ID: 972308316

View in Genome Browser
Species Human (GRCh38)
Location 4:37853819-37853841
Sequence AATCAGAAACATTCAGGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 259}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972308316_972308321 24 Left 972308316 4:37853819-37853841 CCAACTCCTGAATGTTTCTGATT 0: 1
1: 0
2: 0
3: 24
4: 259
Right 972308321 4:37853866-37853888 CTCCTGCAGAAATGGAGAAGAGG No data
972308316_972308323 27 Left 972308316 4:37853819-37853841 CCAACTCCTGAATGTTTCTGATT 0: 1
1: 0
2: 0
3: 24
4: 259
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308316_972308319 16 Left 972308316 4:37853819-37853841 CCAACTCCTGAATGTTTCTGATT 0: 1
1: 0
2: 0
3: 24
4: 259
Right 972308319 4:37853858-37853880 TAAACCATCTCCTGCAGAAATGG 0: 1
1: 0
2: 1
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972308316 Original CRISPR AATCAGAAACATTCAGGAGT TGG (reversed) Intronic
903425599 1:23251872-23251894 ACTCAGCAACTTTAAGGAGTAGG - Intergenic
903451731 1:23458148-23458170 AATCAGGAAGATTAAGGAGACGG + Intronic
907892450 1:58648731-58648753 AAGCAGAACCTTTCTGGAGTGGG + Intergenic
907972391 1:59396092-59396114 AATCAGAAACTCTTGGGAGTGGG + Intronic
908159590 1:61393504-61393526 AATCATAAGCATGCAGGAGTAGG - Intronic
908620826 1:65977239-65977261 AATCAGAAACTCTGGGGAGTGGG - Intronic
908646699 1:66286224-66286246 AAACTGAAACTTTGAGGAGTTGG + Intronic
909568507 1:77082038-77082060 AATTAGATACCTTGAGGAGTTGG - Intergenic
909619482 1:77651635-77651657 AATGAAAAACATTCTGGAGATGG + Intronic
910367589 1:86483192-86483214 ATTCAGAAACTTCCAGGAGGAGG + Intronic
914970256 1:152303421-152303443 AATGAGGAACAGTCAGGAGACGG - Exonic
914970728 1:152306337-152306359 AATGAGGAACAATCAGGAGACGG - Exonic
914971205 1:152309256-152309278 AATGAGAAACAATCAGGAGACGG - Exonic
914971366 1:152310228-152310250 AATGAGGAACAATCAGGAGACGG - Exonic
914971827 1:152313147-152313169 AATGAGGAACAATCAGGAGACGG - Exonic
915806928 1:158863916-158863938 AATCTGTAAGTTTCAGGAGTAGG + Intergenic
916183512 1:162108776-162108798 AATCAGCAACATTTAGAAGTAGG + Intronic
916586010 1:166150966-166150988 AATCAGAAATGTTTAGAAGTTGG + Intronic
916947435 1:169742916-169742938 GAGCAGAAATCTTCAGGAGTGGG + Intronic
917820372 1:178756887-178756909 AATCAAAAAAATTAAGGAGGAGG - Intronic
918513997 1:185342277-185342299 GATCAGAAAGATTCAGAGGTGGG + Intergenic
922509502 1:226152129-226152151 ATTCAGAAAAATTCAGGTTTAGG + Intronic
1064632228 10:17328341-17328363 AATAAGAAAGATTCAGGTCTTGG - Intronic
1066669383 10:37820819-37820841 AATGGGAAATATTCAAGAGTTGG - Intronic
1068027880 10:51670846-51670868 ATTCAGTATTATTCAGGAGTAGG - Intronic
1068371370 10:56120354-56120376 AATCAGAAAGAAACATGAGTGGG - Intergenic
1068573902 10:58661887-58661909 AATCAGAAAAATTCGAGTGTAGG + Intronic
1068909611 10:62365105-62365127 AGTCAGAAAGTTTCAAGAGTTGG + Intergenic
1071057015 10:81523548-81523570 AAGCAGAAAAATTCAGGGGTAGG + Intergenic
1074080821 10:110166834-110166856 AATCAGAATCCTTCAGGATGGGG + Intergenic
1075143339 10:119861416-119861438 AATCAGAAACTCTTAGGGGTGGG + Intronic
1075266094 10:121000607-121000629 AAGCAGAAACATAGAGGAGAAGG + Intergenic
1075322814 10:121505828-121505850 GCTCAGAAAGATTCAGGAGCGGG + Intronic
1075354632 10:121760085-121760107 AATCAGAAAAACTGAGCAGTAGG - Intronic
1077468051 11:2743024-2743046 AATATGAAAAATTCACGAGTGGG - Intronic
1078860404 11:15241209-15241231 ATTTAGGAACATTTAGGAGTAGG + Intronic
1079141237 11:17811148-17811170 TATCTGAAACATTTAGGAATTGG - Intronic
1079571336 11:21947051-21947073 ATTCAGAAAAATACAGGAGTTGG + Intergenic
1085805074 11:79628436-79628458 TATGAGAAACCTTCAGGAGATGG - Intergenic
1085968769 11:81561578-81561600 AATCATAAACATTCTGGAAAAGG + Intergenic
1086148839 11:83586153-83586175 CCTCAGCATCATTCAGGAGTGGG + Intronic
1087681805 11:101226450-101226472 AACCAGAGATATTCAGGAGTAGG - Intergenic
1088347507 11:108844723-108844745 AATCTGAAAAATTAGGGAGTAGG + Intronic
1090326693 11:125893478-125893500 AATCAGATACTTGCAGGATTAGG + Exonic
1091351077 11:134894839-134894861 AAAATGAATCATTCAGGAGTTGG + Intergenic
1092992103 12:13912885-13912907 AAGCAGAGACATTGAGGAGGGGG - Intronic
1093096651 12:14979553-14979575 AATCTGAGACATACAGGAATTGG + Intronic
1093415417 12:18914730-18914752 AAACAAAAACATCCAGGAGAGGG - Intergenic
1094153049 12:27307393-27307415 AAACAGATATATACAGGAGTAGG + Intronic
1094697924 12:32840113-32840135 AATCAGAAACACTCAAGGTTGGG - Intronic
1095235209 12:39786667-39786689 AGTCAGAAACTTTTAGGAATTGG + Intronic
1096401423 12:51309889-51309911 AATCAGAAACCTTCCACAGTGGG + Intronic
1097362553 12:58673919-58673941 ACACAGAAATATTCAGGAGGAGG + Intronic
1097671749 12:62548008-62548030 AATAAGAAACCTTCAGCAGGAGG + Intronic
1098107883 12:67089918-67089940 AATCAGAAAAATTCAGAATGTGG + Intergenic
1098368344 12:69730961-69730983 AATCAGAAACTTTAAGAATTGGG - Intergenic
1098878888 12:75896062-75896084 AATCAGAATGAGTCAGAAGTTGG + Intergenic
1101312547 12:103596282-103596304 AATCAGAAACATTGAAGACAAGG + Intronic
1104405509 12:128513229-128513251 AAGCAGAAACATCCTGAAGTGGG + Intronic
1104675183 12:130707608-130707630 AATCAGAAGCTTCCAAGAGTGGG + Intronic
1106668315 13:31876965-31876987 AGTAAGAGACATGCAGGAGTCGG - Intergenic
1106964526 13:35045615-35045637 AATCAGAAGTAGTAAGGAGTGGG - Intronic
1107677433 13:42811477-42811499 ATTCAGAAACACTCAAGAGCAGG - Intergenic
1108694941 13:52894875-52894897 GATCAGACACTTACAGGAGTGGG - Intergenic
1114660772 14:24342489-24342511 AATTAGAGACAATCAGGAGCAGG - Intergenic
1114829574 14:26124263-26124285 CATCAGTAGCATTCAGGACTTGG - Intergenic
1115181927 14:30637434-30637456 AATGTGAAACATTGAGGGGTTGG - Intronic
1120486672 14:85122652-85122674 GATCAGAAACTTTGAGGATTTGG + Intergenic
1122188436 14:100020497-100020519 AATGAGAAGCTTTCAGAAGTCGG - Intronic
1124637608 15:31374973-31374995 AAACAGAAATATGCAGGCGTTGG + Exonic
1125259222 15:37802864-37802886 AATCAGAAACTCTGTGGAGTAGG + Intergenic
1127569065 15:60223179-60223201 AATCAGAAACAGGCAGTCGTGGG + Intergenic
1128129075 15:65213613-65213635 AATCAGAAACAGCCAGGACTAGG - Intergenic
1133094259 16:3430542-3430564 AGACAGAAACATTCAGGTTTTGG + Intronic
1133910176 16:10058766-10058788 TGTCAGAAACATTCAGAATTTGG - Intronic
1134060441 16:11196463-11196485 AATAATAAACATTCATGATTTGG - Intergenic
1134894836 16:17875821-17875843 CCTCAGAAACTTTCAGCAGTTGG - Intergenic
1135252342 16:20911653-20911675 AATCAGAATCTTCCAGTAGTGGG + Intronic
1135723608 16:24837534-24837556 AAACAGAAACAATCAGGGCTGGG + Intergenic
1135839602 16:25862921-25862943 AATCAAAAATATTCAAGAATAGG - Intronic
1136573796 16:31111618-31111640 ATTGAGAAATAGTCAGGAGTCGG + Intronic
1137455923 16:48617845-48617867 AATTAGAAACATTTGGGAGCTGG - Intronic
1138712923 16:58989224-58989246 AACCAAAAGCATGCAGGAGTAGG + Intergenic
1140524262 16:75609276-75609298 AAGCAGAAACATTAATGTGTTGG + Intronic
1140635545 16:76908658-76908680 AGGCATAAACATCCAGGAGTGGG + Intergenic
1140642845 16:76997202-76997224 ACTCAGAAACATTCAGTATGTGG + Intergenic
1140730741 16:77853643-77853665 AATCAGAAACTTCCAGGATGGGG - Intronic
1141766455 16:86062833-86062855 AAACAGAAACACACAGGAGCTGG + Intergenic
1142581757 17:947435-947457 AATCAAAAATATTCAGGGCTCGG + Intronic
1143932925 17:10449667-10449689 AATCAGTAACTTTCTGGATTTGG + Intronic
1145812377 17:27772210-27772232 ACTCTGAGACATCCAGGAGTGGG + Intronic
1146205842 17:30905160-30905182 TATCAGAAACTTTAAGCAGTTGG - Intronic
1146654692 17:34628423-34628445 CATCTGAAACATCCAGGACTCGG + Intronic
1146816546 17:35947203-35947225 CATCAGATAGATTCAGAAGTGGG + Intergenic
1147483291 17:40787586-40787608 AATCAAAATTATTCAGGAGAGGG + Intergenic
1147494668 17:40904450-40904472 AGAGAGAAACATTCAGGAGTGGG + Intergenic
1148483575 17:47976157-47976179 ACTCAGAAAAATAAAGGAGTAGG - Intronic
1150567333 17:66353274-66353296 AATCAGAAAAATTAAAGATTAGG - Intronic
1151044038 17:70898259-70898281 ATTTAGAAACATTAAGAAGTAGG - Intergenic
1153481253 18:5549060-5549082 AGTAAGACACATTCAGAAGTCGG + Intronic
1155691803 18:28633827-28633849 AATCAAAAAGATTCAGCAGGAGG - Intergenic
1156931347 18:42647918-42647940 AATCAGCTAGAGTCAGGAGTCGG + Intergenic
1157006002 18:43585642-43585664 AAGCAGAAATATTTAGAAGTGGG + Intergenic
1157123740 18:44936109-44936131 ATTCAGATACATTCTGCAGTAGG - Intronic
1159277544 18:66240233-66240255 AAACATAAACATTCAGAAGTAGG + Intergenic
1161829413 19:6591496-6591518 AATCAAAAAAATGCAGGAGAGGG - Intronic
1164018921 19:21279734-21279756 AAAAAAAATCATTCAGGAGTAGG + Intronic
1164574082 19:29395432-29395454 GATCAGAAAGATTCAGCAGGAGG + Intergenic
1166585533 19:43944561-43944583 AATCTAGAACATTCAGGGGTTGG + Intergenic
925468794 2:4136318-4136340 ATGCAAAAACATTCAGGAGTAGG - Intergenic
927445079 2:23153053-23153075 TATAAGAAGCATTCAGGAGGTGG + Intergenic
928226815 2:29456607-29456629 GATGAAAAACATTCTGGAGTTGG + Intronic
928287585 2:30006756-30006778 AATCAGAAACAACCAGGGCTTGG - Intergenic
930285749 2:49425212-49425234 AATCAGAAAAAATCAGGCCTTGG + Intergenic
931276806 2:60751249-60751271 AACCAGAAACATCTAGAAGTTGG + Intergenic
932431550 2:71678244-71678266 AATCAGAAACTTTCAGACTTTGG + Intronic
932802982 2:74758995-74759017 AAGAAGTAACATTCAGTAGTTGG + Intergenic
935597490 2:104890569-104890591 AACCCGAAACATTCAGGGGTTGG - Intergenic
935611094 2:105026103-105026125 AATGAGAAACATTCTGAAGTGGG - Intergenic
935903395 2:107816754-107816776 AATCAGAACCTCTCAGGAGAGGG + Intergenic
938342662 2:130546000-130546022 AGTCAGAAACATTCAGAACCAGG + Intronic
938347171 2:130574722-130574744 AGTCAGAAACATTCAGAACCAGG - Intronic
938997286 2:136693737-136693759 AACCAGATATATTCTGGAGTTGG + Intergenic
938997484 2:136695981-136696003 AATTTGAAACATTGAAGAGTTGG + Intergenic
939679678 2:145115086-145115108 GGTCAGAAACATTGAGGAGGTGG + Intergenic
941377594 2:164750837-164750859 AATCAGAAACATTAAGGGCAGGG + Intronic
944160870 2:196658018-196658040 AATCAGAAATAATTAGTAGTTGG + Intronic
945118697 2:206436402-206436424 AATCCTAAACACTCAGGAATTGG + Intergenic
947946628 2:234109299-234109321 AATGAGAAACATACAGAAGAGGG - Intergenic
948016936 2:234698856-234698878 TATCATATACATTTAGGAGTGGG - Intergenic
949069375 2:242014358-242014380 AATCAAAACCAAGCAGGAGTAGG - Intergenic
1169287882 20:4324836-4324858 AGGCAGAAAGATTCAGGAGCTGG - Intergenic
1169295982 20:4399430-4399452 TAACAGAAATATTCAGGAGATGG - Intergenic
1169832824 20:9842644-9842666 AACCAGTAACATGCAGGAGCTGG + Intergenic
1170248561 20:14252335-14252357 GATCAGAAAAATTTTGGAGTGGG + Intronic
1170678899 20:18507695-18507717 AAACAGAAACGTTTAGGGGTGGG + Exonic
1171108236 20:22456435-22456457 ATCCAGAGACATTCTGGAGTAGG + Intergenic
1175728529 20:61335855-61335877 AAGCAGAAACAGTCATCAGTGGG - Intronic
1176523267 21:7842718-7842740 AAACAGAAACATTACAGAGTTGG + Intergenic
1177277666 21:18935089-18935111 AATCAGCAATATCTAGGAGTTGG - Intergenic
1177946825 21:27480813-27480835 GATCAGAAACATTGGGGACTTGG - Intergenic
1178657287 21:34472730-34472752 AAACAGAAACATTACAGAGTTGG + Intergenic
1178701758 21:34839839-34839861 AATCAGAAGCAGGCAGGAGAAGG - Intronic
1178712235 21:34927974-34927996 AATCAGAATCCTTGAGGGGTAGG + Intronic
1180284764 22:10734270-10734292 ATTCAGAAACCTGCAGTAGTAGG - Intergenic
1181184490 22:21093063-21093085 AATCAACAACATCCATGAGTGGG - Intergenic
1181367816 22:22392192-22392214 AATCAGAAACAATAAGGTGAGGG - Intergenic
1181868257 22:25876414-25876436 GATCAAGAACATTCAGGAATAGG - Intronic
1184939261 22:47749084-47749106 AAACACAGACATTCAGGAGTCGG - Intergenic
949702112 3:6770488-6770510 AAACAGAACCATTCAAGAGAGGG - Intronic
950225015 3:11226339-11226361 AATCAGAAAGATTGAAGAGTGGG + Intronic
950703053 3:14763200-14763222 TTTCAGAAACATTCAGAAGAAGG + Intronic
950899433 3:16483890-16483912 AATCAGAAACTTTGAGGATGGGG + Intronic
952069150 3:29612030-29612052 AAACAAAAAAATTGAGGAGTTGG - Intronic
952576577 3:34781404-34781426 ATTCAGAACAATTCAGGAGTTGG + Intergenic
953144495 3:40261866-40261888 AATGAGAAACATTGAGGTGGAGG - Intergenic
955548676 3:60059212-60059234 AATCAGCAGTTTTCAGGAGTTGG + Intronic
955561789 3:60199406-60199428 AGTTAGAAACATTCTGGATTGGG + Intronic
955639594 3:61068027-61068049 AATCAGAAACTCTGAGGAGGGGG - Intronic
956815861 3:72907686-72907708 AATGAGAAACAGGCAGGAGAGGG - Intronic
958443081 3:94180068-94180090 AAAGAGAAAAATTTAGGAGTGGG - Intergenic
959432852 3:106276254-106276276 AATCAGAAACATAAAGGATGTGG + Intergenic
959471294 3:106754353-106754375 ATTCTGAAAAATACAGGAGTAGG + Intergenic
959524624 3:107362868-107362890 AAGCAAAATAATTCAGGAGTTGG - Intergenic
963676777 3:148322139-148322161 AAGCAGAAACATTTTGGAGGAGG - Intergenic
965173978 3:165306496-165306518 ATTCAAAAACATTGAGGAGGAGG + Intergenic
965219389 3:165907505-165907527 AATCAGAAAAATAGAAGAGTAGG + Intergenic
966746105 3:183278785-183278807 AATAACAATGATTCAGGAGTAGG + Intronic
967309659 3:188093991-188094013 AAGCAGAAGCAATTAGGAGTGGG + Intergenic
967360259 3:188622690-188622712 AATGAGAAACATCTATGAGTGGG - Intronic
967413506 3:189191783-189191805 AATGGGCAATATTCAGGAGTAGG - Intronic
968024319 3:195426416-195426438 AATCAGAAAAATTCAGGAAGGGG + Intronic
970773934 4:19649807-19649829 AATCAGTGATATTCAGGAATGGG - Intergenic
972308316 4:37853819-37853841 AATCAGAAACATTCAGGAGTTGG - Intronic
974235439 4:59174914-59174936 AATCAGACAAATTCAGAAGGTGG - Intergenic
974581646 4:63811346-63811368 AATCAAAAAAATTGAGGAGGAGG - Intergenic
975800907 4:78058263-78058285 AATACAAAACAATCAGGAGTAGG - Intronic
977005821 4:91568784-91568806 AATCATCAAGATTCAGGAGATGG - Intronic
977178398 4:93842411-93842433 ATTTAGAAACATTTATGAGTTGG + Intergenic
978544651 4:109858007-109858029 AATGAGAAACATCCATTAGTGGG + Intronic
979743938 4:124186005-124186027 AAGCAGAAATATTTAGGAATTGG + Intergenic
980656100 4:135788638-135788660 AATCAGAAGCATTTCTGAGTGGG - Intergenic
981220480 4:142227003-142227025 AAACAGAAACATTCGGCAGGTGG + Intronic
981423475 4:144577806-144577828 AATCAGAAACAAATAGGTGTGGG + Intergenic
982745540 4:159102290-159102312 AATCAGAAACATTTATTGGTAGG - Intergenic
983916584 4:173299058-173299080 GATTAGACACATTCAGGAGAAGG - Intronic
984212650 4:176869508-176869530 AATCAAAAATATTCAATAGTGGG + Intergenic
984546677 4:181112877-181112899 AATAAGAAACATTGGGGATTGGG + Intergenic
985435172 4:189922570-189922592 AATCAAAAGAATGCAGGAGTAGG + Intergenic
985939461 5:3123142-3123164 AAACAAAAACATTTTGGAGTGGG - Intergenic
988654684 5:33196202-33196224 ATTCAGAGTCATTCAGGAATAGG - Intergenic
988704751 5:33714067-33714089 AATTAGAGTCTTTCAGGAGTTGG + Intronic
989127539 5:38071677-38071699 ATGCAGAAGCATGCAGGAGTGGG + Intergenic
989412115 5:41132158-41132180 AAGCATGAACATTCCGGAGTTGG + Intergenic
991106811 5:62852731-62852753 ACTCAGAGACATTTAGTAGTGGG + Intergenic
993722143 5:91332139-91332161 AATGAGAAACAGTGAGGGGTTGG - Intergenic
994347441 5:98703407-98703429 CCTAACAAACATTCAGGAGTGGG - Intergenic
994389004 5:99167149-99167171 CTCCAGAAAGATTCAGGAGTTGG - Intergenic
995452782 5:112320925-112320947 ACTCAGACACATTCATGGGTTGG - Intronic
995580280 5:113592333-113592355 AATCAGACACATTTACAAGTAGG - Intronic
995761045 5:115562118-115562140 AATCAGAAACCCTTAGGGGTGGG + Intergenic
995908029 5:117149823-117149845 AATCAGAAATCATCAGGGGTGGG - Intergenic
997005114 5:129807284-129807306 AACCAGAAACATACAGGAAATGG - Intergenic
998939690 5:147267881-147267903 AATAAGAAAGCTTCAGGAATGGG - Intronic
999016120 5:148107485-148107507 AATCATAAAATGTCAGGAGTGGG - Intronic
999266042 5:150267382-150267404 AAACAGCAACATTCTGGATTTGG - Intronic
999424020 5:151470743-151470765 ATTCAGAAACATTGAACAGTAGG - Intronic
999529808 5:152450577-152450599 AAACATGAACATTCATGAGTAGG - Intergenic
999677382 5:154017814-154017836 ACCCAGAATCATTCAGGAGCAGG - Intronic
999939402 5:156524772-156524794 ACTCAGAAACATTGAGTAGAAGG - Intronic
1000086914 5:157895712-157895734 AATCAGCAAAATTCAGAATTTGG - Intergenic
1001688994 5:173618164-173618186 CAAAAGAAACATTCAGGTGTTGG + Intergenic
1002938543 6:1696089-1696111 AAACAAAAACATGCAGGAGAGGG + Intronic
1003460859 6:6326402-6326424 AGACAGAAACATTCTGGAGATGG - Intergenic
1004404427 6:15318722-15318744 GATCAGAAACAATGAGGGGTGGG + Intronic
1004835590 6:19528023-19528045 AATCAGAAAGTTACAGGAATTGG + Intergenic
1005212605 6:23484916-23484938 AATCAGACCCATTCAGGATGTGG + Intergenic
1006728939 6:36220922-36220944 GATAAGAAACAGCCAGGAGTAGG - Intronic
1006976019 6:38102265-38102287 GATGAGAAACACTCACGAGTAGG + Intronic
1008275385 6:49537966-49537988 AATCAGAAAAATTCAAAAGGTGG + Intergenic
1008695142 6:54027202-54027224 AATAACAAAGATTCAGGAATTGG + Intronic
1009620459 6:66068775-66068797 ACACAGATTCATTCAGGAGTAGG - Intergenic
1013921083 6:115404588-115404610 AATGAGAAACAGTCAAGAATGGG - Intergenic
1015290827 6:131536708-131536730 AATCAGAGACATCCAGAATTTGG - Intergenic
1016555915 6:145338120-145338142 ACTCAGAAAGATTCAGTAGCTGG - Intergenic
1016737727 6:147498171-147498193 AAACAAAATCATTCAGGAGGAGG - Intergenic
1016790531 6:148062843-148062865 AAACAGAAAAAAGCAGGAGTTGG - Intergenic
1021030537 7:15728536-15728558 AATGATAAAGATTGAGGAGTTGG + Intergenic
1021710519 7:23411667-23411689 CATCAAAAACAATCAGCAGTTGG + Intronic
1023293610 7:38692318-38692340 AATCGGCAGCTTTCAGGAGTTGG - Intergenic
1026417107 7:70193754-70193776 TATCTGAAACAGTCAGGAGCTGG - Intronic
1028593741 7:92526449-92526471 AAGCAGAAAGATTCACAAGTTGG - Intronic
1028902274 7:96114826-96114848 AATCAGAAAAATTAAAAAGTGGG - Intergenic
1030786878 7:113673418-113673440 AATCAGGAGCATTCAGCAGAAGG + Intergenic
1031283081 7:119830239-119830261 AATCACAAACATTTTGGAATAGG - Intergenic
1031534938 7:122921902-122921924 TGTGAGAAACATGCAGGAGTGGG + Intergenic
1031626993 7:124003595-124003617 AATCATCAAGATTCAGGAGGAGG - Intergenic
1035970545 8:4243118-4243140 AATCAGACAAATTGAGCAGTTGG + Intronic
1036235209 8:7034058-7034080 AGTCAGAAAGATTGAGGGGTGGG + Intergenic
1036493398 8:9248527-9248549 AATTACAAACATACAGGAGTCGG - Intergenic
1037476861 8:19266309-19266331 CAACACAAACATTCAGAAGTGGG + Intergenic
1038208653 8:25494162-25494184 AATCAAAAACACTCAGGGCTGGG + Intronic
1038756007 8:30341218-30341240 AATCAGAATCTCTAAGGAGTTGG - Intergenic
1039570679 8:38583869-38583891 CATCAGAAACATTCACAAGAGGG - Intergenic
1039670345 8:39589226-39589248 AGCCAGTAACATTAAGGAGTTGG - Intronic
1041406019 8:57500432-57500454 GATCAGAAACAGTCAGGGCTGGG + Intergenic
1041911244 8:63090711-63090733 AATCAGAAAAATCCAGAAGATGG - Intergenic
1043377383 8:79666049-79666071 AGGCAGCAACCTTCAGGAGTTGG - Intronic
1044123310 8:88425197-88425219 AATCAGCAGCTTTCAGGAATTGG + Intergenic
1044377464 8:91493619-91493641 AATCAGAAAATATCAGGTGTTGG - Intergenic
1045568794 8:103348913-103348935 AATGAGAGACCTCCAGGAGTTGG - Intergenic
1045889180 8:107134447-107134469 CATCAGAAATATTCAGAAGTAGG + Intergenic
1047126207 8:121963930-121963952 AAGTAGAAAGATTCAGGACTTGG - Intergenic
1047388969 8:124434593-124434615 AATCACAAAAATTTATGAGTTGG + Intergenic
1047531355 8:125679664-125679686 AATCAGATAAGTCCAGGAGTAGG + Intergenic
1047540395 8:125759754-125759776 AAACAGAAAAGCTCAGGAGTTGG - Intergenic
1047909314 8:129510051-129510073 AAGCAAAAACATTGAAGAGTTGG - Intergenic
1050878456 9:10670804-10670826 AATCAAAAAAATTGAGGAGGAGG - Intergenic
1052959574 9:34283538-34283560 AATCAGAATCCCTCAGGAGTGGG - Intronic
1054963200 9:70992930-70992952 TATCAGAAACATTCTGCAATGGG + Intronic
1056105986 9:83346778-83346800 AATCAGAAACCTCCGGCAGTTGG - Intronic
1056110027 9:83385716-83385738 ATTCAGAAAAATACAGGAGCTGG + Intronic
1056473316 9:86926956-86926978 AATCAGGAACATTCAGTAAGGGG + Intergenic
1058954846 9:109936581-109936603 TAACAGAAACATCCAGGAGTTGG - Intronic
1059789014 9:117619676-117619698 AAACAGAAACAGGCAGGATTTGG + Intergenic
1060198149 9:121636416-121636438 AAGCAGAAACTTTCAGGAGCAGG + Intronic
1185499665 X:587177-587199 AATCAGAAAAAAACAGAAGTAGG - Intergenic
1186728019 X:12377566-12377588 AATCAGCAACTTTCAAGACTGGG - Intronic
1186806397 X:13144403-13144425 AATCAGAAACTCTCAGGCGGTGG + Intergenic
1187385287 X:18842992-18843014 AACCAGAAACATACAAGAGAGGG - Intergenic
1189227290 X:39423379-39423401 CATGAAAAACACTCAGGAGTGGG - Intergenic
1190850201 X:54233004-54233026 ATTCAGACACATTCAGGAGGTGG - Exonic
1190936637 X:55003894-55003916 AAACAGAATCAGTCAGGAGTGGG - Intronic
1193370359 X:80689227-80689249 AATTAGAAACATAGATGAGTGGG + Intronic
1193703660 X:84793598-84793620 ACTCAAAATCATTCAGGAGCAGG - Intergenic
1194980754 X:100438001-100438023 AATCAGCAGCTTTCAGGAATTGG + Intergenic
1195263604 X:103158419-103158441 AAACAGAAAGCTTCACGAGTTGG + Intergenic
1195324890 X:103750489-103750511 AATGAGAAACATTCAGGATGTGG - Intergenic
1196278015 X:113791520-113791542 AATCAGAAACTTTCAGTCTTAGG - Intergenic
1196391154 X:115208933-115208955 AAACAGACACATTAAGGAGAGGG + Intronic
1198199903 X:134405497-134405519 AATCAGAAAGAATATGGAGTCGG - Intronic
1198954088 X:142108189-142108211 AATCGGAAAAATTAAGAAGTAGG + Intergenic
1199519287 X:148717337-148717359 AATATGAAACATTCAGAAATAGG + Intronic
1201514146 Y:14799099-14799121 ACTCAGATGCATTGAGGAGTCGG - Intronic