ID: 972308315

View in Genome Browser
Species Human (GRCh38)
Location 4:37853818-37853840
Sequence ATCAGAAACATTCAGGAGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972308315_972308319 17 Left 972308315 4:37853818-37853840 CCCAACTCCTGAATGTTTCTGAT 0: 1
1: 0
2: 2
3: 11
4: 255
Right 972308319 4:37853858-37853880 TAAACCATCTCCTGCAGAAATGG 0: 1
1: 0
2: 1
3: 14
4: 189
972308315_972308321 25 Left 972308315 4:37853818-37853840 CCCAACTCCTGAATGTTTCTGAT 0: 1
1: 0
2: 2
3: 11
4: 255
Right 972308321 4:37853866-37853888 CTCCTGCAGAAATGGAGAAGAGG No data
972308315_972308323 28 Left 972308315 4:37853818-37853840 CCCAACTCCTGAATGTTTCTGAT 0: 1
1: 0
2: 2
3: 11
4: 255
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972308315 Original CRISPR ATCAGAAACATTCAGGAGTT GGG (reversed) Intronic
900760153 1:4464927-4464949 ATCAGCAACATTCACTATTTTGG + Intergenic
904190492 1:28739286-28739308 ATCAGAACTATTTCGGAGTTAGG + Intronic
904358326 1:29955955-29955977 TTCAGAAACACTGAGGAGTCAGG - Intergenic
906036384 1:42752600-42752622 CTGGGAACCATTCAGGAGTTTGG + Exonic
906551043 1:46666753-46666775 GTGTGAAACATTAAGGAGTTTGG + Intronic
907345017 1:53769818-53769840 ATCAGAAAGATTCAGAAGTTAGG + Intronic
907596155 1:55721779-55721801 ATCTGAAACATAGAGAAGTTAGG + Intergenic
908188697 1:61677773-61677795 ATGAGAAACATTAAGGAGAATGG - Intergenic
908635384 1:66158244-66158266 AACAGAAACAATCAAGAGTGAGG + Intronic
909215090 1:72876889-72876911 ATCACAAAGATTCAGAAATTTGG + Intergenic
910024374 1:82631224-82631246 ATCAGAAACATCCAGTAGGCTGG - Intergenic
910351281 1:86300754-86300776 TTCAGAAAAATGCAGGAGTGAGG - Intergenic
911335920 1:96579975-96579997 ATGAGAAAGATTCAGTATTTTGG - Intergenic
911470762 1:98315561-98315583 AACACAAACATTCAGTAGTGAGG - Intergenic
912258041 1:108081134-108081156 ACCAGCAACATTTAGGAGTCTGG - Intergenic
912700661 1:111876029-111876051 ATCAGAAACACACAGGTCTTAGG + Intronic
913591624 1:120334198-120334220 AACAGAAGCATGCAGGTGTTAGG + Intergenic
916369394 1:164073518-164073540 AGCAGTGCCATTCAGGAGTTAGG + Intergenic
916947436 1:169742917-169742939 AGCAGAAATCTTCAGGAGTGGGG + Intronic
917178417 1:172264866-172264888 ATCAGAAACAGCCTTGAGTTAGG - Intronic
917625462 1:176841586-176841608 ATCAGAAAAAATCAGGTATTTGG - Intronic
918879499 1:190098310-190098332 ATCAATAACATTCAAGTGTTTGG - Exonic
918952904 1:191162848-191162870 TTCACAAACATACAGGATTTAGG + Intergenic
919503990 1:198374733-198374755 ATCAGACACATTTCAGAGTTTGG + Intergenic
919566582 1:199196310-199196332 GGCAGAAACATGCAGGAGATAGG + Intergenic
921200586 1:212801641-212801663 CTCAGAGACATACAGTAGTTTGG + Intronic
1063916626 10:10889538-10889560 ATCAGAAACATGCAAGATTCAGG + Intergenic
1065680304 10:28223707-28223729 ATCAGAAATACTCAGAAGATTGG - Intronic
1065770170 10:29070703-29070725 ATCAGAAAGAATGAGGAGATGGG - Intergenic
1066263933 10:33756735-33756757 ATCAGAATCAGTCAGGAGCCAGG - Intergenic
1071330316 10:84552367-84552389 CTCAGAGACATTAAGAAGTTTGG + Intergenic
1074234128 10:111567765-111567787 ATCAGAAACTCTCCTGAGTTTGG - Intergenic
1075986696 10:126793732-126793754 ATCAGAAAAATTCTGGACATGGG + Intergenic
1076054392 10:127359598-127359620 TTCAGAAACATTAAGCATTTGGG + Intronic
1077755915 11:5026837-5026859 ATCATCAACATTCAGGAGAAAGG + Intergenic
1078294950 11:10058214-10058236 ATCAGTAAGATTCAGGAGGATGG + Intronic
1079141236 11:17811147-17811169 ATCTGAAACATTTAGGAATTGGG - Intronic
1080145858 11:28983111-28983133 CTCAGATACCTTAAGGAGTTGGG + Intergenic
1080275525 11:30499298-30499320 ACCAGAATCATTTAGGATTTTGG + Intronic
1082146478 11:48676565-48676587 ATGTTAAACATTCAGCAGTTTGG + Intergenic
1082721010 11:56676279-56676301 ATCCAAAACATTCAGGACATAGG + Intergenic
1083381435 11:62272344-62272366 AACAGTAATATTCTGGAGTTAGG + Intronic
1083439623 11:62667179-62667201 AACAGAAACATTCAGCAATATGG - Exonic
1084925977 11:72511527-72511549 ATCAGAAACAATGGAGAGTTTGG - Intergenic
1086148840 11:83586154-83586176 CTCAGCATCATTCAGGAGTGGGG + Intronic
1086401192 11:86462281-86462303 ATCAAAAAAATTAAGAAGTTAGG + Intronic
1088271576 11:108040121-108040143 ATTAGAAAAATCTAGGAGTTGGG - Intronic
1090178948 11:124676574-124676596 ACCAGCAACATTCAGGAAATTGG - Intronic
1091059007 11:132444406-132444428 ATCAGAAACATGCATGAATTTGG + Intronic
1093293451 12:17358287-17358309 ATCAAAATCATTCAGGGGATGGG + Intergenic
1093564345 12:20584416-20584438 AATAGAAACATTCTGGAGGTAGG - Intronic
1093677731 12:21963276-21963298 ATAAGAGGCATTCTGGAGTTTGG - Intergenic
1095133468 12:38570327-38570349 ATAAGAAAGATTCAAAAGTTTGG - Intergenic
1095235210 12:39786668-39786690 GTCAGAAACTTTTAGGAATTGGG + Intronic
1095250807 12:39977302-39977324 ATTAGAAACTTTGAGGGGTTTGG - Intronic
1095794472 12:46202800-46202822 ATCAGAAACTTGCAGTATTTTGG - Intronic
1096577834 12:52565316-52565338 ACCAGAAACATTCCTGACTTTGG - Intergenic
1097283345 12:57859497-57859519 AACAGAAAGATTCTGGACTTAGG - Intergenic
1097643756 12:62211662-62211684 TTCATAATCATTCAGGGGTTGGG + Intronic
1098107884 12:67089919-67089941 ATCAGAAAAATTCAGAATGTGGG + Intergenic
1104200050 12:126579763-126579785 TAAAGAAAGATTCAGGAGTTTGG - Intergenic
1106349837 13:28920136-28920158 ATCAGTAACATTGATGAGTTAGG + Intronic
1108497226 13:51036875-51036897 ATTAGAAAAATTGTGGAGTTGGG + Intergenic
1108694940 13:52894874-52894896 ATCAGACACTTACAGGAGTGGGG - Intergenic
1109063089 13:57645403-57645425 ATCAGATACATGCTGGAATTTGG + Intronic
1109242642 13:59908922-59908944 ATAAGAAAAAGTCAAGAGTTTGG - Intronic
1111716426 13:91885371-91885393 ATTTGTAAAATTCAGGAGTTTGG + Intronic
1111770794 13:92593103-92593125 ATCAGAGAGATTCAGCACTTTGG + Intronic
1114952134 14:27768372-27768394 GTCAGAAATATTCAGGAACTAGG + Intergenic
1116510680 14:45742589-45742611 ATGAGAAGCATTCATGAATTGGG - Intergenic
1116663542 14:47744887-47744909 ATCAGAAAGGTTCAGCATTTTGG + Intergenic
1116864269 14:50018638-50018660 ATCAAATACCTTCAGGAGTCAGG - Intergenic
1118729095 14:68654291-68654313 CCCAGAAGCATTCTGGAGTTTGG + Intronic
1119857584 14:77912489-77912511 ATCTGAAACTTTCAGGATTGTGG - Intronic
1122118334 14:99538554-99538576 CACAGAACCATTCAGGAGGTGGG + Intronic
1123737326 15:23198390-23198412 ATTTGTAAAATTCAGGAGTTTGG + Intergenic
1124288543 15:28427054-28427076 ATTTGTAAAATTCAGGAGTTTGG + Intergenic
1124294683 15:28490260-28490282 ATTTGTAAAATTCAGGAGTTTGG - Intergenic
1127167007 15:56254188-56254210 ATGAGAAATTTTCAGGAGATGGG + Intronic
1128271969 15:66318300-66318322 TTCAAAAACATTCTTGAGTTGGG + Intronic
1129938953 15:79477316-79477338 ATCAGAAACTTGCAGGAGATTGG + Intergenic
1130783368 15:87069137-87069159 ATCAGAGGCCTTGAGGAGTTTGG + Intergenic
1131704788 15:94981739-94981761 GTTAGAAACAATCAGGGGTTAGG + Intergenic
1133910175 16:10058765-10058787 GTCAGAAACATTCAGAATTTGGG - Intronic
1135272299 16:21079877-21079899 GGCAGAAAGATTCAGGAGCTGGG + Intronic
1138182703 16:54953106-54953128 ATTAAAAAGATTCTGGAGTTTGG + Intergenic
1138693801 16:58792635-58792657 ATCAGAAAAGCTCTGGAGTTTGG + Intergenic
1138760417 16:59537112-59537134 CTCAGAAAGTTTCAGGAGTGTGG - Intergenic
1138859643 16:60741279-60741301 ATAAGAAACTTTCAGACGTTTGG + Intergenic
1139314738 16:66058641-66058663 ATCAAGGACATTCAGAAGTTTGG + Intergenic
1139393407 16:66620912-66620934 ATCAGAAACCTTAAGTAGCTAGG + Intronic
1140232440 16:73128755-73128777 TTCAGAAACAACCAGGATTTGGG - Intronic
1141019389 16:80480596-80480618 CTCTAAAACATTGAGGAGTTTGG - Intergenic
1141766456 16:86062834-86062856 AACAGAAACACACAGGAGCTGGG + Intergenic
1144862028 17:18310880-18310902 TTCAGAAACAGTGAGAAGTTAGG - Intronic
1145067662 17:19772993-19773015 AACAAAAACATTAAGGATTTTGG + Intronic
1146654693 17:34628424-34628446 ATCTGAAACATCCAGGACTCGGG + Intronic
1146816547 17:35947204-35947226 ATCAGATAGATTCAGAAGTGGGG + Intergenic
1147494669 17:40904451-40904473 GAGAGAAACATTCAGGAGTGGGG + Intergenic
1151981647 17:77514488-77514510 AACAGAAACACTCAGTGGTTTGG - Intergenic
1154263066 18:12854831-12854853 ATCAGAAAAATTACGGGGTTAGG + Intronic
1155413097 18:25567534-25567556 ATCAAAAGAATTCAGAAGTTTGG + Intergenic
1155888923 18:31242387-31242409 ATTAGAAAGATTCAGGCCTTGGG + Intergenic
1156168871 18:34457686-34457708 TTAGGAAACATTCAGGAGGTGGG + Intergenic
1157098794 18:44711270-44711292 AGCAGAAACAATCAGGAGGGAGG - Intronic
1157915084 18:51656470-51656492 ATCGGCAGCTTTCAGGAGTTGGG - Intergenic
1159167285 18:64720408-64720430 TTCATAAAGATTTAGGAGTTAGG - Intergenic
1159603843 18:70454372-70454394 ATTTTAAACATTCAGGAGTAAGG + Intergenic
1163647552 19:18498494-18498516 ATCATAGAAATCCAGGAGTTTGG - Intronic
1164473973 19:28559115-28559137 ATCAGTGATATCCAGGAGTTAGG - Intergenic
1166276970 19:41760890-41760912 ACCTGAAACATTCAGGTGCTGGG - Intronic
925285298 2:2711863-2711885 ATCAGAAGGAATCAGGAATTTGG + Intergenic
927445741 2:23159998-23160020 ATTACATACATTCAGGAGCTGGG - Intergenic
927654059 2:24930370-24930392 ATTAGACACATTCAGGTTTTGGG + Intergenic
929536933 2:42789752-42789774 AGCAGAAAGACTGAGGAGTTTGG - Intronic
930053535 2:47235236-47235258 ATCAGGACCATTTAGCAGTTTGG + Intergenic
932373661 2:71214883-71214905 ATCAGAGACACTCAGTATTTAGG + Intronic
932590853 2:73066169-73066191 ATCAGCAACATTGAGAAGGTGGG + Intronic
934048096 2:88188273-88188295 CTCAGAACCATTCAGGGGATGGG - Intergenic
934485181 2:94700937-94700959 GTCAGAAATATTCAGGAACTAGG - Intergenic
938997287 2:136693738-136693760 ACCAGATATATTCTGGAGTTGGG + Intergenic
938997485 2:136695982-136696004 ATTTGAAACATTGAAGAGTTGGG + Intergenic
939239917 2:139544256-139544278 GTCAGAGACTGTCAGGAGTTTGG - Intergenic
942905042 2:181170029-181170051 ATAATAAACATTTAGTAGTTTGG - Intergenic
943931737 2:193863220-193863242 ATCAGAAGGATTGAGGAGTAAGG - Intergenic
944160871 2:196658019-196658041 ATCAGAAATAATTAGTAGTTGGG + Intronic
948016935 2:234698855-234698877 ATCATATACATTTAGGAGTGGGG - Intergenic
948462117 2:238134805-238134827 GTCAGAAACATCCAGGAGAAAGG + Intergenic
1172984652 20:38974740-38974762 AGCATCAACATTCAGGAGTCAGG + Intronic
1173534364 20:43798105-43798127 ATCTGAAACTTTCTGTAGTTAGG + Intergenic
1177106334 21:16960239-16960261 AACAGAAAATTTCAGGAATTTGG + Intergenic
1177235787 21:18388388-18388410 ATCAGAAAAATTTGGGATTTTGG + Intronic
1177336823 21:19739295-19739317 ATCAGAAACTAACAGGAATTAGG + Intergenic
1178188701 21:30255702-30255724 ATCAGTCACCTTAAGGAGTTAGG - Intergenic
1181868256 22:25876413-25876435 ATCAAGAACATTCAGGAATAGGG - Intronic
1181970895 22:26689037-26689059 AACAGATATATTCAGGAGTCAGG + Intergenic
1184956591 22:47891025-47891047 ATCAGAAAAATGCAGGATTCAGG + Intergenic
950236719 3:11328083-11328105 ATCAGAATTATTCAGGAGCCTGG + Intronic
951066712 3:18275502-18275524 ATCAGAAAAATTCAGAACTATGG - Intronic
951473986 3:23085449-23085471 ATCAGAAATTTTCAGGGTTTTGG - Intergenic
951519926 3:23601939-23601961 ATCAGAAACATTCAGAAGTGTGG - Intergenic
952069149 3:29612029-29612051 AACAAAAAAATTGAGGAGTTGGG - Intronic
952557553 3:34550388-34550410 ATCAGATAAATTCAGAAGTTAGG - Intergenic
954744988 3:52782727-52782749 AAAAGAAATAATCAGGAGTTCGG - Intronic
954818754 3:53306425-53306447 TTCAGAAACATTAAAAAGTTGGG + Intronic
955548677 3:60059213-60059235 ATCAGCAGTTTTCAGGAGTTGGG + Intronic
956974376 3:74563347-74563369 ATAATAAACATTCTGGAATTTGG - Intergenic
957002872 3:74907085-74907107 AGCAGAAATATTCAGGATCTTGG + Intergenic
957532969 3:81464084-81464106 TTCAGCAACATTCAGGGGGTAGG + Intergenic
957962389 3:87273452-87273474 TGCACAAACATTTAGGAGTTTGG + Exonic
958706827 3:97666175-97666197 AACAGCAACATTCAGGAGGCTGG - Intronic
959746824 3:109785207-109785229 ATCAGAAACATTTAGCATTTTGG - Intergenic
960438941 3:117663019-117663041 TTCACAACAATTCAGGAGTTGGG - Intergenic
960693044 3:120367397-120367419 ATCAGAGACTTTCAGGGATTGGG + Intergenic
962131886 3:132688333-132688355 ACCAGAAATGTTCAGGATTTTGG - Intronic
968024320 3:195426417-195426439 ATCAGAAAAATTCAGGAAGGGGG + Intronic
971961282 4:33490434-33490456 ATGAAAAACATACAGGAGTCAGG + Intergenic
972308315 4:37853818-37853840 ATCAGAAACATTCAGGAGTTGGG - Intronic
974235438 4:59174913-59174935 ATCAGACAAATTCAGAAGGTGGG - Intergenic
974675495 4:65083093-65083115 ATCTTAAAGATTCAGGAGTCAGG + Intergenic
974971673 4:68837177-68837199 ATCACTGACATTCAGGTGTTTGG - Intergenic
975380374 4:73693342-73693364 ATCAGATAGATGAAGGAGTTGGG + Intergenic
976519998 4:86015837-86015859 ATCAGCCACATTAAGGAGTCAGG + Intronic
977853657 4:101860751-101860773 GTCAGAAGCAGTCATGAGTTGGG + Intronic
978299350 4:107249008-107249030 ATCAAAAAGATTCTGGATTTAGG - Intronic
978402846 4:108349322-108349344 ACCAGAAAAAGTGAGGAGTTCGG + Intergenic
979000480 4:115211129-115211151 TTCAGAAAAATTCAGAAGCTTGG + Intergenic
979854657 4:125616828-125616850 ATCAGAAATGTTAATGAGTTTGG - Intergenic
981707418 4:147675388-147675410 ATAAGAGACATTCATGATTTAGG + Intronic
981918224 4:150058033-150058055 GTCAGAAACATTAGGGAGTGTGG + Intergenic
984093071 4:175399375-175399397 ATCAGAAAAATACAGTACTTAGG + Intergenic
986622939 5:9694701-9694723 AACATAAACATTGAGGAGTTTGG + Intronic
987327037 5:16822116-16822138 ATCAGATACATTTAGAAATTTGG + Intronic
988757210 5:34269168-34269190 CTTTGAACCATTCAGGAGTTAGG - Intergenic
989235544 5:39144189-39144211 AGCTGAAACATTAAGGAGTCTGG + Intronic
990875776 5:60483553-60483575 TTCAGCAAAAATCAGGAGTTAGG - Intronic
991336927 5:65559279-65559301 AACAAAAACTTTCAGGATTTTGG - Intronic
991439442 5:66631363-66631385 ATGAAAAACATTCTGGAATTTGG + Intronic
992192992 5:74312449-74312471 ATCTGAATCAATCAGGACTTGGG + Intergenic
993571472 5:89544938-89544960 AACAGAAACATGCTGAAGTTTGG - Intergenic
993722142 5:91332138-91332160 ATGAGAAACAGTGAGGGGTTGGG - Intergenic
993929480 5:93920535-93920557 ATCAAAAAAATTAAGAAGTTAGG + Intronic
994409331 5:99386925-99386947 AACAGAAACATCCAGGAGTCAGG - Intergenic
994697519 5:103091359-103091381 ATCTAAAACAATCATGAGTTAGG + Intronic
995452781 5:112320924-112320946 CTCAGACACATTCATGGGTTGGG - Intronic
998054339 5:139061539-139061561 TTCAGAAACATAAAGGAATTTGG - Intronic
998568841 5:143239267-143239289 TTTAGAAACTTGCAGGAGTTGGG + Intergenic
999266041 5:150267381-150267403 AACAGCAACATTCTGGATTTGGG - Intronic
999841735 5:155435185-155435207 GCCACAAACATTCTGGAGTTTGG - Intergenic
1000349179 5:160339822-160339844 ATCAGCAAAATTCACGAGCTGGG + Intronic
1002820270 6:718282-718304 ATCAGAAACATTGAGAGCTTGGG + Intergenic
1003460858 6:6326401-6326423 GACAGAAACATTCTGGAGATGGG - Intergenic
1004835591 6:19528024-19528046 ATCAGAAAGTTACAGGAATTGGG + Intergenic
1004869618 6:19891579-19891601 ATGAGAAAAAGTCAAGAGTTAGG - Intergenic
1006728938 6:36220921-36220943 ATAAGAAACAGCCAGGAGTAGGG - Intronic
1006818403 6:36870114-36870136 GTCAGAAGCATTCAGGTTTTTGG - Intronic
1006976020 6:38102266-38102288 ATGAGAAACACTCACGAGTAGGG + Intronic
1008561560 6:52729653-52729675 ATGTGAAACTTTAAGGAGTTTGG + Intergenic
1009284042 6:61791217-61791239 AATAGAAACATTCCGGAGTGAGG - Intronic
1009879928 6:69554163-69554185 TTCAGAAAAAAACAGGAGTTTGG + Intergenic
1010635348 6:78252377-78252399 ATCAGAAACATTGTGGAATTAGG + Intergenic
1010830616 6:80523818-80523840 CACAGGAACATTCAGAAGTTAGG + Intergenic
1011243714 6:85299723-85299745 AAAAAAAACATTCAGGAATTGGG + Intergenic
1012123128 6:95391827-95391849 ATCAGAAAGATGCAGGATATAGG - Intergenic
1014709414 6:124788778-124788800 ATCAGAGACATTCAGAATTGTGG + Intronic
1015049930 6:128828034-128828056 ATCAAAAAGGTGCAGGAGTTAGG - Intergenic
1016193622 6:141303234-141303256 ATCAGAAGCAATGAGGAGTGCGG + Intergenic
1016381929 6:143492925-143492947 ATCAGAAACCTTTAGTTGTTTGG + Intergenic
1016834222 6:148461217-148461239 AGCACACACATTCAGGAGTCAGG - Intronic
1018840812 6:167515013-167515035 ACCGGAAGCATTCTGGAGTTTGG - Intergenic
1020243483 7:6413105-6413127 ATCAGTAACACTGAGGGGTTAGG + Intronic
1021532844 7:21668396-21668418 AAGAGAAACATTCTGGATTTAGG - Intronic
1023293609 7:38692317-38692339 ATCGGCAGCTTTCAGGAGTTGGG - Intergenic
1024043024 7:45569416-45569438 ATCAGATGAAGTCAGGAGTTGGG + Intergenic
1024818555 7:53299946-53299968 AGCTGAAACATTCAGGGTTTTGG - Intergenic
1028593740 7:92526448-92526470 AGCAGAAAGATTCACAAGTTGGG - Intronic
1029792503 7:102859762-102859784 AGCAAAAGCATTCATGAGTTTGG - Intronic
1030757175 7:113301186-113301208 AACAGAAACATTTAAGAGGTTGG - Intergenic
1031292919 7:119961215-119961237 ATCAGAAACATTCCAAAATTTGG + Intergenic
1031534939 7:122921903-122921925 GTGAGAAACATGCAGGAGTGGGG + Intergenic
1032526675 7:132583109-132583131 ATCAGAGACATTCAAGAGAGAGG + Intronic
1035007298 7:155675644-155675666 ATCAAAATGATTCAGGAGGTAGG - Intronic
1037894698 8:22644110-22644132 ATCAGGAAAAATCAGGAGGTTGG + Intronic
1039599720 8:38825380-38825402 CTCAGAGACATTCTGGAGATGGG - Intronic
1041459945 8:58100303-58100325 ATCAGATACATTCTGAAGCTGGG + Intronic
1042013700 8:64283141-64283163 CACAGAAACAGTCAGGAGTGTGG - Intergenic
1042404128 8:68383949-68383971 AAAAGAAACATACAGGATTTTGG + Intronic
1042824596 8:72967429-72967451 ATCAGAACCTTTCAGAAGTGAGG + Intergenic
1043377382 8:79666048-79666070 GGCAGCAACCTTCAGGAGTTGGG - Intronic
1044106932 8:88221053-88221075 ACCAGAAAGCTTCAGGACTTAGG + Intronic
1044123311 8:88425198-88425220 ATCAGCAGCTTTCAGGAATTGGG + Intergenic
1045568793 8:103348912-103348934 ATGAGAGACCTCCAGGAGTTGGG - Intergenic
1045889181 8:107134448-107134470 ATCAGAAATATTCAGAAGTAGGG + Intergenic
1047126206 8:121963929-121963951 AGTAGAAAGATTCAGGACTTGGG - Intergenic
1047388970 8:124434594-124434616 ATCACAAAAATTTATGAGTTGGG + Intergenic
1047844795 8:128794262-128794284 TTCAGAAAAATTCATGAGATGGG + Intergenic
1047909313 8:129510050-129510072 AGCAAAAACATTGAAGAGTTGGG - Intergenic
1048277722 8:133079697-133079719 AACAGAAATATTCAAAAGTTTGG + Intronic
1048550767 8:135432046-135432068 ATAATAAGCATTCATGAGTTTGG + Intergenic
1050263747 9:3868729-3868751 ATCAGCCACATTTAGGGGTTTGG - Intronic
1052959573 9:34283537-34283559 ATCAGAATCCCTCAGGAGTGGGG - Intronic
1053672618 9:40383453-40383475 GTCAGAAATATTCAGGAACTAGG + Intergenic
1053922431 9:43009841-43009863 GTCAGAAATATTCAGGAACTAGG + Intergenic
1054383729 9:64523512-64523534 GTCAGAAATATTCAGGAACTAGG + Intergenic
1054512007 9:65992829-65992851 GTCAGAAATATTCAGGAACTAGG - Intergenic
1055361730 9:75498097-75498119 AAAAGAAAAAATCAGGAGTTTGG + Intergenic
1055394940 9:75863892-75863914 AACAGGAAAATTCAGGATTTTGG - Intergenic
1056105985 9:83346777-83346799 ATCAGAAACCTCCGGCAGTTGGG - Intronic
1056400871 9:86225894-86225916 ATCAGAGACCTCCAGAAGTTAGG + Intronic
1056758815 9:89400230-89400252 ATCAGAAACTTCCAGGGGGTGGG + Intronic
1060853606 9:126897613-126897635 CTCACAGACATTCAGGGGTTTGG - Intergenic
1061456042 9:130698461-130698483 ATCAGAAACATCCATGGGGTGGG + Intronic
1186806398 X:13144404-13144426 ATCAGAAACTCTCAGGCGGTGGG + Intergenic
1187985667 X:24808057-24808079 ATTGAAAACATTCAGGAGATTGG + Intronic
1188807455 X:34609164-34609186 CTCAGAGCCATTCAGGAGATTGG - Intergenic
1188960866 X:36489810-36489832 GTAAGAAACTTTCAAGAGTTCGG - Intergenic
1188989439 X:36799900-36799922 ATCAGGAACAGTCAGGGGTGAGG + Intergenic
1190453080 X:50600111-50600133 ATCAGAAAATCTCTGGAGTTGGG - Intronic
1190936636 X:55003893-55003915 AACAGAATCAGTCAGGAGTGGGG - Intronic
1191224239 X:58025012-58025034 ATGACAAAATTTCAGGAGTTGGG + Intergenic
1193482778 X:82047591-82047613 ATCAGCAAGATTCAGGAGGATGG + Intergenic
1194498861 X:94655230-94655252 CTGAGAAGCTTTCAGGAGTTGGG + Intergenic
1194980755 X:100438002-100438024 ATCAGCAGCTTTCAGGAATTGGG + Intergenic
1196607221 X:117670983-117671005 ATCAGATGCATTCAGAAGATGGG - Intergenic
1196935341 X:120724983-120725005 ATTAGAGACTGTCAGGAGTTTGG + Intergenic
1198047924 X:132921114-132921136 AACAGAAACAGACATGAGTTGGG + Intronic
1198056453 X:133000425-133000447 TTCAGAAACATTCAGTTCTTGGG + Intergenic
1202296975 Y:23369010-23369032 CTCAGAAAAATCAAGGAGTTTGG + Intergenic
1202573832 Y:26301587-26301609 CTCAGAAAAATCAAGGAGTTTGG - Intergenic