ID: 972312498

View in Genome Browser
Species Human (GRCh38)
Location 4:37893793-37893815
Sequence AACACTACTCTGCTGCTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 135}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972312498_972312505 15 Left 972312498 4:37893793-37893815 CCATTCAGCAGCAGAGTAGTGTT 0: 1
1: 0
2: 2
3: 10
4: 135
Right 972312505 4:37893831-37893853 GTAGTGATGACGAAGGATTTAGG 0: 1
1: 0
2: 0
3: 2
4: 101
972312498_972312502 8 Left 972312498 4:37893793-37893815 CCATTCAGCAGCAGAGTAGTGTT 0: 1
1: 0
2: 2
3: 10
4: 135
Right 972312502 4:37893824-37893846 TATCCCTGTAGTGATGACGAAGG 0: 1
1: 0
2: 0
3: 29
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972312498 Original CRISPR AACACTACTCTGCTGCTGAA TGG (reversed) Intronic
901697559 1:11020444-11020466 AACACTTTTCTGCTTCTCAAAGG - Exonic
906695446 1:47820316-47820338 ACCAGCACCCTGCTGCTGAAAGG - Intronic
907812714 1:57888048-57888070 AACACTTCTTGCCTGCTGAATGG + Intronic
914898772 1:151699968-151699990 AACACTACTGTGCTAATGGAGGG + Intergenic
917907551 1:179602168-179602190 AACACTTCTATGCTGCTGGTGGG - Intronic
920419562 1:205822578-205822600 AACACTACTCAACAGCAGAAAGG - Intergenic
920504945 1:206508771-206508793 AACATTACTCAGCTCCTGACAGG + Intronic
921199790 1:212793523-212793545 AACACCATTTTGCTGCTGTATGG + Intronic
921539839 1:216399651-216399673 CACACTACTTTGTTGCTGCAGGG - Intronic
921582868 1:216915276-216915298 ACCACTGCTCTGCATCTGAAAGG + Intronic
922522374 1:226266534-226266556 AACACTACTTTGCTGCCAAAAGG + Intronic
922984002 1:229851792-229851814 AACACTACTCTGTTGAAGAAAGG + Intergenic
923462359 1:234218145-234218167 ACCAATGCTCTGCTTCTGAAAGG - Intronic
924484876 1:244472298-244472320 AACTCTCCTCTGCTGCTCATGGG - Intronic
1067924682 10:50496316-50496338 AAAAGTACTCTGCTGGTCAATGG + Intronic
1068659280 10:59606671-59606693 AAGACTAATGTGCTACTGAAAGG - Intergenic
1068774614 10:60856578-60856600 AACACTTCTCTGCTGAAGCATGG + Intergenic
1069576424 10:69533057-69533079 AACACTTCTCTACTGCTGGTGGG + Intergenic
1075844047 10:125530682-125530704 AACTCTGCCCTGCTGCTGACAGG - Intergenic
1078015342 11:7608666-7608688 AAAATAACTCTGCTGCTGATTGG + Intronic
1083489470 11:63004995-63005017 AACACTTCTCTCCTGCTCACTGG - Intronic
1084233423 11:67769925-67769947 ATCTCTACACTGCTGCAGAACGG - Intergenic
1088545078 11:110951183-110951205 AACACCAGTCTCCTGCTGCAGGG + Intergenic
1089367436 11:117929596-117929618 AACACTCCTCTGCTTCTGTGGGG - Intergenic
1091403928 12:197304-197326 CACACTTCTCTCTTGCTGAAAGG - Intronic
1092313193 12:7381441-7381463 AACTCTATTTTTCTGCTGAATGG - Intronic
1098145956 12:67498165-67498187 AACACTATACCCCTGCTGAAGGG - Intergenic
1100652802 12:96609208-96609230 CACCCTTCTCTGCTCCTGAATGG + Intronic
1107024181 13:35782913-35782935 TACTCAACTCTGCTGCTGTAGGG + Intronic
1109071087 13:57769975-57769997 AACACAACTCTGCTGTGGACTGG - Intergenic
1109162976 13:58999702-58999724 AACCCTGCTCTGCTGCTTAGAGG - Intergenic
1112140848 13:96640179-96640201 AACACTAATATGCTGTTGATGGG - Intronic
1113324856 13:109271162-109271184 AACAGTTCTCTGCTGCAGAGAGG - Intergenic
1118786544 14:69050281-69050303 ACCACTATCCTGCTGCTGCAAGG + Intergenic
1120501375 14:85301029-85301051 AAAACAACTCTGCTTCTGAATGG + Intergenic
1123543404 15:21318150-21318172 AATACTAATATGCTGCTGACGGG + Intergenic
1124387165 15:29219351-29219373 AACACTTCTATGCTGCTGGTGGG + Intronic
1126435962 15:48637905-48637927 TACTCCACTCTGCTGCTGTAGGG + Intronic
1129096452 15:73213879-73213901 AACACTTCTATACTGCTGATGGG - Intronic
1131224357 15:90611656-90611678 AACAGGACTCGGCTACTGAATGG - Intronic
1131706109 15:94998373-94998395 CACACTAGTCTTCTGCTGGAAGG - Intergenic
1133952529 16:10408450-10408472 AACACTTCTATGCTGCTGGTGGG - Intronic
1136490073 16:30602001-30602023 AACACTGCATTGCTGCTGAGAGG - Intergenic
1137468185 16:48730264-48730286 GAAACTTCTCTGTTGCTGAATGG - Intergenic
1138492235 16:57383266-57383288 AACTCTCCTCTGCTGCTGGCTGG + Exonic
1139613727 16:68076548-68076570 GGCACTACTCAGCTCCTGAAAGG - Intronic
1140314755 16:73885077-73885099 AACTGAAGTCTGCTGCTGAAAGG + Intergenic
1142757139 17:2023295-2023317 AGCACTGCTCGGTTGCTGAAAGG + Intronic
1143219291 17:5248091-5248113 AACCATACTCTGCTGCTCCATGG + Intergenic
1144387310 17:14760873-14760895 AGCTCAACTCTGCTGCTGACTGG - Intergenic
1145272617 17:21412829-21412851 AACTCAACTCTCCTGCTTAATGG + Intronic
1145310826 17:21700292-21700314 AACTCAACTCTCCTGCTTAATGG + Intronic
1147504978 17:41006972-41006994 AATACTACTCAGCTGTTAAAGGG + Intergenic
1148923208 17:51058726-51058748 AACACCACCATGCTTCTGAATGG + Intronic
1155118664 18:22796455-22796477 AACACTACTCAGCAGCAAAAAGG + Intergenic
1156667928 18:39430802-39430824 AACACTTCTATGCTGCTGGTGGG + Intergenic
1159907011 18:74102485-74102507 AAAACTCCTGTACTGCTGAAGGG + Intronic
925900192 2:8503743-8503765 AACACTACTGTGATGGTTAATGG + Intergenic
926808050 2:16730377-16730399 AACACTACTTTGCTGCTGTAAGG + Intergenic
931548369 2:63414208-63414230 AACACTTCTATGCTGCTGTTGGG + Intronic
931842759 2:66171611-66171633 AGCACAACTCTTTTGCTGAAAGG - Intergenic
935733965 2:106091414-106091436 ATCACAACTCTGGTGCTGCATGG - Intergenic
937897612 2:126990468-126990490 CACACTGCTTTGCTGCTGCAAGG + Intergenic
938556100 2:132425588-132425610 AACACTAATCTAGTGCTGCAAGG + Intronic
939139119 2:138332302-138332324 AACACTTCTATACTGCTGATGGG - Intergenic
941752889 2:169151975-169151997 GACACTACTCTCCTGGAGAATGG - Intronic
941852558 2:170198537-170198559 AAAACTACTGAACTGCTGAATGG - Intronic
948185151 2:236015106-236015128 ATCACTACTCTACGACTGAAGGG - Intronic
948477897 2:238232287-238232309 AACACTTTTCTGCTTCTCAAAGG - Intergenic
948607405 2:239144822-239144844 AACACTGCTGTGTTGCTGCAGGG + Intronic
1169248604 20:4043452-4043474 AACACTACTCGGCAACAGAAAGG + Intergenic
1169505104 20:6201616-6201638 AACACTTCTCTGCTTCTCAAAGG + Intergenic
1171180186 20:23085855-23085877 GACCCTAGTCTGCCGCTGAAGGG - Exonic
1173401149 20:42727098-42727120 AAGACTGCCCTGCTGCTGACAGG + Intronic
1173634614 20:44544272-44544294 AACACAATTCTGTTTCTGAATGG - Intronic
1179428500 21:41302426-41302448 ATCATTATTCTGCTGCTGGAAGG + Intergenic
1179832531 21:44006331-44006353 AATACTACTCAGCAGCAGAAAGG - Intergenic
1180653873 22:17402449-17402471 AAGACTACTGTGCTGATGTAGGG + Intronic
1180688781 22:17692660-17692682 AATACTACAGTGATGCTGAAAGG - Intronic
1184268659 22:43364770-43364792 ACCACTACCCTGCTGCCGGATGG + Intergenic
950260032 3:11536822-11536844 CACCCTACACAGCTGCTGAAGGG - Intronic
951819493 3:26791969-26791991 TGCACTACTCTGCTGCTGCCAGG + Intergenic
955017888 3:55089602-55089624 AACACTGCTCTGCTGCTGACTGG - Intergenic
955650174 3:61185556-61185578 AAAGCACCTCTGCTGCTGAATGG - Intronic
956415453 3:69023280-69023302 AACACTATTCTGCAGATGTATGG - Exonic
958562704 3:95767822-95767844 AACACTACTTAGCTGATAAAGGG + Intergenic
960409383 3:117303704-117303726 CTCAATATTCTGCTGCTGAATGG - Intergenic
960550369 3:118969678-118969700 AAAACTCCTATGCTGCTGAATGG + Intronic
962535618 3:136326671-136326693 AACACTTCTTTGTTGCAGAATGG - Intronic
972312498 4:37893793-37893815 AACACTACTCTGCTGCTGAATGG - Intronic
974801411 4:66823643-66823665 AACACTTCTATGCTGCTGGTGGG - Intergenic
976876358 4:89857880-89857902 AACACTCTTATGCTGCTGATGGG + Intergenic
977124702 4:93150563-93150585 AACTCTCCCCAGCTGCTGAAAGG - Intronic
979732841 4:124045445-124045467 AAGACTACTGAGCTCCTGAAGGG - Intergenic
981425745 4:144601151-144601173 AACACTTGTGTGCTGCTGAAAGG + Intergenic
983356012 4:166657944-166657966 ATAGCTACTCTGCTGGTGAAAGG - Intergenic
984135949 4:175939231-175939253 AATACTACTCAGCTGCTGCAGGG + Intronic
985421895 4:189792778-189792800 CCCAATACTCTGCTGCTCAAGGG + Intergenic
986723802 5:10579412-10579434 AACACAAATCAGGTGCTGAAGGG + Intronic
988026612 5:25701516-25701538 AACCCTCCTATTCTGCTGAAAGG - Intergenic
989577241 5:42999897-42999919 AGCACTACTCTGAGGCAGAAAGG + Intergenic
991252151 5:64575544-64575566 GGCAGAACTCTGCTGCTGAAGGG + Intronic
994253185 5:97561283-97561305 AACACTATTATGTTACTGAAAGG - Intergenic
995693354 5:114852231-114852253 AACACTTCTATACTGCTGATGGG - Intergenic
996794204 5:127326469-127326491 AATACTAGTTTGCTGATGAAAGG - Intronic
1003322638 6:5065693-5065715 AACAGTTATCTTCTGCTGAAAGG + Intergenic
1003641463 6:7878814-7878836 AACACACCTCTGTTGCTTAAGGG + Intronic
1004007248 6:11648558-11648580 AACTCTAATATGCTGCTGATGGG - Intergenic
1004054811 6:12124705-12124727 AACACTACTCTGCAGGCGTATGG - Exonic
1004558857 6:16728149-16728171 CACACTACCCTGGAGCTGAAAGG + Intronic
1005286307 6:24330841-24330863 GGCACTACTCTGCTGCGTAAGGG - Intronic
1007107578 6:39294332-39294354 ATTACTACTCTGGGGCTGAAGGG + Intergenic
1007369766 6:41418801-41418823 TACACTACTCTGCCTCTCAAGGG + Intergenic
1017583762 6:155897400-155897422 ACCACTACTCTGCTGCAAAAAGG + Intergenic
1018058592 6:160072370-160072392 TCCACTACACTGATGCTGAAAGG - Intronic
1019865283 7:3703268-3703290 AACACTACTCTGCATCATAAAGG + Intronic
1020487051 7:8732516-8732538 AACACTTCTCTCTTCCTGAAAGG + Intronic
1020785652 7:12570172-12570194 CACACTCCTCTGCTGCCTAACGG + Intergenic
1026324985 7:69301251-69301273 CACTCTACACTGCTGATGAAGGG + Intergenic
1028741099 7:94276741-94276763 AAAACTACTCTTCTGCTGCTAGG - Intergenic
1032840321 7:135708207-135708229 AACACCACGCTGCTGCTGGTGGG - Exonic
1034948768 7:155282463-155282485 ATCATTGCTCTGCTGCTGAATGG - Intergenic
1035255667 7:157625111-157625133 AACACTTCTTCGCTGCTGATGGG + Intronic
1035416139 7:158688704-158688726 AACAAAACTCTGAGGCTGAAAGG + Intronic
1035975538 8:4306736-4306758 AACACTACCCTGCTGCGGTCGGG - Intronic
1040744921 8:50630797-50630819 AACAGCACTCTACTCCTGAAAGG + Intronic
1042002340 8:64138697-64138719 TACAGTACAGTGCTGCTGAATGG - Intergenic
1042422050 8:68602752-68602774 GACATCACTCTGGTGCTGAATGG + Intronic
1042530679 8:69811691-69811713 AACACCACTCTCTTCCTGAACGG + Intronic
1043628032 8:82288946-82288968 AACACTTCTATGCTGCTGGTGGG - Intergenic
1043665402 8:82804856-82804878 AGCAATACACTGCTGCTGCAGGG + Intergenic
1043875044 8:85476324-85476346 AACACAACTATGCTGCAGAGAGG - Intronic
1044386684 8:91597528-91597550 AACCATACTGTGCTGCTGACTGG - Intergenic
1046610611 8:116419876-116419898 AACAAGACTCTGCTGCTGTTTGG - Intergenic
1047175740 8:122538677-122538699 AACACTTTTATGCTGCTGATGGG + Intergenic
1048662797 8:136625184-136625206 AACACTACTCTACTACTATAAGG + Intergenic
1051189673 9:14498447-14498469 AACACTTAGCTGCAGCTGAAAGG + Intergenic
1051491341 9:17669907-17669929 AACAGCTCTCTGCTGCAGAAAGG + Intronic
1061798572 9:133102356-133102378 AATCCTACCCTGCTGCTGACTGG - Intronic
1191175694 X:57498939-57498961 AACACTTCTACGCTGCTGGATGG - Intergenic
1192219428 X:69187235-69187257 AGCACAACTCTGCTGCTCATTGG - Intergenic
1193828120 X:86251951-86251973 AACACTTCTATGCTGCTGATGGG - Intronic
1196111264 X:111949725-111949747 AACACTTCTATGCTGCTGCTGGG + Intronic
1197070271 X:122288312-122288334 AACACTTCTATGCTGCTGGTGGG + Intergenic
1197348152 X:125349889-125349911 CACACCACACTGCTGCTGATGGG - Intergenic
1197811215 X:130445161-130445183 TAGACTCCTCTGCTGCAGAAAGG - Intergenic
1199347678 X:146761087-146761109 AGGTCTACTCTGCTGCTGAGAGG - Intergenic
1199688637 X:150288782-150288804 GAAACTACTTTGCTCCTGAAAGG + Intergenic