ID: 972308323

View in Genome Browser
Species Human (GRCh38)
Location 4:37853869-37853891
Sequence CTGCAGAAATGGAGAAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972308315_972308323 28 Left 972308315 4:37853818-37853840 CCCAACTCCTGAATGTTTCTGAT 0: 1
1: 0
2: 2
3: 11
4: 255
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308316_972308323 27 Left 972308316 4:37853819-37853841 CCAACTCCTGAATGTTTCTGATT 0: 1
1: 0
2: 0
3: 24
4: 259
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308318_972308323 -2 Left 972308318 4:37853848-37853870 CCAGAGAATTTAAACCATCTCCT 0: 1
1: 0
2: 0
3: 22
4: 191
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308317_972308323 21 Left 972308317 4:37853825-37853847 CCTGAATGTTTCTGATTTAATCT 0: 1
1: 0
2: 0
3: 25
4: 367
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data
972308314_972308323 29 Left 972308314 4:37853817-37853839 CCCCAACTCCTGAATGTTTCTGA 0: 1
1: 0
2: 2
3: 24
4: 240
Right 972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972308323 Original CRISPR CTGCAGAAATGGAGAAGAGG TGG Intronic
No off target data available for this crispr