ID: 972315950

View in Genome Browser
Species Human (GRCh38)
Location 4:37926018-37926040
Sequence TGCCAGATGGTGCCCTGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 173}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972315950 Original CRISPR TGCCAGATGGTGCCCTGCAA TGG Intronic
902760496 1:18577603-18577625 TGCCAGATGGTCACCTGCACAGG + Intergenic
904810157 1:33158279-33158301 TTCCAGATGGTGTACTGCAGGGG + Exonic
904818933 1:33227824-33227846 AGCCAGATGGTGCTCAGAAATGG + Intergenic
904841327 1:33373693-33373715 TCCCAGTTGATGCCCTGCACTGG + Intronic
906216686 1:44045198-44045220 TGACAGATGCTGCCATGCAAGGG + Intergenic
909521573 1:76574712-76574734 TGCCAGAAAGAGCCCTGAAAGGG + Intronic
909632328 1:77780003-77780025 CGCCAGAGGGAGGCCTGCAAAGG + Intronic
910216646 1:84850573-84850595 AGCCAGATGTTGCCTTGAAAGGG + Intronic
914093103 1:144521726-144521748 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914305423 1:146412158-146412180 TCCCAGAGGCTGCCCTGCACAGG - Intergenic
914596636 1:149160645-149160667 TCCCAGAGGCTGCCCTGCACAGG + Intergenic
914913039 1:151802027-151802049 TGCCAGCTGGGGCCCTGCGGGGG - Exonic
915497803 1:156293800-156293822 TGGCAGATGGAGATCTGCAAGGG - Intronic
918069170 1:181122428-181122450 TGCCAGCTGGTGCCCAGCACAGG + Intergenic
920217829 1:204374136-204374158 TGCAAGATGGTGCCAAGCCAAGG - Intronic
923109184 1:230877366-230877388 TTCCAGATGCTGCCCTGCAATGG + Intergenic
1066261835 10:33736901-33736923 TTCCAGACGCTACCCTGCAAAGG + Intergenic
1066691616 10:38034281-38034303 TGTAATATGGTGCCCTGGAAGGG - Intronic
1067001084 10:42614381-42614403 TGTAATATGGTGCCCTGGAAGGG + Intronic
1067170264 10:43900177-43900199 TTTCAGCTGGTGCCCTGGAATGG + Intergenic
1069092077 10:64212036-64212058 TGTCACATGGTGGCCTGCTATGG + Intergenic
1069716228 10:70523158-70523180 CTACAGCTGGTGCCCTGCAAGGG - Intronic
1071467069 10:85951011-85951033 AGCCAGATGGAGTCCTGCAGGGG - Intronic
1072720740 10:97779515-97779537 TTCCAGACAGTGCCCAGCAAGGG - Intergenic
1075162114 10:120033520-120033542 TGGCACATGGTGGCCTGCAAGGG + Intergenic
1075915844 10:126166364-126166386 TGCCAGCTGGAGAGCTGCAAAGG - Intronic
1077167198 11:1149050-1149072 TGCCAGGTGGGGCCCTGGACGGG + Intergenic
1077844851 11:6013257-6013279 TGCCAGCCTGTGCCCAGCAAGGG - Intergenic
1078003828 11:7517800-7517822 AGACTGATGGTGCCCTGGAATGG - Intronic
1081669069 11:44933309-44933331 TGCCAGGTGGGCCCCTGCCAGGG - Exonic
1084044950 11:66563098-66563120 CGCCGTATGGTGCCCTACAAGGG + Exonic
1089609308 11:119660644-119660666 TGCCGGCTGGTGCCCTCCTAGGG - Intronic
1090333543 11:125948407-125948429 TGCCCGATGCTGCCAGGCAAAGG - Intergenic
1091971726 12:4793102-4793124 TGCCAGGCTGTGCCCTGCACAGG - Intronic
1098428154 12:70389729-70389751 AGGCAGATGGGGCCCAGCAAGGG - Intronic
1101169639 12:102077025-102077047 TGCATGATGGTTCCCTGCAGTGG - Intronic
1106734258 13:32573013-32573035 TGCCAGTGGGTGGCCTCCAAAGG + Intergenic
1107018665 13:35729995-35730017 TGCCAAATGGTCCCCAGCAATGG + Intergenic
1107798479 13:44079904-44079926 TGACAGATGGTGGACAGCAAGGG + Intergenic
1107799173 13:44088084-44088106 TGACAGATGGTGGACAGCAAGGG - Intergenic
1107866008 13:44704002-44704024 AGCCAGATTGTGGCCTGGAATGG + Intergenic
1109054876 13:57534377-57534399 TGCCAGCAGGTGCCTTGCAAGGG + Intergenic
1110158663 13:72350081-72350103 TGCCAGATGGTGACATGAAGAGG - Intergenic
1111919601 13:94396421-94396443 TGGTGGATGGTGCCCTGCAGGGG + Intronic
1112491410 13:99867772-99867794 GGCCAGATGTTGCTCTGAAATGG + Intronic
1112585768 13:100717057-100717079 TGCCAGATGATGACTTGGAAAGG - Intergenic
1113552135 13:111200793-111200815 TGCCAGAAGGGGCCCTGCACTGG - Intronic
1116600214 14:46911952-46911974 TGTCTGAGTGTGCCCTGCAATGG - Intronic
1117912500 14:60648822-60648844 TCCCAGATGGTGCGCGGCAGTGG + Exonic
1119781771 14:77280585-77280607 TGCCTGATTCTTCCCTGCAAGGG - Intronic
1121926304 14:97930345-97930367 TTCCAGCTGGTGCCCTGGAGAGG - Intronic
1122306112 14:100767873-100767895 TGGCATTGGGTGCCCTGCAAAGG + Intergenic
1124074719 15:26433831-26433853 AGCCAGATGGTGCCCTGGAGTGG + Intergenic
1124477776 15:30049963-30049985 TGTCAAATTGTGCCCTGTAAGGG - Intergenic
1129281671 15:74489985-74490007 TGCCCTCTGGTGGCCTGCAATGG + Intergenic
1130192399 15:81749678-81749700 TGCCAGCTAGTTCCCTGCAAGGG - Intergenic
1130674469 15:85939688-85939710 TGCCAGATGGTTACCTTGAAAGG + Intergenic
1133700897 16:8307821-8307843 TGGCAGAAGGTGCACTGCCAGGG + Intergenic
1136995763 16:35187274-35187296 TGCCAGATGGTGCCTTCTGATGG - Intergenic
1141426439 16:83947471-83947493 TGCCTGCAGGTGCCCAGCAATGG + Intronic
1144223907 17:13126001-13126023 TGCAATATGGTGCCCTGGATTGG - Intergenic
1145399237 17:22517527-22517549 TGCCAGATGCCGCCCTGGAGAGG + Intergenic
1145827855 17:27890861-27890883 TGCAAGATGGAGCCCTGGAGTGG - Intronic
1146981115 17:37162679-37162701 TGCCACATGCTGCCCTTCTATGG + Intronic
1147215598 17:38897333-38897355 TGCCAGATGATTCCCTGCCAGGG + Intronic
1150479582 17:65499140-65499162 TGCCAGCTGGTGCCCTCCAAAGG + Intergenic
1151467943 17:74299786-74299808 AGCCAGATGGTGCCATACACAGG - Exonic
1152070292 17:78130903-78130925 GGCCAGCTAGAGCCCTGCAAGGG + Intronic
1157919289 18:51698623-51698645 AGACTGATGGTGCCCTGGAATGG + Intergenic
1158174351 18:54637446-54637468 TGGCAGCTGGAGCCCTGCAGAGG - Intergenic
1160354138 18:78212740-78212762 TGCCACATGGTGTCCTGGACAGG - Intergenic
1161164799 19:2780656-2780678 TGCCAGATGCTGGCGTTCAAAGG - Intronic
1161166078 19:2788398-2788420 TGCAAGGTGGAGCCCTGGAAAGG - Intronic
1161604974 19:5209781-5209803 TGCAAGATGGTGCCCTTGGAGGG - Intronic
1161719983 19:5897295-5897317 TGCCGGCCGGTGCCCTGCCAGGG - Intronic
1163376065 19:16931272-16931294 TGCCTGAGGGTGCCATCCAAGGG + Intronic
1163721711 19:18901001-18901023 TGCAAAAAGGTGCCCTGCCATGG - Intronic
1163939351 19:20478118-20478140 AGACTGATGGTGCCCTGGAAAGG - Intergenic
1165283002 19:34814139-34814161 TGACAGAGGGTGCACTGCAAAGG - Intergenic
1165384283 19:35501492-35501514 GGACAGGTGGGGCCCTGCAAAGG - Intronic
1165466408 19:35977567-35977589 TGTCATCTGGTGCCCTGCAGGGG - Intergenic
1167012304 19:46816550-46816572 GGCCAGATGGGGACCAGCAAAGG + Intergenic
929570576 2:43020398-43020420 TTCCAGATGGTGTCCTTAAAAGG - Intergenic
930033107 2:47070117-47070139 TGCCTGATGATGCCCTCCAAGGG - Intronic
932107679 2:68961645-68961667 TGCGTGAGTGTGCCCTGCAATGG + Intergenic
935348988 2:102137435-102137457 TCCAAGATGGTGCACTGCCATGG + Intronic
936249253 2:110854686-110854708 TGCCAGGTGGTGGCCCTCAATGG - Intronic
936427781 2:112434934-112434956 TGCCAGATGCTGCCCACCACCGG - Intergenic
940899241 2:159111166-159111188 TGCCTGGTGGTGCCCTGCCTGGG + Intronic
942081479 2:172403356-172403378 AGCCAGAGGGAGCCCTGAAAGGG + Intergenic
945953604 2:216064364-216064386 TTCCAGATGGTGCCCATAAAAGG + Intronic
947565260 2:231189471-231189493 TGACAGAGGTTGGCCTGCAAGGG - Intergenic
947834637 2:233166548-233166570 GCCCAGAAGCTGCCCTGCAATGG - Intronic
948765859 2:240218363-240218385 TGCCAGGTGGTGACTTGCACAGG + Intergenic
948790570 2:240374522-240374544 TGCCAGATGGATTCCTGCACTGG - Intergenic
948844017 2:240674642-240674664 TGCCAGATCCTGCCAGGCAAAGG - Intergenic
1172510438 20:35497179-35497201 AGCCAGATGGTGGCTTGCAGGGG + Intronic
1173053868 20:39592300-39592322 TGGCAAATGATGCCCTGCAAGGG + Intergenic
1173905122 20:46621988-46622010 TGCCAAATTGTAACCTGCAAAGG + Intronic
1176374463 21:6080277-6080299 TGCCAGATGCTGCCCACCACCGG + Intergenic
1177520360 21:22213823-22213845 TGCCAAGAGGTGGCCTGCAAAGG + Intergenic
1178623520 21:34197098-34197120 TCCCTGCTGGTGCCCTGGAAGGG + Intergenic
1179453074 21:41478657-41478679 TGCCAGAGGGTGCTCTGTGAGGG - Intronic
1179749012 21:43457968-43457990 TGCCAGATGCTGCCCACCACCGG - Intergenic
1180857588 22:19058200-19058222 GGACACATGGTGCCCTGCCATGG + Intronic
1180999540 22:19981612-19981634 TTGCAGATGGTGCCCTGGACCGG - Exonic
1182475427 22:30574279-30574301 TGCCAGAGGGTGGCCTGGTAGGG - Intronic
1184999485 22:48235947-48235969 TGGCTGATGGTGCCTTGCACGGG + Intergenic
950261958 3:11548930-11548952 TGCCAGATTGTCCTCTGCAGGGG + Intronic
950336077 3:12194382-12194404 TGCCAAATTGTTCCCTGAAATGG - Intergenic
953375023 3:42421314-42421336 TGCCCCATGGGGCCTTGCAATGG - Intergenic
953715799 3:45316064-45316086 GGCCAGATGGAGCCCTGCCTAGG + Intergenic
954280881 3:49576876-49576898 TGCCAGATGGTGCCCTACATTGG + Intronic
954446985 3:50552123-50552145 TGCCAGATGGCGCCAATCAAGGG + Intergenic
954980160 3:54738640-54738662 TGGCAAAGGGTGCTCTGCAAGGG - Intronic
955932754 3:64074328-64074350 TGCCAGATGCAGCCTTGCTATGG + Intergenic
956124760 3:66000749-66000771 TGCAGGATGTTGCCCTGCCATGG - Intronic
956698687 3:71940043-71940065 TGCCAGATTGTCCCTTCCAATGG - Intergenic
958653299 3:96966323-96966345 TGCCAGCTGGCTCCCTGTAAGGG - Intronic
958954695 3:100455022-100455044 GGCCAGAGGGTGCCTTTCAAAGG - Intronic
959636357 3:108576871-108576893 TGGGAGATGGTGCCCTGACAGGG + Intronic
960142367 3:114163452-114163474 TGCCAAATGGAGACCTGGAAGGG + Intronic
962312567 3:134336933-134336955 TGCCAGCTGGAGCTGTGCAAAGG + Intergenic
965872242 3:173276973-173276995 AGACTGATGGTGCCCTGGAACGG + Intergenic
966010619 3:175071105-175071127 TGCCAGTTAGTGCACTGCAGGGG + Intronic
966146215 3:176814637-176814659 TGACAGATGGAGCACTGCAGAGG - Intergenic
966582529 3:181584361-181584383 TGCCAGTCAGTGCCCTGCAGGGG + Intergenic
968455803 4:699050-699072 TGCCCGCAGGTGCCCTGCAGAGG - Intergenic
970554552 4:17218060-17218082 TCCCAGATGATGGCCAGCAAGGG - Intergenic
972315950 4:37926018-37926040 TGCCAGATGGTGCCCTGCAATGG + Intronic
972377805 4:38489388-38489410 TGCCAGTTAGTGTCCTGCACCGG + Intergenic
975306922 4:72860522-72860544 AGCCAGGCTGTGCCCTGCAAGGG + Intergenic
975763429 4:77641035-77641057 TGCCAGATCATCCCCTTCAAAGG + Intergenic
976091231 4:81460286-81460308 TGTCAGAGGGTGCTCTGCAGAGG + Intronic
976300013 4:83508243-83508265 AGACTGATGGTGCCCTGGAACGG - Intronic
982205062 4:152991555-152991577 GGCCAGGTGGTGACCTGAAAAGG + Intergenic
986254420 5:6090212-6090234 TGGGAAATGGTGCTCTGCAATGG + Intergenic
986480167 5:8178652-8178674 TGCCAGACGCTTCCCTGCAGGGG + Intergenic
987252878 5:16118427-16118449 AACCAGATGGTGGCTTGCAAAGG + Intronic
988682191 5:33494608-33494630 TGCCAGATTGTCCCCTGGAGAGG - Intergenic
992152982 5:73924845-73924867 TGCAAGATGCTGGCCTCCAAAGG - Intronic
996059060 5:119012618-119012640 TGCAAGATGATGCCTTGCTACGG - Intergenic
996202507 5:120694034-120694056 TGGCAGGTGGTGTCCTTCAAAGG - Intergenic
996222000 5:120944860-120944882 TGCTAGATGGTTCTTTGCAATGG - Intergenic
998174640 5:139894284-139894306 CTCCAGGTGTTGCCCTGCAAAGG - Intronic
998335848 5:141371608-141371630 TGACAGATGGAGCCCTGGACCGG + Exonic
1002279437 5:178122033-178122055 TGTCAGAAGGTGCCCTGAGACGG + Exonic
1011357972 6:86492027-86492049 TGCAAGACTGTTCCCTGCAAGGG - Intergenic
1016989907 6:149921933-149921955 TGCCTGCTGTTGCTCTGCAAAGG + Intronic
1017625292 6:156341606-156341628 TGTCAGATGTTGCCCCGCCAAGG + Intergenic
1019255187 7:45249-45271 TGAGGGATGGTGCCCTGCACAGG - Intergenic
1020413576 7:7919829-7919851 TGGCAGAGGGTGGCCTGAAAAGG + Intronic
1020451190 7:8322226-8322248 TGCCATATGGCCCTCTGCAAAGG - Intergenic
1020548431 7:9565852-9565874 TTACAGTTGGTGCCTTGCAAAGG - Intergenic
1020843477 7:13252680-13252702 TTCCAGATGGTTCACTGAAAAGG - Intergenic
1022391236 7:29946446-29946468 GGCAAGTTGGGGCCCTGCAAAGG - Intronic
1024221543 7:47292121-47292143 TCCCAGATGGTGACATGCAATGG + Intronic
1024680854 7:51685900-51685922 TTCCAGCTGCTGCCCTGCCATGG + Intergenic
1024710069 7:52005641-52005663 TTCCAGATGGTGCAATGCAAAGG - Intergenic
1026296914 7:69060765-69060787 AGGCAGATGGTGCACTCCAAAGG - Intergenic
1031024274 7:116663162-116663184 TGGCAGATGGTGTCCTTCTAGGG - Intergenic
1034268747 7:149793311-149793333 TGCCAGACGGAGCCCTGTGAGGG + Intergenic
1034905910 7:154945674-154945696 TGAGAGAAGGTGCTCTGCAATGG + Intronic
1035369933 7:158373018-158373040 TGCCAGAGGATGCGCTGCACAGG + Intronic
1036700671 8:11011836-11011858 TGCCATGTGCTGCCCTGCAGTGG - Intronic
1039662941 8:39487030-39487052 TGCCACATGGGTCCCTTCAAGGG + Intergenic
1042323939 8:67508430-67508452 TTCCAGAGGGTGGACTGCAATGG + Intronic
1042808316 8:72796084-72796106 TGCCAGATGGAGCCTTAAAAGGG - Intronic
1045524739 8:102932073-102932095 TGCCAGTTGTTGCCATGGAAGGG - Intronic
1046794501 8:118356346-118356368 GGCCAGGTGGTGCCCTACACCGG - Intronic
1048025001 8:130578067-130578089 TGCCAGATGGTGCCCTGACAAGG - Intergenic
1048717320 8:137283904-137283926 AGACTGATGGTGCCCTGGAATGG + Intergenic
1049498340 8:142947234-142947256 TGGCAGCTGTTCCCCTGCAAAGG - Intergenic
1049608180 8:143539380-143539402 TGCCAGCTGATGCCCTTCCAGGG - Intronic
1049745607 8:144261970-144261992 GGCCAGAGGGTGCCCTGGACTGG + Intergenic
1051758873 9:20438285-20438307 GTCCAGATGGTACCCTGCATAGG + Intronic
1052333189 9:27292800-27292822 CTCCAGATGGTTCCCTGCACAGG + Intronic
1052659649 9:31411725-31411747 TGCCAGGTGGTGGGGTGCAAAGG + Intergenic
1055499602 9:76889753-76889775 TGGGAGAAGGTGCCCTGCAGTGG - Intronic
1056331311 9:85523325-85523347 TGCCAGATGGCTCCCTCCCAGGG + Intergenic
1059330153 9:113529862-113529884 TGCCAGATGTTGCTCAGCAAAGG - Intronic
1061413402 9:130432885-130432907 TGGCAGCTGCTGCCCTGGAAAGG + Intronic
1062220889 9:135414676-135414698 TGCTAGACAGAGCCCTGCAAGGG - Intergenic
1062392251 9:136338454-136338476 TGCCCGATGGTCCCCTGCCCCGG - Intronic
1186508759 X:10115008-10115030 TTCCAAATGGTGCCATGCAGAGG - Intronic
1186963743 X:14764905-14764927 TGCCACATGGGGCGCTCCAAAGG - Intergenic
1193698981 X:84740903-84740925 AGACTGATGGTGCCCTGGAACGG + Intergenic
1193706709 X:84829507-84829529 TGTCAGATTGTGCCATGCAGGGG + Intergenic
1194799186 X:98250703-98250725 TGTCAGAGGGTGCCAGGCAAGGG - Intergenic
1198800984 X:140447369-140447391 TGCCAGTTGGGGCAGTGCAAGGG + Intergenic
1202164830 Y:21976494-21976516 GGCAATATGGTGCCTTGCAATGG + Intergenic
1202226526 Y:22609880-22609902 GGCAATATGGTGCCTTGCAATGG - Intergenic
1202316591 Y:23585782-23585804 GGCAATATGGTGCCTTGCAATGG + Intergenic
1202554173 Y:26084276-26084298 GGCAATATGGTGCCTTGCAATGG - Intergenic