ID: 972308318

View in Genome Browser
Species Human (GRCh38)
Location 4:37853848-37853870
Sequence AGGAGATGGTTTAAATTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972308318_972308324 9 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308324 4:37853880-37853902 GAGAAGAGGTGGTTCTGTGACGG 0: 1
1: 0
2: 1
3: 29
4: 297
972308318_972308321 -5 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308321 4:37853866-37853888 CTCCTGCAGAAATGGAGAAGAGG No data
972308318_972308323 -2 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308318_972308329 27 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308329 4:37853898-37853920 GACGGTGTGGGCTCAGGGCAAGG No data
972308318_972308325 14 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308325 4:37853885-37853907 GAGGTGGTTCTGTGACGGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 114
972308318_972308326 15 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308326 4:37853886-37853908 AGGTGGTTCTGTGACGGTGTGGG 0: 1
1: 0
2: 0
3: 6
4: 124
972308318_972308328 22 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308328 4:37853893-37853915 TCTGTGACGGTGTGGGCTCAGGG No data
972308318_972308327 21 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308327 4:37853892-37853914 TTCTGTGACGGTGTGGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972308318 Original CRISPR AGGAGATGGTTTAAATTCTC TGG (reversed) Intronic
904621328 1:31777079-31777101 AGGAGAATGTTTAAATTTCCTGG - Intergenic
906553262 1:46684578-46684600 AGAAGATAGTTCAAATTCTCAGG - Exonic
907731959 1:57075256-57075278 TGGAGATGTTTTAATTTATCTGG + Intronic
908145127 1:61233597-61233619 AGGAGGTGGTTGAAATCCTGGGG + Intronic
908627408 1:66059898-66059920 AGAAATTGTTTTAAATTCTCAGG - Intronic
909180705 1:72420279-72420301 AGGAAAAGGTTTAAGTTCTGAGG + Intergenic
909536870 1:76746845-76746867 AAGATATGTTTCAAATTCTCAGG + Intergenic
909617819 1:77632287-77632309 AGGAGATGGTTCAGGTTCTCCGG + Exonic
910729916 1:90383945-90383967 AAAAGATGGCTGAAATTCTCAGG - Intergenic
911031080 1:93488953-93488975 AGGAGATGGTGTAAATTTAAAGG + Intronic
917591104 1:176477930-176477952 TGGAAATAGTTTAACTTCTCTGG - Intronic
918895639 1:190340501-190340523 AGGAGATAGTTTAATATCTCTGG + Intronic
920764675 1:208820648-208820670 AGGTGATGGTTTTATTTCTCTGG + Intergenic
920793181 1:209112163-209112185 AGGAGATGCTCTAAATGCTTAGG - Intergenic
922319793 1:224476563-224476585 AGGAAATGGGTTAAATACTTAGG + Intronic
922789307 1:228301954-228301976 AGGCTATGGTTTCAATTCTTTGG + Intronic
1063246296 10:4223037-4223059 AGGAGAAGCTTTGAATCCTCAGG + Intergenic
1063524956 10:6776555-6776577 AGGAAATGGAAGAAATTCTCAGG - Intergenic
1064354641 10:14605663-14605685 AGGAGTTTCTTTAAGTTCTCTGG - Intronic
1064837408 10:19549041-19549063 TGGAGAAGGTTTAAATGGTCTGG + Intronic
1065643512 10:27809856-27809878 ATGAAATGCTTTAAATTATCTGG + Intergenic
1066211685 10:33246249-33246271 TAGAGATGGATTAAATTCTAAGG - Intronic
1066306864 10:34153691-34153713 AATAGATGCTTAAAATTCTCTGG - Intronic
1066667363 10:37797966-37797988 AAAATATGGTTTTAATTCTCTGG - Intronic
1069424437 10:68277430-68277452 AGGAGATGATTTAGAGTATCTGG + Intergenic
1073671416 10:105594289-105594311 AATAGATGATTTAAATTTTCAGG - Intergenic
1074253937 10:111781772-111781794 GGGCGATTGTTTAACTTCTCTGG + Intergenic
1074328511 10:112478494-112478516 AGAAGAGGGTTTACATTTTCAGG - Intronic
1077894551 11:6443828-6443850 AAGAGATGGTTGAATTTCTCTGG - Intergenic
1078650808 11:13190505-13190527 AGGAGATGTTCTAAATGCTGGGG - Intergenic
1078721872 11:13892228-13892250 AGGAGATGGATTAAAATCTTTGG + Intergenic
1081164799 11:39794473-39794495 ATGAGATAGTTAAAATTCCCTGG - Intergenic
1083600375 11:63943652-63943674 AGGTTATGGTTTCAATTATCAGG - Intronic
1084804432 11:71569186-71569208 AGGAGAGGGTTTAGAATGTCAGG - Intergenic
1084992107 11:72936217-72936239 GGGAGATAGATGAAATTCTCTGG - Intronic
1085696442 11:78708759-78708781 AGGGGATAGATTAAAATCTCAGG - Intronic
1085701993 11:78753943-78753965 AGCAGGTGATTTAACTTCTCTGG + Intronic
1087305153 11:96480648-96480670 ACAAAATGGTTTAATTTCTCAGG - Intronic
1089918271 11:122180990-122181012 AGCAGATTTTTAAAATTCTCTGG + Intergenic
1091117764 11:133030738-133030760 TGGAGATGATTTCAATGCTCTGG + Intronic
1091585981 12:1817201-1817223 AGGAGATGGGTTGAGATCTCTGG - Intronic
1092005196 12:5063556-5063578 AAGTGATGGTTTACCTTCTCAGG + Intergenic
1092824732 12:12388247-12388269 AGGATGTGGTTTAAAGTCTCAGG - Intronic
1092935992 12:13365247-13365269 AGGTGATGGTTGAGATTCTTAGG + Intergenic
1095160928 12:38914236-38914258 TGGTGATGGTTTAAACCCTCTGG + Intergenic
1095214054 12:39527463-39527485 GGGAGATGATTTAAAGTATCTGG - Intergenic
1095307007 12:40650797-40650819 AGCAGATGGTTAAAATCCTAGGG - Intergenic
1098765987 12:74489475-74489497 AGGAGATGGTATAATATTTCTGG + Intergenic
1098766025 12:74489908-74489930 AGGAGATGGTATAATATTTCTGG - Intergenic
1100185966 12:92140395-92140417 AGGAAATGGTATCAATCCTCAGG + Exonic
1100383257 12:94082104-94082126 AGGATATGGTTGAAATTATAAGG - Intergenic
1101713331 12:107288785-107288807 AGAAGGTCATTTAAATTCTCTGG - Intergenic
1104653003 12:130550745-130550767 AGGTGATGTATTAAGTTCTCTGG + Intronic
1105039477 12:132950296-132950318 AGCAGAGGGATTAAATACTCAGG - Intronic
1105533339 13:21240790-21240812 TGATGATGGTTTAAAATCTCAGG - Intergenic
1107605757 13:42054509-42054531 AGTAAATAGTTTAAATTCTGTGG + Intronic
1109042952 13:57365034-57365056 AGGTGATGGTTTGAAGTTTCTGG + Intergenic
1109533011 13:63677736-63677758 TGGAGATAGTTTTAGTTCTCTGG - Intergenic
1110156124 13:72318973-72318995 GGGATAGTGTTTAAATTCTCAGG - Intergenic
1110821208 13:79919014-79919036 GGGAGAGAGTTTAAATTCTCTGG - Intergenic
1113088470 13:106592714-106592736 TGGAGATGGTTTAAATAATGGGG - Intergenic
1113114466 13:106860603-106860625 AGGAAATTATTTAAATTCTTAGG - Intergenic
1115232187 14:31172894-31172916 AGGAGATCTTATAAATTCTAAGG - Intronic
1115903556 14:38181944-38181966 TGGACATGGTTTTAACTCTCAGG - Intergenic
1120881922 14:89420226-89420248 ATGACATAGTTTAACTTCTCAGG + Intronic
1123687713 15:22811093-22811115 AGGAGCTGTTTTAATTTCTTCGG - Intronic
1127413301 15:58731310-58731332 TGGAGATGGTTTAAAGTATATGG + Intronic
1130367819 15:83256271-83256293 AGGAGATGGTTTCATTCCACAGG + Exonic
1130881841 15:88062096-88062118 TAGAGATGATTTAAAGTCTCCGG + Intronic
1131793036 15:95985478-95985500 TGGAGATGGATTAACTTCTCTGG - Intergenic
1136411325 16:30079078-30079100 AGGGGCTGGCATAAATTCTCAGG + Intronic
1136665767 16:31811101-31811123 AGGAGGTGGGGTAAATGCTCTGG - Intergenic
1138228143 16:55316574-55316596 AGGAAATAGTTTATGTTCTCCGG + Intergenic
1140627420 16:76810929-76810951 AGGAGATGTGATAAATTATCAGG - Intergenic
1141787066 16:86208533-86208555 AGGAGATGGTTTAAATAAGCAGG - Intergenic
1141861563 16:86720222-86720244 GTGTCATGGTTTAAATTCTCAGG - Intergenic
1150370619 17:64634419-64634441 AGGAAATGGTTTAAAGTCAGTGG - Intronic
1150477543 17:65486440-65486462 AGGAGGTTGTTTAAAATCTCTGG - Intergenic
1150477624 17:65486926-65486948 AGGAGGTTGTTTAAAATCTCTGG - Intergenic
1151854567 17:76711421-76711443 AGGAGTTGCTTTTAATCCTCAGG + Intergenic
1154136009 18:11778830-11778852 CAGAGAAGGGTTAAATTCTCTGG - Intronic
1155014740 18:21822408-21822430 AGGTGCTGTTTTAAATTTTCAGG - Intronic
1155250396 18:23948290-23948312 ATGAGATGGTTTATACCCTCAGG - Intronic
1155716745 18:28953071-28953093 AAGAGATGTTTTAAAGTATCTGG - Intergenic
1155730597 18:29152937-29152959 CGGAGATGGTTTAAAATTTCTGG - Intergenic
1155848595 18:30741383-30741405 AGGAGATTGTTTAAGTGATCAGG - Intergenic
1156151603 18:34249978-34250000 AGGCTTTGGTTTACATTCTCTGG + Intergenic
1157426152 18:47585984-47586006 AGGACATGGTTTGTATCCTCAGG - Intergenic
1157992904 18:52518962-52518984 AGGACATGGTTAGCATTCTCTGG - Intronic
1159841950 18:73408497-73408519 AGGGGATGCTTTATATTCTAAGG + Intergenic
1161154654 19:2726438-2726460 AGGAGATGATTTTAGTTCTGTGG - Intronic
1162969045 19:14169306-14169328 AGCAAATGATTTAATTTCTCTGG - Intronic
1164833764 19:31343307-31343329 AGGAGATGGTTAAAATGTCCAGG + Intronic
1167868538 19:52348263-52348285 AAGAGATGATTTAAAGTCTACGG - Intronic
1168600462 19:57713937-57713959 AGAAGAACATTTAAATTCTCTGG - Intronic
926500164 2:13643556-13643578 AAGAGATGATTTAGATTATCTGG + Intergenic
929272655 2:39989944-39989966 AGTAAATCGTTTAATTTCTCTGG - Intergenic
929429254 2:41872767-41872789 AGGATGTGGTTTCATTTCTCAGG - Intergenic
931923651 2:67047599-67047621 AGAATTTGGTTTAAATTTTCTGG + Intergenic
932389875 2:71377773-71377795 AGGACATCATTTAAATTCTGAGG + Intronic
934655359 2:96114529-96114551 TGGAGGTGGTTCAAATCCTCTGG - Exonic
935023302 2:99252611-99252633 AAGGGATTGTTTAAATTATCTGG + Intronic
936654743 2:114472071-114472093 AGGAGACTGTTTAAATGCTGGGG + Intronic
937235412 2:120429067-120429089 AGGAGCTGGTGCAACTTCTCTGG - Intergenic
938135839 2:128755807-128755829 CGGAGATGGTTAAAATCTTCTGG - Intergenic
940083241 2:149828599-149828621 AGGAGATGATTACAATTGTCAGG - Intergenic
941528597 2:166636599-166636621 AGGAGATGATATAAACTCTGAGG - Intergenic
943459419 2:188152895-188152917 AGCAGGTGGGTTAAATTATCAGG + Intergenic
945035921 2:205703946-205703968 AGGAGATGGTGGAAGTTGTCTGG - Intronic
946559835 2:220900118-220900140 AGGACATGGTTTAGATTTTCAGG - Intergenic
946963310 2:225008501-225008523 AGAAGATATTTTAAATTCTGAGG - Intronic
1169616358 20:7450666-7450688 AGGAGTTGATTTTAATTCTCAGG + Intergenic
1170222949 20:13960819-13960841 AGGAGATTTTTTAAAGCCTCAGG - Intronic
1170275113 20:14577142-14577164 AGGTGATGGTTTTAAATCTAAGG + Intronic
1170544154 20:17419103-17419125 AGATGATGGTTTAAAGTGTCAGG - Intronic
1172136081 20:32687817-32687839 AAGAGATGGATTTAAGTCTCAGG + Intergenic
1172773497 20:37394711-37394733 AGGGGATGGTCTTCATTCTCTGG - Intronic
1174375881 20:50126363-50126385 AGGAGATGGGTTAACTACTTAGG - Intronic
1178362566 21:31961380-31961402 AGAATATGGTTTCATTTCTCTGG + Intronic
1179368002 21:40776668-40776690 AGGTGAAGGTGGAAATTCTCTGG + Intronic
1182376077 22:29849064-29849086 GGGACATGGTTTAAATTCAGAGG + Intergenic
1183142818 22:35959913-35959935 TGGAGATGATTTAAAATCTCTGG - Intronic
1183315391 22:37134245-37134267 AGGAGATGACCTAAAGTCTCTGG + Intronic
1183469471 22:37997903-37997925 AGGAGATGGTACAAATCCTGCGG - Intronic
949669369 3:6380774-6380796 GGGATATGGTTCAAATTCTCTGG - Intergenic
950826235 3:15824795-15824817 AGGAGTTGGTTTAAACTCATTGG + Intronic
951154441 3:19332502-19332524 AGGACATGCTTTCATTTCTCTGG + Intronic
952651302 3:35730014-35730036 AGGAGCTGGCTGAAATTCTAAGG - Intronic
960464073 3:117973987-117974009 AAGAGATGTTTTAAATTATATGG + Intergenic
960555515 3:119025073-119025095 TGGAGATAGTTTTAATTCTGAGG + Intronic
961424954 3:126837854-126837876 AGGAGACGGTGGAAATGCTCAGG - Intronic
962715721 3:138124494-138124516 AGGAGATGGGGTAAAATCTTTGG + Exonic
964201802 3:154125591-154125613 AGGAGATGCTTTACATTCCCTGG + Intronic
964424680 3:156539614-156539636 GGGGGTTGGTTTAAATTTTCAGG - Intergenic
965948390 3:174271405-174271427 AGGAGCTAATTTAAATTGTCAGG - Intronic
966340219 3:178917242-178917264 TGGAGATGTTTTATATTCCCAGG - Intergenic
966439395 3:179927001-179927023 AGCAAATTGTTTAAACTCTCTGG + Intronic
972308318 4:37853848-37853870 AGGAGATGGTTTAAATTCTCTGG - Intronic
972797737 4:42438803-42438825 ATGACCTGGGTTAAATTCTCTGG + Intronic
972990534 4:44818322-44818344 GGGAGATCTTTTAAATTCTAGGG - Intergenic
975499092 4:75065409-75065431 TAGAGATGGTTTAGTTTCTCTGG + Intergenic
981674317 4:147323625-147323647 AGGAGATGGTATTAAGTGTCTGG - Intergenic
982065016 4:151646701-151646723 AAGAGAGGGATTATATTCTCTGG + Exonic
984306077 4:177993506-177993528 AAGAGATGATTTAAAATCTACGG + Intergenic
984331958 4:178333364-178333386 AGCACATGGTTTCATTTCTCTGG + Intergenic
985353282 4:189089984-189090006 AGGAGATGCTGTAAAATCACTGG - Intergenic
985425353 4:189825123-189825145 AGGACATGGCATAAATTCTGTGG + Intergenic
988325512 5:29761601-29761623 AGGAGATGTTTTAAATGTTATGG + Intergenic
988948754 5:36236368-36236390 AGAAAATGTTTTAAATTCTGTGG - Intronic
990343202 5:54845545-54845567 AGGAAATGTTTTAATTTGTCAGG + Intergenic
991948552 5:71925709-71925731 AGGAGATTGTTTGCATTCCCGGG - Intergenic
995033493 5:107507224-107507246 AGGTGATCATTTAACTTCTCTGG - Intronic
995920753 5:117308082-117308104 AGCAAGTTGTTTAAATTCTCTGG + Intergenic
998533970 5:142911915-142911937 AGGAGACAGTTTATATTCACAGG - Intronic
998602716 5:143601616-143601638 TGGAGAAAGTTTAAGTTCTCCGG + Intergenic
999747139 5:154600927-154600949 GGAAGATGGTTTATATTCTGTGG - Intergenic
1000640464 5:163696370-163696392 AGGAGATGGACTGTATTCTCCGG + Intergenic
1000833839 5:166132566-166132588 AGGAGATCCTGTAAATTCTGAGG + Intergenic
1001918672 5:175583265-175583287 AGTAGATTTCTTAAATTCTCAGG - Intergenic
1005327219 6:24714399-24714421 AGGAGATGGATTTCATTCTTTGG - Exonic
1005591435 6:27332249-27332271 AGGAGGTGGTTTGAATTCCATGG + Intergenic
1006672903 6:35740811-35740833 AGTAGATGGTTTCTATTCTGTGG + Intronic
1007783520 6:44267391-44267413 AGGAGATGCTTCAATTTCCCAGG - Intergenic
1009460551 6:63907567-63907589 AGGAGATAGTTTAAAATATTTGG - Intronic
1009826019 6:68866831-68866853 AGGAGATGATTTAGAGTATCGGG + Intronic
1010011625 6:71054152-71054174 ATGATAGGGTTGAAATTCTCAGG + Intergenic
1012661753 6:101906424-101906446 AGTAAATGGTTTTAAGTCTCTGG - Intronic
1013704000 6:112810730-112810752 AGGAGATGGAGTAAACTTTCTGG - Intergenic
1014498054 6:122152098-122152120 AGGAAATGAATTAAATACTCAGG + Intergenic
1015490011 6:133814420-133814442 ATGGGGTGGTTTAGATTCTCAGG - Intergenic
1019568100 7:1694601-1694623 AGGAGATGGTTTCCTGTCTCAGG - Intronic
1021635100 7:22684166-22684188 AGGGAAGGGTTTAAATTCTAAGG + Intergenic
1022920902 7:35013376-35013398 AGGAGAGGGCTTTAATTCTGTGG - Intronic
1022932073 7:35128439-35128461 AGGAGCAGTTTTAAATACTCTGG - Intergenic
1023956848 7:44893477-44893499 AGGAGATGGTTGAAGGTCCCAGG + Intergenic
1025072772 7:55915231-55915253 AGGAGTTAGTTTTAATTTTCTGG + Intronic
1031050784 7:116942897-116942919 AGGAGATTGTCTACATACTCTGG - Intergenic
1031651485 7:124296305-124296327 AGGTCATGGATTCAATTCTCTGG - Intergenic
1031969988 7:128057526-128057548 AGCACATGGCTTACATTCTCAGG + Intronic
1032875175 7:136030994-136031016 AGGAGATTATTTAAACTTTCAGG - Intergenic
1035964462 8:4174823-4174845 AGGCGAAGGTGTAATTTCTCTGG - Intronic
1036702341 8:11021095-11021117 TGGAGATGGTTTAAAATCTGAGG - Intronic
1039648564 8:39314875-39314897 AGAAAATCGTTTAACTTCTCTGG + Intergenic
1039728581 8:40250090-40250112 AGAAGGTGGTTTGGATTCTCAGG - Intergenic
1041012096 8:53554917-53554939 AGTAGGTGGTTTTAATTCTGGGG - Intergenic
1041317058 8:56574953-56574975 AGGAGATAGTGGAAAATCTCTGG - Intergenic
1041618714 8:59938965-59938987 AAGAGATGGTGTATCTTCTCTGG + Intergenic
1045353589 8:101364523-101364545 AGGAAATAGTTGAAATTCTAAGG - Intergenic
1045394214 8:101744351-101744373 TGGAGATGTTTAAAATGCTCTGG - Intronic
1047835395 8:128684632-128684654 AGGAGATGATTTAAAGTCTACGG - Intergenic
1049428082 8:142546162-142546184 AGGAGATGGTGCAAAGTCACCGG + Intergenic
1050308587 9:4330495-4330517 TGGAGGTTGTTTAATTTCTCTGG - Intronic
1050871833 9:10581419-10581441 AAGAGAAGGTTTAAATTGTTTGG - Intronic
1051268362 9:15330632-15330654 AGGAGAAGCTTCAACTTCTCTGG + Intergenic
1053298017 9:36928823-36928845 AGAAGATTGTTTAAAACCTCTGG + Intronic
1054711542 9:68516084-68516106 AGTAGATTGTTCAAATTCTCAGG - Intronic
1054722298 9:68616297-68616319 AGCAGAAGGTTTGAACTCTCTGG - Intergenic
1056576604 9:87859695-87859717 AGGTGATGTTATAAATTCCCAGG - Intergenic
1057757479 9:97849446-97849468 AGTGGATGGTTTAAAGTCGCTGG + Intergenic
1057831464 9:98410273-98410295 AGGTGATGAGTTAAATTCTAAGG + Intronic
1058647571 9:107144871-107144893 AGAACATGGTTTGCATTCTCTGG + Intergenic
1058802612 9:108559736-108559758 AGGAGGAGGATTAAATTCACGGG - Intergenic
1059188416 9:112299616-112299638 AGGAGAGGGTACAAATACTCTGG - Intronic
1059789786 9:117628524-117628546 AGGAGATGGTATGAATTCACTGG + Intergenic
1189599056 X:42601986-42602008 TGGAGATGGGTTGATTTCTCAGG - Intergenic
1193764544 X:85510598-85510620 AAGAGCTGGTTTGAATCCTCAGG + Intergenic
1194201300 X:90956241-90956263 AGGAGATTGTTTAATTTCCATGG + Intergenic
1194304867 X:92231663-92231685 AGTATGTGGTTTCAATTCTCTGG + Intronic
1194373074 X:93098521-93098543 ATTTGATGGTTTAAAGTCTCTGG + Intergenic
1196916660 X:120543078-120543100 AGGAGAGGCTTTACATTTTCTGG - Intronic
1197685921 X:129439681-129439703 ATGGGATTGTTTATATTCTCAGG - Intergenic
1198494707 X:137180236-137180258 AGGAGCAAGTTTAAATTATCGGG - Intergenic
1200547145 Y:4531697-4531719 AGGAGATTGTTTAATTTCCATGG + Intergenic
1200681117 Y:6212560-6212582 ATTTGATGGTTTAAAGTCTCTGG + Intergenic