TCTGCCATATTCAGGAGTTGAGG - Intronic
1010830617 6:80523819-80523841 ACAGGAACATTCAGAAGTTAGGG + Intergenic
1011246032 6:85322218-85322240 TCCTAAACACTCAGGAGTTTTGG + Intergenic
1011930707 6:92708459-92708481 ACAGAAACATACAGTAGCTGAGG + Intergenic
1012863909 6:104595259-104595281 ACACAAAAATTCAGGAGTTCTGG + Intergenic
1015676594 6:135756799-135756821 ACAGCAACAAACAGGAGTTGTGG + Intergenic
1015936991 6:138414318-138414340 TCAAAAGCATTTAGGAGTCGAGG + Exonic
1017692560 6:156981348-156981370 TCAGAAACAAAAAGGAGTTAAGG + Intronic
1018302179 6:162415082-162415104 TCAGAAACATTCAGAAGTGAAGG - Intronic
1019919257 7:4152497-4152519 TCAGAAGCCTTCAGGAATAGTGG - Intronic
1021623623 7:22571860-22571882 ACAGAAGAATTCAGGAGATGTGG + Intronic
1023592135 7:41791766-41791788 TCAGGAACACTCAAGAATTGAGG - Intergenic
1027830590 7:83172092-83172114 TCTGACACATACAGGAGTGGAGG - Intergenic
1032837069 7:135684278-135684300 ACAGAAACATTCACGAGATTAGG + Intronic
1034388641 7:150764070-150764092 TCAGATTCATTCATGTGTTGTGG - Intergenic
1034463984 7:151214873-151214895 TCAGACTCATTCAGCAGGTGAGG - Exonic
1035139495 7:156743890-156743912 GCAGCAAGATCCAGGAGTTGGGG - Intronic
1036837878 8:12090240-12090262 TGAGCAACATACAGGAGTAGAGG - Intergenic
1036859668 8:12336488-12336510 TGAGCAACATACAGGAGTAGAGG - Intergenic
1038067469 8:23977949-23977971 TAAGAAAGATACAGTAGTTGAGG - Intergenic
1038091991 8:24264688-24264710 ACAGAGACATTCAGGACTTGAGG + Intergenic
1038894758 8:31769961-31769983 TCAGACATATTCAGGAGTACCGG + Intronic
1042601107 8:70500704-70500726 TCAAACACATACAGGAGTAGAGG + Intergenic
1043514561 8:80984184-80984206 TCAGACACATGCAGAAGGTGTGG + Intronic
1045042162 8:98236328-98236350 TCAGAGACATTCAGCAGTTGTGG + Intronic
1047014967 8:120714300-120714322 TCAGAAACAGTCAAAACTTGTGG + Intronic
1047388971 8:124434595-124434617 TCACAAAAATTTATGAGTTGGGG + Intergenic
1048770040 8:137885525-137885547 TCAGAGAGATTTAGGAGATGTGG - Intergenic
1051616323 9:19010327-19010349 TCAGAAGCATGCAGGAAATGTGG - Intronic
1051944412 9:22549768-22549790 TCAGATACATTTTGCAGTTGTGG + Intergenic
1053220023 9:36304812-36304834 TCAGAAAGACTGAGGGGTTGAGG - Intergenic
1054931759 9:70642448-70642470 CCAGAAACAATGAGGAGGTGGGG + Intronic
1056758816 9:89400231-89400253 TCAGAAACTTCCAGGGGGTGGGG + Intronic
1058313111 9:103531054-103531076 TCAGAAAGAGGCAGAAGTTGTGG + Intergenic
1059453587 9:114386325-114386347 TGAGAAACAATGAGGATTTGGGG + Intronic
1060853605 9:126897612-126897634 TCACAGACATTCAGGGGTTTGGG - Intergenic
1186806399 X:13144405-13144427 TCAGAAACTCTCAGGCGGTGGGG + Intergenic
1187581257 X:20609996-20610018 TCAGAGAAATTGTGGAGTTGGGG - Intergenic
1188960865 X:36489809-36489831 TAAGAAACTTTCAAGAGTTCGGG - Intergenic
1189302124 X:39959748-39959770 TCAGACACATTCAGAAGTCCAGG + Intergenic
1190042221 X:47080645-47080667 TCAGAAAAATGCAGGTGTGGCGG + Exonic
1190172374 X:48121838-48121860 TCAGAAACATTAAGGAGGACAGG + Intergenic
1190180137 X:48184941-48184963 TCAGAAACATTAAGGAGGACAGG - Intergenic
1190183980 X:48219130-48219152 TCAGAAACATTAAGGAGGACAGG + Intronic
1190189912 X:48268583-48268605 TCAGAAACATTAAGGAGGACAGG + Intronic
1190193149 X:48294160-48294182 TCAGAAACATTAAGGAGGACAGG - Intergenic
1190197136 X:48329273-48329295 TCAGAAACATTAAGGAGGAAAGG + Intergenic
1190204834 X:48394518-48394540 TCAGAAACATTAAGGAGGACAGG + Intergenic
1190205702 X:48400885-48400907 TCAGAAACATTAAGGAGGACAGG - Intergenic
1190453079 X:50600110-50600132 TCAGAAAATCTCTGGAGTTGGGG - Intronic
1190659656 X:52642772-52642794 TCAGAAACATTAAGGAGGACAGG - Intergenic
1191590953 X:62884465-62884487 TCATAAGCTATCAGGAGTTGTGG + Intergenic
1191915295 X:66194545-66194567 TCAGAAGAGTCCAGGAGTTGTGG + Intronic
1193956062 X:87864328-87864350 TCAGAAACACTGAAGAGTTTAGG + Intergenic
1194803278 X:98297565-98297587 ACAGTAAAATTGAGGAGTTGAGG - Intergenic
1194929643 X:99870283-99870305 TCAGAATGATTCATGTGTTGAGG - Intergenic
1195376808 X:104235612-104235634 TCTGCAACATTCAGCAGCTGTGG - Intergenic
1197388823 X:125835351-125835373 GCAGAAATATGCAGGACTTGAGG + Intergenic
1197528952 X:127599115-127599137 TCAGAAATGTTCTAGAGTTGAGG - Intergenic
1197795142 X:130290266-130290288 ACAGAAACATTTTGCAGTTGGGG + Intergenic
1198056454 X:133000426-133000448 TCAGAAACATTCAGTTCTTGGGG + Intergenic
1198822384 X:140662395-140662417 TCAGAAGCAATCATAAGTTGGGG + Intergenic
1201018036 Y:9624669-9624691 TCAGCAAGATTCAGGGGCTGGGG + Intergenic