ID: 972308317

View in Genome Browser
Species Human (GRCh38)
Location 4:37853825-37853847
Sequence AGATTAAATCAGAAACATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 367}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972308317_972308323 21 Left 972308317 4:37853825-37853847 CCTGAATGTTTCTGATTTAATCT 0: 1
1: 0
2: 0
3: 25
4: 367
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308317_972308321 18 Left 972308317 4:37853825-37853847 CCTGAATGTTTCTGATTTAATCT 0: 1
1: 0
2: 0
3: 25
4: 367
Right 972308321 4:37853866-37853888 CTCCTGCAGAAATGGAGAAGAGG No data
972308317_972308319 10 Left 972308317 4:37853825-37853847 CCTGAATGTTTCTGATTTAATCT 0: 1
1: 0
2: 0
3: 25
4: 367
Right 972308319 4:37853858-37853880 TAAACCATCTCCTGCAGAAATGG 0: 1
1: 0
2: 1
3: 14
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972308317 Original CRISPR AGATTAAATCAGAAACATTC AGG (reversed) Intronic
900860715 1:5227393-5227415 ATATTAAAACGGAAAAATTCAGG + Intergenic
905162958 1:36053213-36053235 ATATTTAATCAGAAACCTTAGGG + Intronic
905258731 1:36702644-36702666 AGATGAGATCAGGCACATTCAGG + Intergenic
906492849 1:46281400-46281422 AGATTAAGTCAGAACCATGTGGG + Intronic
906924019 1:50094970-50094992 AGATTAATTGTGAAGCATTCAGG + Intronic
907035854 1:51215540-51215562 AGAGTAAATCAGATACACTGAGG - Intergenic
907082606 1:51637903-51637925 AGATTAAACCTGTTACATTCTGG - Intronic
908148631 1:61275384-61275406 AGATTAAATAAAAAAAATTTAGG + Intronic
909066803 1:70945007-70945029 AGATTACAGTAGAAACAATCTGG - Intronic
909398115 1:75193548-75193570 AGATTAAAACGGAAACCTTCTGG - Intergenic
911646418 1:100341893-100341915 AGATAAAATTAGAAGAATTCAGG + Intergenic
911692485 1:100850252-100850274 AGATTAAATCAAATACTTGCTGG + Intergenic
911707434 1:101030335-101030357 AGATTGAATCAGTAACAATATGG + Intergenic
911862361 1:102968870-102968892 AGATTAAATCATAGACATAAAGG + Intronic
911951921 1:104184179-104184201 AGAATGAAGCAGGAACATTCTGG + Intergenic
912060763 1:105665703-105665725 AGATAAAATCAGTGCCATTCAGG - Intergenic
912663257 1:111554228-111554250 AGATCAAGTTAGAAACATCCCGG + Intronic
912699933 1:111870025-111870047 AGATTAATTGAGACACATACTGG + Intronic
914691923 1:150037109-150037131 AAATTAGATCAGATACAGTCCGG + Intergenic
916229025 1:162520714-162520736 AGATTAGATCAGAGAGATTAGGG + Intronic
916395416 1:164381656-164381678 AGATTAAATATTAAACAGTCTGG + Intergenic
916701209 1:167297525-167297547 AGACTATATCAGAAAGGTTCAGG + Intronic
918741334 1:188134479-188134501 AGATTAAAATAGAAACACTCTGG - Intergenic
919342230 1:196326601-196326623 ATTTTAAATCAGATACATTATGG - Intronic
919715856 1:200775829-200775851 ACATTAAAATACAAACATTCTGG - Intronic
919969999 1:202569709-202569731 ACATTAACTCTGAAATATTCAGG + Intronic
920668318 1:207982963-207982985 ACATTAAATCAGAAAGAAACAGG + Intergenic
921832197 1:219740639-219740661 ACATTATTTCAGCAACATTCTGG + Intronic
923230505 1:231982250-231982272 TGATTAAATCAGCAGCATTAGGG + Intronic
924059838 1:240161846-240161868 AGATAAAATAACAAACCTTCTGG + Intronic
924211843 1:241777048-241777070 AGATTAAATCAGACACCCTCAGG + Intronic
924679579 1:246218841-246218863 AGAGGAAACCAGTAACATTCAGG + Intronic
924869257 1:248022995-248023017 AAATTAAAAGACAAACATTCTGG - Intronic
924888406 1:248245715-248245737 AAATGAAATCAGTAAAATTCTGG + Intergenic
1063793536 10:9483483-9483505 AAAGTAAATCAAAAACATTCTGG + Intergenic
1065021479 10:21505521-21505543 AAATCAGATAAGAAACATTCCGG + Intergenic
1065461574 10:25972016-25972038 AAATTTAATGAGAAGCATTCAGG - Intronic
1065703029 10:28444015-28444037 AGATGAAATCAGGATCATTTGGG + Intergenic
1065853051 10:29806383-29806405 AGCCTCAAACAGAAACATTCTGG + Intergenic
1068112004 10:52690858-52690880 ACATTAAAACAGAAACCTTAAGG - Intergenic
1068165106 10:53320454-53320476 ATATTAAATCACAACCATCCAGG - Intergenic
1068183717 10:53557378-53557400 AGTTTAAATGAGAACCATTACGG + Intergenic
1068930103 10:62581099-62581121 ACATTAACTCAGAAATATTCAGG + Intronic
1069085075 10:64129703-64129725 AATTTAAATCAGAAGCATTCAGG - Intergenic
1069206065 10:65687299-65687321 AAAAGTAATCAGAAACATTCTGG - Intergenic
1069383158 10:67860975-67860997 AGATTAAATCAGAATCTCTCAGG + Intergenic
1071564390 10:86664243-86664265 AGCTTAAAGCAGACACATTAGGG - Intronic
1072048509 10:91680911-91680933 AGATTAAATCAGGAAAACTTTGG + Intergenic
1075359435 10:121816811-121816833 AGATGAAATCAGTCACGTTCAGG - Intronic
1075986694 10:126793725-126793747 AGATAACATCAGAAAAATTCTGG + Intergenic
1080081609 11:28225850-28225872 AGATTAAATCAAAGACATGCAGG - Intronic
1080524079 11:33095864-33095886 AGATTCAAAAAGAAACATTTTGG - Intronic
1081786999 11:45754744-45754766 AAATTAAAACAAAAACACTCAGG + Intergenic
1083336530 11:61924936-61924958 AGAATCCATCAGAAACCTTCGGG + Intergenic
1083542477 11:63522810-63522832 AAATTAAAAAAGAAACATTTAGG - Intergenic
1084804224 11:71567628-71567650 AGATTAATTCAGCCACATTTAGG + Intronic
1085379785 11:76104803-76104825 GGATTACATAAGAAACATACAGG - Intronic
1085985064 11:81776882-81776904 AGATAATATCAGAAACATAAGGG - Intergenic
1086320047 11:85636625-85636647 AAATATAATAAGAAACATTCTGG + Intergenic
1086551827 11:88061579-88061601 AGAGGAAATAAGAAACATTGAGG + Intergenic
1086647425 11:89242032-89242054 AGATTATATCATAAATATTTTGG + Intronic
1087024828 11:93639474-93639496 AAATTAAATCAGAATCTTTGGGG - Intergenic
1088266778 11:107995174-107995196 AGAATAAATCAAAAACCTTCTGG - Intergenic
1090781880 11:130014275-130014297 ATATAAATTCAGAAACATTTTGG + Intergenic
1091541122 12:1463470-1463492 AAACCAGATCAGAAACATTCAGG - Intronic
1091575225 12:1727674-1727696 AGAATGAGACAGAAACATTCTGG - Intronic
1093927595 12:24924589-24924611 AGATAAAATTAGAGAAATTCAGG + Intronic
1093962971 12:25295450-25295472 AGATTAAATCAGAAAACTCAAGG - Intergenic
1093963144 12:25297651-25297673 ATATTCAATTAGAAACATGCGGG - Intergenic
1096323228 12:50633976-50633998 AGATTAAAGATGAAAAATTCAGG + Intronic
1097217085 12:57422648-57422670 AGAATACAACAGAAACTTTCAGG + Intronic
1097283346 12:57859504-57859526 ATATTGAAACAGAAAGATTCTGG - Intergenic
1097454795 12:59784826-59784848 TAAGAAAATCAGAAACATTCAGG - Exonic
1098103135 12:67040275-67040297 AGATTACTTCAGAAACTTGCTGG - Intergenic
1098413720 12:70208910-70208932 ATATTAAACCAGAAAGCTTCTGG - Intergenic
1100306464 12:93354245-93354267 GGATTATATGAGATACATTCAGG - Intergenic
1102742343 12:115219136-115219158 AGATTAGGTCTGAAAAATTCTGG - Intergenic
1102903702 12:116658799-116658821 AGATTTTGTCAGAAACATTTTGG + Intergenic
1105738320 13:23295573-23295595 TGATGAAATAAGAAACAGTCAGG - Intronic
1106669198 13:31886876-31886898 AGATCTGATCAGAAACATCCTGG - Intergenic
1107389488 13:39948568-39948590 AGTTTAAAACAGAAAACTTCAGG + Intergenic
1107590664 13:41901004-41901026 AGATTAAATCAGATAACTTTGGG + Intronic
1107660671 13:42636163-42636185 AGATCAAACAAGAAACACTCGGG - Intergenic
1108916895 13:55624886-55624908 AAAGTAAATCAAAAACTTTCTGG + Intergenic
1108961261 13:56233680-56233702 AAAATAAATAAGCAACATTCAGG + Intergenic
1111168445 13:84493143-84493165 AAATTAAATAAAAAACATTTGGG + Intergenic
1111229199 13:85318981-85319003 AGAGTAAAGTAGAACCATTCTGG + Intergenic
1111818749 13:93188095-93188117 AAATTAAGTCAAAAATATTCTGG - Intergenic
1112068183 13:95817213-95817235 ACATAAGATCATAAACATTCTGG + Intronic
1114395931 14:22361223-22361245 AGTTTAAACCAAAAACATTCAGG - Intergenic
1114947205 14:27698196-27698218 AAATTATCTCAGAAACATTTAGG + Intergenic
1115014509 14:28593895-28593917 AGATGAGATCAGCAACATTGAGG - Intergenic
1115136398 14:30113966-30113988 AGAGGCCATCAGAAACATTCAGG + Intronic
1115154798 14:30325901-30325923 AAAATAAATCAAAAACTTTCTGG + Intergenic
1116424284 14:44770515-44770537 ACATTAAAACAGAAACAAACCGG + Intergenic
1116649579 14:47572380-47572402 TGCTTAAATCAGAAATATTTGGG + Intronic
1116779872 14:49225162-49225184 TGATTAAATCAGGCCCATTCAGG + Intergenic
1117311030 14:54523266-54523288 AGATTAAATGACAATCATTCTGG - Intronic
1118417641 14:65559985-65560007 AGTGTAAATCAGTAACATTAAGG + Intronic
1118647468 14:67853330-67853352 AGGATAAATCAGAGACAATCAGG - Intronic
1119289423 14:73482982-73483004 AAATTAAAACAAAAACATTTAGG + Intronic
1121166223 14:91803934-91803956 AGATGAGATCAGGAGCATTCAGG + Intronic
1124041327 15:26107575-26107597 AAATTAAAACAGAAATATTTGGG + Intergenic
1124834142 15:33179430-33179452 AGATTGAGTCATAAAGATTCTGG - Intronic
1125078833 15:35652638-35652660 AGATGAAGTCAGAATTATTCAGG - Intergenic
1125257831 15:37786923-37786945 AAGTTAAATCAAATACATTCTGG - Intergenic
1125651812 15:41323348-41323370 AAAGTAAATCAAAAACCTTCTGG - Intronic
1126180833 15:45783638-45783660 AGATTTCATCAGGAATATTCTGG + Intergenic
1127109938 15:55658125-55658147 AGATGACATCAGGAGCATTCAGG + Intronic
1127453545 15:59138669-59138691 CATTTAAATCAGGAACATTCAGG + Intronic
1127762598 15:62153523-62153545 AGGTTAAATTAGAGTCATTCTGG - Intergenic
1127777509 15:62277658-62277680 AGAATAGAACAGAAACGTTCTGG + Intergenic
1129637619 15:77338193-77338215 AAATTAAATCTGAACCATACAGG - Intronic
1131872526 15:96776930-96776952 GGATGAAGTGAGAAACATTCTGG + Intergenic
1132001316 15:98182719-98182741 AAACAAAAGCAGAAACATTCAGG + Intergenic
1132901748 16:2259564-2259586 AGAATAAAGAAAAAACATTCAGG + Intronic
1133321381 16:4915736-4915758 AGATTGAGTCAGAAACAGTGAGG - Intronic
1133431112 16:5737501-5737523 AAATTAAAACAAAAATATTCTGG + Intergenic
1134806830 16:17133117-17133139 AAACTAAATCAGAAACTTTACGG + Intronic
1135036363 16:19080961-19080983 AGAATAAAGGAAAAACATTCAGG + Intergenic
1135176193 16:20231491-20231513 AAATTAAATCAGAATCACTCTGG + Intergenic
1136657542 16:31719419-31719441 AGTTAAAATCAGAAAAACTCTGG + Intronic
1138290013 16:55838922-55838944 AGATTACATTATAAACATCCAGG + Intergenic
1138412360 16:56850619-56850641 ACAGTAAGTCAGAAGCATTCTGG + Intergenic
1139071183 16:63385286-63385308 AGGTAAAATCTGAAACATACAGG + Intergenic
1141059802 16:80855654-80855676 AGATCAGATCATAGACATTCTGG - Intergenic
1142576151 17:909206-909228 AGATTAAACAAGAAACATCTTGG + Intronic
1143208780 17:5167435-5167457 ATGTTACATCAGTAACATTCTGG - Intronic
1143704799 17:8689382-8689404 AGATTAAATCAGATAAAGTTAGG - Intergenic
1144320370 17:14111846-14111868 AGATTACATCAGTAACATTAGGG - Intronic
1147679723 17:42233916-42233938 AGATTAGGGCAGAAACATTTGGG + Intronic
1149709389 17:58726742-58726764 AGATGAGATCAGGCACATTCAGG + Intronic
1149789505 17:59465030-59465052 AGAGTAAAGCAGGAACAGTCTGG - Intergenic
1152559939 17:81072906-81072928 GGATTAAATCAGTAAGATGCAGG - Intronic
1203159500 17_GL000205v2_random:36206-36228 AGATTACATCAGGAGTATTCTGG + Intergenic
1153476935 18:5507126-5507148 AGATAAAATAAGGAACATTAGGG - Intronic
1153677934 18:7472010-7472032 AGATAATATCAGAATCAGTCAGG - Intergenic
1153732861 18:8032658-8032680 AAATTGAAACAGAAGCATTCAGG + Intronic
1154064169 18:11091083-11091105 AAATTTAATAAGAAATATTCAGG + Intronic
1155139705 18:23033359-23033381 AGACAAAATCAGAAACTTTGGGG - Intergenic
1155276525 18:24193184-24193206 TGATAGAATCAGAAACATGCAGG + Intronic
1156175570 18:34541669-34541691 AGACTAATACAGGAACATTCAGG + Intronic
1156693871 18:39742495-39742517 GCCCTAAATCAGAAACATTCAGG - Intergenic
1156897106 18:42258323-42258345 AGTGTAAATCAGAATCATTAAGG - Intergenic
1157825066 18:50805130-50805152 TAAGTAAATCAGAAAAATTCTGG - Intronic
1159087964 18:63816075-63816097 ATTTTAAATCAACAACATTCAGG - Intergenic
1163139452 19:15336664-15336686 AGCTTAAAATAGATACATTCTGG - Intergenic
1164262662 19:23581667-23581689 CGTTTAAATCAGAAAAGTTCTGG + Intronic
1164335804 19:24319882-24319904 AAACTAAAAAAGAAACATTCTGG + Intergenic
1164466687 19:28492962-28492984 TGATTAAATCAGGAACAGGCAGG + Intergenic
1165330712 19:35139987-35140009 GGATTAAGTCAGAGACAGTCTGG - Intronic
1165530862 19:36399631-36399653 AAATTAAATTAGATACTTTCAGG - Intronic
1168450278 19:56461247-56461269 AGATTAAATCAGGAGCTGTCTGG - Intronic
925195831 2:1924826-1924848 TGAATGAATCAGAAACATTGTGG + Intronic
925507997 2:4590826-4590848 AGATTCCATCAGGAACTTTCAGG + Intergenic
926242687 2:11100660-11100682 AGGTGAAATCAGTATCATTCGGG + Intergenic
926565352 2:14463234-14463256 AGATTATATCAGCAAAATGCTGG + Intergenic
927176968 2:20416904-20416926 ACACTATTTCAGAAACATTCTGG - Intergenic
928818985 2:35337551-35337573 AAATTAAATCGAAAACTTTCTGG + Intergenic
929341890 2:40829759-40829781 AGATTACAGCAGAATGATTCTGG - Intergenic
929357299 2:41041242-41041264 ACATAAAATGAGAAACATCCTGG + Intergenic
929952353 2:46423425-46423447 AATTTAAATCTGAAACATGCTGG - Intergenic
935467388 2:103415267-103415289 AGATTAAATCAGGAAGAATTAGG + Intergenic
936908267 2:117562717-117562739 AGATTAAATAAGACCCAGTCTGG + Intergenic
937198625 2:120182054-120182076 AGATTAAAGCAGAAAGCATCAGG + Intergenic
937584530 2:123530515-123530537 AAATTAAAATAGAAACATTATGG + Intergenic
938008581 2:127810271-127810293 AAATCAAATCAGAAAAATACGGG - Intronic
938592535 2:132753392-132753414 AGTTTACATCAGAAACATATTGG - Intronic
939225254 2:139355970-139355992 AAATTAAATAAGCCACATTCTGG - Intergenic
939322395 2:140641035-140641057 ATATTAAATTTGAAACATTCAGG + Intronic
939539258 2:143473469-143473491 AGAGTAAAAGAGAAATATTCTGG - Intronic
939748599 2:146011035-146011057 AGTGTACATCAGAATCATTCAGG + Intergenic
940075361 2:149735464-149735486 AGAGTATAACAGAAACATTTTGG - Intergenic
940358961 2:152776816-152776838 ATAGTAAATCAGAATCCTTCAGG + Intergenic
940411713 2:153372029-153372051 TCACTAAATCAGAAACATACTGG - Intergenic
941321384 2:164059588-164059610 ATAATAAATGAGAAATATTCAGG - Intergenic
941355958 2:164491487-164491509 AAATTAAATCAGAAATACTCAGG + Intergenic
941377591 2:164750831-164750853 AGACATAATCAGAAACATTAAGG + Intronic
942036162 2:172012682-172012704 TGATTAAAGCAGTAACATTAAGG - Intronic
942077450 2:172369264-172369286 AAAGTAAATTAAAAACATTCTGG + Intergenic
942738388 2:179142683-179142705 TGGTGAAATCAGATACATTCTGG + Intronic
942918100 2:181336881-181336903 AGAATAAATTAAAAACAATCAGG + Intergenic
942985469 2:182135671-182135693 AAATTCAATCAAAAACAGTCAGG + Intergenic
943193603 2:184714201-184714223 AAAGTCATTCAGAAACATTCAGG + Intronic
943246927 2:185466212-185466234 AAAGTAAATTAAAAACATTCTGG - Intergenic
943585258 2:189731665-189731687 AGATTAAAAAAGAAACAGCCTGG - Intronic
944095252 2:195959298-195959320 AGAAGAAAGCAGAAGCATTCAGG - Intronic
944510332 2:200458544-200458566 AGATGTAATCAGCAAAATTCAGG + Intronic
945052459 2:205836919-205836941 ATATTAAATCAGAACCTTTTGGG - Intergenic
945452469 2:210009364-210009386 TGATAAAATCAGAAACCCTCAGG - Intronic
946091514 2:217228952-217228974 AAAGTAAATCAAAAACCTTCTGG - Intergenic
946721144 2:222609647-222609669 ACTCTAAATCAGACACATTCAGG - Intronic
946864750 2:224032727-224032749 AGATTAGATCAGGAACACCCAGG - Intronic
947309138 2:228781180-228781202 AGATTAAGTCAGATCCATCCAGG + Intergenic
1170208889 20:13828315-13828337 AAATTAAAACAAAAACAGTCCGG + Intergenic
1171326016 20:24293579-24293601 AGATTAAATGAGATACATAGGGG - Intergenic
1172066403 20:32223702-32223724 AGAATAAATGAGAAAGATTTGGG - Intronic
1173009452 20:39168503-39168525 AAATTAAAAAAGAAACATACTGG - Intergenic
1173459515 20:43231845-43231867 AGATTAAATGAGAAAATATCTGG + Intergenic
1173474010 20:43345771-43345793 AGTCTTAATCACAAACATTCGGG + Intergenic
1174868868 20:54164964-54164986 AGATAAAATCTGAAAAATTTTGG + Intronic
1177056692 21:16314051-16314073 GGATTAAACCAGAAGAATTCTGG - Intergenic
1177524595 21:22275281-22275303 AGATGAAATCTGAAAAATTTTGG - Intergenic
1178038871 21:28616901-28616923 ATATTAAATAAGAAACCATCAGG + Intergenic
1178054336 21:28782313-28782335 AGATATAAACAGAAACATTTTGG - Intergenic
1178114861 21:29406589-29406611 ATATTAAATCAGAAACAGCTTGG - Intronic
1178712232 21:34927968-34927990 AAATTAAATCAGAATCCTTGAGG + Intronic
1181448475 22:22999456-22999478 AGATAAAATCAGAAACAAAAAGG + Intergenic
1183834611 22:40441952-40441974 AGATTAAATCAAGACCATTCTGG - Intronic
949366763 3:3290267-3290289 AGGTAAAAGCAGAACCATTCCGG + Intergenic
949911419 3:8912008-8912030 GGATTAAAATGGAAACATTCGGG - Intronic
951514520 3:23544089-23544111 AGACTAAACCATAAAAATTCTGG + Intronic
952152022 3:30603988-30604010 AGATTAAATCAGAAATGTTAAGG + Intergenic
952205522 3:31178218-31178240 AGTTTGAATCCGAAACAATCTGG + Intergenic
952515555 3:34101172-34101194 AAAGTAAATCAAAAACCTTCTGG - Intergenic
952576576 3:34781398-34781420 ATATTAATTCAGAACAATTCAGG + Intergenic
952783969 3:37133952-37133974 AGAAAAATTCAGAAAAATTCAGG + Intronic
953142552 3:40242426-40242448 AGAGTAAAACATGAACATTCTGG + Intronic
953161200 3:40421417-40421439 AAATTGAATCAACAACATTCAGG + Intronic
953366865 3:42352647-42352669 AGGTTAAAGCAGAGCCATTCAGG + Intergenic
954913657 3:54130791-54130813 GGATTAAATGAGAAACATCTGGG + Intronic
955922704 3:63974227-63974249 AGATGAAATCGAAAACAATCTGG + Intronic
956240474 3:67124331-67124353 AGACTAAATTGGAAACTTTCTGG + Intergenic
956940153 3:74150463-74150485 AGCTGAAGTCAGAAACATTTGGG - Intergenic
956979569 3:74619985-74620007 AGAGTACATCACAAACATTGGGG - Intergenic
957036005 3:75293664-75293686 AGTTAAAATGAAAAACATTCAGG - Intergenic
957259534 3:77881997-77882019 AGCATAAATCAGAAATATTATGG - Intergenic
957414811 3:79887773-79887795 AGATTAAAACAGCCAAATTCGGG - Intergenic
957792956 3:84961968-84961990 AGATTCCATCAGCAGCATTCAGG + Intronic
957805541 3:85143810-85143832 ATATGCAATCAGAAATATTCTGG - Intronic
959046045 3:101474881-101474903 AGTTTAAACCAGTTACATTCAGG - Intronic
959458829 3:106598447-106598469 AGATTAAAAAAGACACATTATGG - Intergenic
961079736 3:124016059-124016081 AGTTAAAATGAAAAACATTCAGG - Intergenic
961304024 3:125943048-125943070 AGTTAAAATGAAAAACATTCAGG + Intergenic
962336448 3:134535825-134535847 ACATTACAGCAGAATCATTCTGG - Intronic
963415218 3:144986239-144986261 AGATTAAAGAAGAAACAATATGG - Intergenic
963455748 3:145544436-145544458 AGATTAAATCAGAAAGAAATAGG - Intergenic
963497841 3:146090577-146090599 AGCTTCATTCAGAAATATTCTGG + Intronic
964029363 3:152118649-152118671 AGATTAAAGCAGGAAAAGTCTGG + Intergenic
964035386 3:152189520-152189542 AAAGTAAATCAAAAACCTTCTGG + Intergenic
964061434 3:152529075-152529097 AAATTAAATTAAAAACCTTCTGG - Intergenic
964120776 3:153180785-153180807 AGACTTAATCAGAAACACTGAGG + Intergenic
964510248 3:157442302-157442324 AAATTAATTCAGAATTATTCTGG - Intronic
965655621 3:170981193-170981215 ATATCAAATCTGAAACACTCTGG - Intergenic
966133156 3:176667311-176667333 TGATTAAATCAGAATAATTAGGG + Intergenic
967786124 3:193498606-193498628 AAATTAAATCAGAATCCTTAAGG - Intronic
970032926 4:11698158-11698180 AGATTAAATTAGAAACAGAGAGG - Intergenic
971742830 4:30541749-30541771 ATATTAAATGAGTAACATTTAGG - Intergenic
971829528 4:31672624-31672646 ACATTAAATCAAAAACTTTGTGG - Intergenic
972308317 4:37853825-37853847 AGATTAAATCAGAAACATTCAGG - Intronic
972600165 4:40565153-40565175 GGATCAAATCAGAAACACTGTGG - Intronic
973123486 4:46553781-46553803 ACATTAACTCAGAACCATACGGG + Intergenic
973825683 4:54704413-54704435 AGATTATAGCATAAACCTTCAGG + Intronic
975151330 4:71024417-71024439 ACATTTAATCAGAAGCTTTCTGG + Intronic
976038017 4:80847703-80847725 AAATTAAATGAGAAAATTTCTGG + Intronic
976147606 4:82057487-82057509 AGTTTAAATTAGAAACAATATGG - Intergenic
976234891 4:82886525-82886547 AGATTAAACAAGAAAACTTCAGG + Intronic
976907646 4:90260167-90260189 AGATTAAATCAGGAAGAAACAGG - Intronic
977256830 4:94750076-94750098 AGAATAAACCCGTAACATTCTGG - Intergenic
977716244 4:100187107-100187129 AGAGTAAATGAGAAATATTACGG - Exonic
978113434 4:104990666-104990688 ATAATAAATCAGCAACTTTCAGG + Intergenic
978316664 4:107445338-107445360 AGCTTAAATCAGAAAGAATTAGG - Intergenic
978445292 4:108774589-108774611 AGAGTAAAACAGAAACAGACGGG - Intergenic
979893023 4:126123274-126123296 AAATTAAACCAGAAACCTACTGG - Intergenic
980211636 4:129795876-129795898 AGATTAAAGCAGAGACTTTGTGG + Intergenic
981656663 4:147119656-147119678 ATATTAAAACATAACCATTCAGG + Intergenic
982039559 4:151382998-151383020 ACATTGAATTAGAAACATTTTGG - Intergenic
982209235 4:153021406-153021428 AGACTGAATTAGAAACCTTCCGG + Intergenic
982710202 4:158750245-158750267 AACTTAAATCGGTAACATTCAGG + Intergenic
982887915 4:160806812-160806834 AGATGGAATCAGAAATATTTTGG + Intergenic
982906369 4:161079608-161079630 AGATGTAATCAGTAACATTGGGG - Intergenic
983013013 4:162572879-162572901 ATATTAAATCACAGACATCCTGG + Intergenic
983310416 4:166053256-166053278 AGATTATATCAGGAAACTTCAGG + Intronic
983483266 4:168301887-168301909 AGATTAATTCAGTGACATTCTGG + Intronic
984340535 4:178451070-178451092 AGATTAAAGGAGAAACATATGGG - Intergenic
984807008 4:183760243-183760265 CCATTAAATCAGAAACATTATGG + Intergenic
984823051 4:183900390-183900412 AGAATAAATTGGAAACTTTCTGG + Intronic
984898834 4:184566237-184566259 AAAGTAAATTAGAAACCTTCTGG - Intergenic
987171752 5:15266714-15266736 CAATTAAATCAGAATCATTTGGG - Intergenic
987439302 5:17936179-17936201 AGATTGAATCAGAAAGATATAGG + Intergenic
988219197 5:28319439-28319461 GGATAAAAACAGAAAGATTCCGG - Intergenic
988264584 5:28930839-28930861 TGATAACATCAGATACATTCTGG - Intergenic
988710598 5:33770554-33770576 ATATAAACTCAGAAAAATTCAGG + Intronic
988964470 5:36402505-36402527 AGATGCACTCAGAAACATCCGGG + Intergenic
990026346 5:51195371-51195393 CAATTAAATTAGAAATATTCTGG + Intergenic
991267263 5:64736128-64736150 ACATTAAATTATAAACATTTGGG + Intronic
991308692 5:65210723-65210745 ACATGTAATCTGAAACATTCTGG - Intronic
991439441 5:66631356-66631378 GTATTAAATGAAAAACATTCTGG + Intronic
992146010 5:73848848-73848870 AGATCATATCAGAAATGTTCAGG + Intronic
993096363 5:83483470-83483492 AAAGTAAATCACAAGCATTCAGG - Intronic
993299320 5:86187503-86187525 ATATGAAATCAGAGGCATTCAGG + Intergenic
993738752 5:91509504-91509526 ATATGTAATCAGAAACAATCAGG + Intergenic
994596166 5:101838668-101838690 GGATTAATTCATAAACATCCAGG - Intergenic
994768162 5:103948432-103948454 ACAGTAATTCACAAACATTCAGG + Intergenic
994815326 5:104579201-104579223 ATTTTAAATCAGTAACATGCAGG + Intergenic
994912458 5:105929196-105929218 AGATTAAATTAAAAACAGTGTGG - Intergenic
996317796 5:122180400-122180422 TGATTAAATGTGAAAAATTCTGG - Intergenic
996636527 5:125695989-125696011 TGAACAAAGCAGAAACATTCTGG + Intergenic
996652748 5:125900605-125900627 AGATACAAGCAGAAATATTCAGG - Intergenic
997000725 5:129757260-129757282 ATATAAAATCAGAAACAGACTGG + Intronic
998048709 5:139012346-139012368 AGATGAGATCAGGCACATTCAGG - Intronic
998683045 5:144492104-144492126 AGATTAAATCAGGAAGAAACAGG + Intergenic
999042034 5:148425090-148425112 AGATGAACTCAGAAACATATGGG - Intronic
999504681 5:152182484-152182506 AGATAAAAAGAGTAACATTCAGG + Intergenic
999660883 5:153861691-153861713 AGATCAAAGCAGAGTCATTCTGG - Intergenic
999958863 5:156732548-156732570 AGAAAAAAACAGAAACCTTCAGG - Intronic
1000538482 5:162509427-162509449 AGTTAAACTCAGCAACATTCAGG + Intergenic
1003349115 6:5299231-5299253 AGTCTAAATGAGAAACCTTCAGG - Intronic
1004662394 6:17721865-17721887 AGATGAGATCAGGCACATTCAGG + Intergenic
1004899695 6:20182726-20182748 GGGGTAAATCAGAACCATTCAGG + Intronic
1005204404 6:23384598-23384620 AGTTTAGATCAGAAACTCTCAGG - Intergenic
1005215488 6:23522782-23522804 ACATTAAATAAGAAATATTTTGG + Intergenic
1005518935 6:26581348-26581370 ACATTCATTTAGAAACATTCTGG + Intergenic
1009431120 6:63567226-63567248 AAAGTAAACCAAAAACATTCTGG - Intronic
1010049504 6:71485806-71485828 AGATGACTTCAGAAACAATCAGG - Intergenic
1011224208 6:85089075-85089097 AGATTAGATCTGAAACAGTGTGG - Intergenic
1011588720 6:88950466-88950488 AAAATAAATCAAAAACTTTCTGG + Intronic
1012127533 6:95449677-95449699 AGCTGAACTCAGAAATATTCTGG - Intergenic
1012575025 6:100784640-100784662 ATATTAATACAAAAACATTCTGG + Intronic
1013434538 6:110089090-110089112 AGGTTGAATCAGAAACAGACAGG + Intergenic
1014677237 6:124382353-124382375 AAATGAAATCAGCAACAGTCAGG + Intronic
1015825437 6:137306026-137306048 AGATGAGATCAGGCACATTCAGG - Intergenic
1015854736 6:137611399-137611421 AGATTCCATCAGAAAAACTCTGG + Intergenic
1016232632 6:141824833-141824855 ATATTAAATCAAAAAGATTTTGG + Intergenic
1016367036 6:143330543-143330565 AGATTAAATCAGAAAAGTGCGGG + Intronic
1016607615 6:145950201-145950223 AGATTACATCAGAGACAATTAGG - Intronic
1016925545 6:149343005-149343027 AAGTTAAATTAGAAATATTCAGG - Intronic
1017585749 6:155920821-155920843 AGACTGAATCAGAAAAAATCAGG - Intergenic
1017940807 6:159051170-159051192 AGTCTAAATCAGAACCAGTCTGG - Intergenic
1018570318 6:165203400-165203422 AGAGTAAATCAGCGCCATTCAGG + Intergenic
1018572310 6:165224570-165224592 AGCTTTATTCAGAAACTTTCTGG + Intergenic
1018993934 6:168696170-168696192 TGATTATATGAGAAACATTTTGG + Intergenic
1019125428 6:169837546-169837568 GGATTAAAACACAAACATTTTGG - Intergenic
1020549481 7:9584233-9584255 AGATGATTTCAGGAACATTCAGG - Intergenic
1022026274 7:26450714-26450736 AAATTAAAGGAGAAACATTTAGG - Intergenic
1022291406 7:29007551-29007573 AGAAAAAATGAGAAATATTCTGG - Intronic
1022451026 7:30514990-30515012 ATATGAAATCAGAAATGTTCTGG + Intronic
1022470187 7:30677274-30677296 AGAGAAAATCAGAAACAGACAGG + Intronic
1022544516 7:31173655-31173677 ATATTCTAGCAGAAACATTCTGG + Intergenic
1023319996 7:38985441-38985463 AGATTCAAGCTGGAACATTCTGG - Intronic
1025029348 7:55544235-55544257 AGATTAACACAGAAGCATGCTGG - Intronic
1026118416 7:67515701-67515723 AGATTGAATCAGAAATTATCAGG + Intergenic
1026506750 7:70991121-70991143 AGGTGAAATCAGAAACACTTTGG + Intergenic
1026609400 7:71844292-71844314 AGATTAAATCAGAAAAAATTGGG - Intronic
1028602075 7:92612625-92612647 AAATTAAAGCACAAACATTCTGG - Exonic
1028722070 7:94044712-94044734 AGATTAAATCAGTCCCATCCTGG - Intergenic
1030778798 7:113571765-113571787 GGATTAACTCTGAAACATTCTGG + Intergenic
1030823704 7:114127841-114127863 ACATTAAATAAGGAATATTCTGG - Intronic
1030909823 7:115233362-115233384 AGATTAAAGCAAAAACAATGTGG - Intergenic
1031711404 7:125050651-125050673 AGAATTAATCAGAACCATTAAGG - Intergenic
1032328805 7:130958049-130958071 AGATTAAATCAGAAATACAAAGG - Intergenic
1036019426 8:4827302-4827324 AGATAAAATGAAAACCATTCTGG - Intronic
1036392179 8:8333082-8333104 AGACTAACTCAGACACATCCTGG + Intronic
1037650359 8:20832062-20832084 AGATTAAATCAAAGTCGTTCTGG - Intergenic
1038466337 8:27767786-27767808 AAAATAAATCTGAAGCATTCAGG + Intronic
1040475358 8:47771842-47771864 AGCTTAAATCGGAAACTTCCTGG + Intergenic
1040517429 8:48146149-48146171 AGATCAAAGAAGAAACATGCCGG - Intergenic
1041444512 8:57935250-57935272 AAATTAAATCACAAAACTTCTGG - Intergenic
1041450660 8:58003435-58003457 AAAGTAAATCAAAAACCTTCTGG - Intronic
1041707072 8:60857925-60857947 TAATTAAAACAGAAGCATTCAGG + Intronic
1042653943 8:71074187-71074209 AGATTAAATTGGACACATTTAGG + Intergenic
1043678249 8:82988733-82988755 AACTGAAATCTGAAACATTCTGG - Intergenic
1044121059 8:88396512-88396534 AGATGAGATCAGGAACATTCAGG + Intergenic
1045458048 8:102401387-102401409 TCATGAAACCAGAAACATTCAGG + Intronic
1045867640 8:106886591-106886613 AGTTTAAATGAGAAACATCAAGG - Intergenic
1046601348 8:116320557-116320579 ATATGGAATCAGAAACGTTCAGG - Intergenic
1046676808 8:117118113-117118135 AATTTAACTCAGAAACATTTTGG + Intronic
1047093157 8:121595658-121595680 ACATTAAATGAGAAACCTTTTGG + Intergenic
1050367089 9:4882548-4882570 AGATTAAAACTGACACATACTGG - Intronic
1051002475 9:12301494-12301516 AGAATGAATCAGAAATATACTGG + Intergenic
1051190727 9:14509206-14509228 GGAATAAATCAGACACTTTCTGG + Intergenic
1051846128 9:21453121-21453143 AGATTAAAATAGAAACTTTTGGG + Intergenic
1053319897 9:37087630-37087652 AGACTTAATCAGACATATTCTGG + Intergenic
1054989471 9:71306192-71306214 AGATGAAAAAAGAAACATTTTGG + Intronic
1055057455 9:72037012-72037034 AGATAAAATGAAAAAGATTCAGG + Intergenic
1055185665 9:73450426-73450448 AGATTAAAAAAAAAAAATTCTGG - Intergenic
1056114076 9:83425159-83425181 AGATTAAATAATGAACATACTGG - Intronic
1057113606 9:92499246-92499268 AAAATAAAGCAAAAACATTCAGG + Intronic
1057940003 9:99273600-99273622 ACATTCAATCAGGAACATGCTGG - Intergenic
1058682570 9:107452920-107452942 AGAATAAATCAGAAATTCTCAGG + Intergenic
1059554538 9:115266125-115266147 AGATAAAATTAGAACCACTCTGG - Intronic
1060350752 9:122857322-122857344 AGATTAAATTAAAATCATCCTGG + Intronic
1188410492 X:29866188-29866210 AGATTTAATCAGTCACATTTTGG - Intronic
1189072530 X:37879184-37879206 AAAGTAAATCAAAAACTTTCTGG + Intronic
1189923183 X:45923885-45923907 AAAATAAATCAAAAACCTTCTGG + Intergenic
1190796275 X:53746124-53746146 AGATGAAATCAGGTGCATTCAGG + Intergenic
1190828441 X:54039636-54039658 TGATTAAAACAAAAACATTATGG - Intronic
1191671964 X:63756048-63756070 AGAGTAAATTTGAAACCTTCTGG - Intronic
1192591606 X:72364695-72364717 TGATGAAATCAGGAACGTTCAGG - Intronic
1193548801 X:82863130-82863152 AGACTTATTCAGACACATTCTGG - Intergenic
1197279039 X:124513708-124513730 AGATTTAATCATAAATATTAAGG + Intronic
1200945571 Y:8832194-8832216 AGATGATACCAGAAATATTCAGG - Intergenic
1201367699 Y:13226643-13226665 AGAATAATTCAGAAAAACTCAGG - Intergenic