ID: 972316888

View in Genome Browser
Species Human (GRCh38)
Location 4:37935024-37935046
Sequence CCTTCTGTGCAGGTGCTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972316888 Original CRISPR CCTTCTGTGCAGGTGCTCCA AGG (reversed) Intronic
900090030 1:916207-916229 TCATCTGAGCAGGTGCTCCCAGG + Intergenic
900098006 1:948179-948201 CTGGCTGTGCAGGTACTCCAGGG + Exonic
902236811 1:15062941-15062963 CCTTCCAGGCAGGAGCTCCAGGG - Intronic
905210274 1:36369382-36369404 CCTGCTGTGGAGGTCCTCCAAGG + Intronic
905454787 1:38080860-38080882 CTCACTGTGCAGCTGCTCCACGG + Intergenic
907854721 1:58291350-58291372 CCTTCAAGACAGGTGCTCCATGG + Intronic
908050332 1:60222655-60222677 ACATCTGTGCATGTGCTTCAGGG + Intergenic
911856623 1:102885028-102885050 CCTTCTGTTCAGATACTCCCTGG - Intronic
912951043 1:114120811-114120833 CCCTGAGTGCAGGTGCCCCAGGG - Intronic
915119393 1:153619217-153619239 CTTTCTCTGCTGGTGCTCCTTGG - Intronic
916141727 1:161705693-161705715 GCTTCTGTGCAGGTGGCCCCAGG - Intergenic
918075749 1:181170122-181170144 CCTTCTGTGGAACTCCTCCAGGG + Intergenic
919861531 1:201741908-201741930 ACTTCTGGGCAGGTGTGCCAGGG + Intronic
920501487 1:206488144-206488166 GGTTCTGTGCAGCTGCTCTAGGG + Intronic
922465714 1:225844726-225844748 CCTTGCCTGCAGGTGCCCCAGGG + Intronic
922576830 1:226666424-226666446 CCTGGTGTCCAGGGGCTCCAGGG + Intronic
922722259 1:227905045-227905067 CCTTCTGTCCAGGGGCTGCTGGG - Intergenic
922798267 1:228352155-228352177 GCTTCTGTCCAGTTCCTCCAGGG + Intronic
922813126 1:228429209-228429231 GCTGCTTTGCAGGTGCTCCTGGG - Intergenic
923145604 1:231195626-231195648 CCTTGCGTGCTGGTGCTCCTGGG + Intronic
923508113 1:234624273-234624295 ACTTCTCTGCAGTTACTCCAAGG + Intergenic
923699559 1:236286905-236286927 CTTACTGCGCAGCTGCTCCAGGG + Intergenic
1064311957 10:14219686-14219708 CCTTCTCTGAAGGTGTTACATGG - Intronic
1067566821 10:47345624-47345646 CCTGCGCTGCAGGTGCTGCAGGG + Intergenic
1067974617 10:51010181-51010203 GCTTTTCTGCACGTGCTCCATGG - Intronic
1069771198 10:70901549-70901571 CCTTCTATGCAGGTGCCCCCAGG + Intergenic
1071334367 10:84589209-84589231 CCATCTGTGCAGGGCCTCCCAGG - Intergenic
1072019786 10:91386975-91386997 CCTTCTGTTTAGCTGTTCCATGG + Intergenic
1072045541 10:91651062-91651084 CTCTCTGTGGAGCTGCTCCATGG + Intergenic
1073466385 10:103696787-103696809 CATTCTCTGCAGCTGGTCCAGGG + Intronic
1075572436 10:123556075-123556097 CCTCCTGCGCAGGTGCCCCAGGG + Intergenic
1076272169 10:129163199-129163221 CGTGCTGTGCAGGTGCCTCATGG + Intergenic
1076586193 10:131549273-131549295 CCTTCTGTGCAGCAGGTCCTGGG - Intergenic
1077683875 11:4272702-4272724 CCTTCTTTGGAGGGGCTCCGGGG - Intergenic
1077686167 11:4294062-4294084 CCTTCTTTGGAGGGGCTCCGGGG + Intergenic
1077691317 11:4345226-4345248 CCTTCTTTGGAGGGGCTCCGGGG + Intergenic
1079487509 11:20950886-20950908 CCTTCGGTGCAGGTGTTGAAAGG - Intronic
1080962030 11:37172039-37172061 CCAACTGGGCAGGTGCTACAGGG - Intergenic
1083340404 11:61955451-61955473 CCTCCCGCGCAGGGGCTCCAGGG - Intronic
1083815635 11:65130887-65130909 CCTGCTGTGCAGGCTCCCCAGGG + Intronic
1087953479 11:104254714-104254736 ACTTCTGTGGAGGTGCTGCGTGG - Intergenic
1089011724 11:115137051-115137073 GCTTCTCTGCAGGTGGCCCAGGG - Intergenic
1089306978 11:117532654-117532676 CTTTCAGTGTAGATGCTCCAGGG + Intronic
1089346657 11:117795784-117795806 CCTGCCCTGCCGGTGCTCCAGGG - Intronic
1090670122 11:128940153-128940175 GTTCCTGTGCAGGGGCTCCAAGG - Intronic
1091056342 11:132422828-132422850 CCATTTGTGCAGGTTTTCCAGGG + Intronic
1091696854 12:2633464-2633486 CCTTCCTTGCTGGTGCTCCTGGG + Intronic
1091933417 12:4415473-4415495 CCTTCTGTGCTCGTCGTCCATGG - Intergenic
1092708523 12:11309531-11309553 CCATCTGTGAAGGTGCTGGAAGG + Intronic
1094161165 12:27392522-27392544 CCTTCTGTGTGGGTGATCCAAGG + Intronic
1094851539 12:34384471-34384493 CCATGTGTGTAGGTGCTCCATGG + Intergenic
1096539817 12:52300681-52300703 ACTTCTGTGCAGGAGTTTCAAGG + Intronic
1099986043 12:89665709-89665731 CCTTCTGTTCAGGAGCTAGAAGG + Intronic
1103444781 12:120987514-120987536 CCTCCTGTTCTGGTGCTGCAGGG + Intronic
1104772032 12:131369495-131369517 CATTCTGTCCAGGCCCTCCAAGG - Intergenic
1107986378 13:45780129-45780151 CGTTCTGTGCAGGGACTCCTGGG + Exonic
1113441065 13:110328682-110328704 ACTGCTGTGAAGGTGATCCAGGG + Intronic
1113486226 13:110654181-110654203 GCTTCTGCCCAGGGGCTCCAGGG - Intronic
1113902228 13:113803760-113803782 CCTTCTGGGCAGCTGGTCCTTGG - Intronic
1114999236 14:28401431-28401453 CCAACTGTGCAGCTGCTCCTGGG + Intergenic
1115157303 14:30355953-30355975 CCTTGAGTGCAGGTGAGCCAGGG + Intergenic
1118239826 14:64045407-64045429 CCTTCAGTGCAGGTTCTCTTGGG + Intronic
1119225494 14:72941927-72941949 TCAACTGTGCAGGTGCTTCACGG - Intronic
1121263150 14:92581185-92581207 CCTTCTTAGCGGGTGCTCCTGGG + Intronic
1121861815 14:97325710-97325732 CTGTTTCTGCAGGTGCTCCATGG + Intergenic
1122827317 14:104376550-104376572 CCTCCTGGGCCGGTGCTCCACGG - Intergenic
1123145284 14:106123879-106123901 CCAGCTGTGCACCTGCTCCAGGG + Intergenic
1123160962 14:106277635-106277657 CCTCCTGTGCACCTGCCCCAGGG + Intergenic
1123200751 14:106661574-106661596 ACTCCTCTGCAGCTGCTCCAGGG + Intergenic
1123481964 15:20640545-20640567 CCTCCTGTGAACCTGCTCCAGGG + Intergenic
1123636048 15:22359820-22359842 CCTCCTGTGCACCTGCTCCAGGG - Intergenic
1124692822 15:31839570-31839592 GCTTCTGTGCAGGTGCTGAGTGG - Intronic
1124847529 15:33306421-33306443 CTTTTTGTTCAGGTGTTCCAAGG - Intergenic
1127735583 15:61835648-61835670 CCAGCTGTGCCCGTGCTCCAAGG - Intergenic
1130403955 15:83581471-83581493 CTCTCTCTGCAGGGGCTCCAAGG - Intronic
1131025330 15:89136700-89136722 CATTCTGTGTAGGTAATCCAGGG + Intronic
1131075600 15:89493304-89493326 CCCTGTGGGCTGGTGCTCCAGGG - Intronic
1131623411 15:94091661-94091683 CCTCCTATGCAGGGTCTCCATGG - Intergenic
1132084559 15:98896836-98896858 ACTTCTGCTCAGATGCTCCAAGG + Exonic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136270842 16:29147377-29147399 CCTTCCATGCAGCTGCTCCCAGG - Intergenic
1136693819 16:32057902-32057924 CCAGCTGTGCACCTGCTCCAGGG - Intergenic
1136794310 16:33001137-33001159 CCAGCTGTGCACCTGCTCCAGGG - Intergenic
1136875598 16:33853242-33853264 CCAGCTGTGCACCTGCTCCAGGG + Intergenic
1137351588 16:47718341-47718363 CCTTCCATGCAGCTGCACCATGG - Intergenic
1138124106 16:54424601-54424623 CCTTCTGTGCAGGTGGCTCTGGG + Intergenic
1138426718 16:56939065-56939087 CCTTCTGTGCTTGTGGTACATGG + Intronic
1138659656 16:58509639-58509661 CCTTCCGTGCTGGGGGTCCAGGG + Intronic
1139246436 16:65449001-65449023 CCATCTGTACAGCAGCTCCAAGG - Intergenic
1141431442 16:83972211-83972233 CCTTCTGTCCTCGTGCTTCATGG + Intronic
1141623521 16:85249583-85249605 CCTGCTGTGCTGTTGCTCCACGG - Intergenic
1141647147 16:85373660-85373682 CGCTCAGAGCAGGTGCTCCAGGG + Intergenic
1142348534 16:89569469-89569491 CCTTCTCTGGAGGTGGCCCAGGG + Intergenic
1203096574 16_KI270728v1_random:1262818-1262840 CCAGCTGTGCACCTGCTCCAGGG - Intergenic
1143037109 17:4005610-4005632 CCCTCTGTGCAGGGTCTGCAGGG - Exonic
1143317647 17:6044622-6044644 CATTCTGTGTTGGTGCTCCCAGG - Intronic
1144254894 17:13458127-13458149 CCTACTGTGTAGGTTCTCCAGGG + Intergenic
1145252289 17:21303193-21303215 CTTGCTGTGCAGATGCTCCAGGG - Exonic
1147341674 17:39756201-39756223 CCCTCTGGGGAGGTGCTCCCTGG - Intergenic
1148668153 17:49390196-49390218 CCTCCTGTTCAGCTGCCCCATGG + Intronic
1150298564 17:64029103-64029125 CCAGCTGTGCAGGCTCTCCAAGG + Intergenic
1156362859 18:36399641-36399663 CCTTGTGCTCAGGTGCTCTAGGG + Intronic
1157490562 18:48120900-48120922 CCTTCAGGGCTGGTGTTCCAGGG - Intronic
1159138945 18:64369475-64369497 CCAACTGTGCAGCTGCTCCTGGG + Intergenic
1160336976 18:78050998-78051020 CCTTCTCTGCACGTGTTTCATGG - Intergenic
1162131148 19:8526829-8526851 CCTTCTGTGCAAGCGCTTCGAGG - Exonic
1162320660 19:9969366-9969388 CCATCTGTCCAGGGGCTCCCAGG + Exonic
1162396879 19:10422433-10422455 CCTCCTCTGATGGTGCTCCAGGG + Intronic
1163241095 19:16064369-16064391 CCCTCTGGGCATGAGCTCCAGGG - Intergenic
1164648615 19:29876225-29876247 CCTTCTGGGCAGGTGGACCTGGG - Intergenic
1165321255 19:35086692-35086714 CATCCAGTGCAGCTGCTCCATGG + Intergenic
1167446219 19:49539123-49539145 GTTTCTGTCCAGGTCCTCCAGGG - Exonic
925200961 2:1967643-1967665 CCTTCTGCGCAGCTGCAGCAGGG + Intronic
927149168 2:20185944-20185966 CCATCTCTGCGGGTGCTGCAGGG + Intergenic
928113185 2:28526724-28526746 TCTGCTGAGCTGGTGCTCCATGG + Intronic
928805070 2:35140615-35140637 GCTTCTGTGCTGGTGGACCATGG - Intergenic
932739770 2:74282715-74282737 CCTTCTTGGCAAGGGCTCCACGG + Intronic
934512174 2:94954250-94954272 CCTCCTGTGCACCTGCTCCAGGG + Intergenic
935891951 2:107688483-107688505 GCCTCTGTGCATGTTCTCCAAGG + Intergenic
937845826 2:126577692-126577714 GTTTCAGTGAAGGTGCTCCAAGG + Intergenic
938303289 2:130230957-130230979 CTGGCTGTGCAGGTACTCCAGGG - Intergenic
938453383 2:131443280-131443302 CTGGCTGTGCAGGTACTCCAGGG + Intergenic
940339089 2:152560951-152560973 CCCTCTGTGCAGGTCCTCGATGG - Exonic
940863662 2:158795494-158795516 CCGTCTGTCGGGGTGCTCCATGG - Intronic
940933669 2:159466827-159466849 TCTTCTCTGCAGGTCCTCAATGG + Intronic
942240792 2:173963683-173963705 CCTTTTGGGCAGGCGCGCCACGG + Intronic
946175359 2:217919132-217919154 CTTGCTGTGGAGATGCTCCAAGG - Intronic
946462077 2:219877752-219877774 TCTTCTCTGCAGGTAATCCAAGG + Intergenic
949007719 2:241659296-241659318 CATGCCGTGCAGGTGCTCCGTGG + Intronic
1168965629 20:1896247-1896269 CCTGCAGTTCAGGTGCTCCGCGG + Intronic
1172271049 20:33656138-33656160 ACCTCTGTGCAGGTGGCCCAGGG + Intergenic
1172287993 20:33754659-33754681 CCTTCTGTGCTGGTCCTCTCTGG - Intronic
1173131108 20:40394415-40394437 CCTCCTCTGCAGATGCTCTATGG + Intergenic
1173326730 20:42040494-42040516 CCTTCTCTAAAGGTGCTCCTAGG + Intergenic
1173771933 20:45667159-45667181 CTCACTGTGCAGGGGCTCCATGG - Exonic
1173791120 20:45828392-45828414 CCATCTGGACAGGTGCCCCAAGG - Intronic
1176272318 20:64242317-64242339 CCTCCTGGGCATGTGCTCCCAGG - Intergenic
1178724235 21:35036977-35036999 TCTTCTGTACATGTGTTCCATGG + Intronic
1179288307 21:39996840-39996862 CCTTCTCTGCAGGAGCACCGTGG - Intergenic
1180054949 21:45352858-45352880 CCATCTGTGGAGGCGCCCCACGG - Intergenic
1184859426 22:47164859-47164881 CCTCCTGCGCAGGGGCTGCAGGG - Intronic
951557867 3:23938804-23938826 CCTCCAATGCAGGTGTTCCATGG - Intronic
953702851 3:45210243-45210265 CCTTCGGTGGAGCTGCCCCAAGG - Intergenic
955352329 3:58203068-58203090 CCTTCTGAGCAGCTCCTCCTGGG + Intronic
959744382 3:109759632-109759654 CCTTCTTTGCAGATGCTGCTGGG - Intergenic
965499230 3:169437727-169437749 CCTTCTCTCCAGGTGCTAAAGGG + Intronic
968795805 4:2703631-2703653 CCTTCTGGGAAAGTGCTCCAAGG - Intronic
969467563 4:7366625-7366647 CCTCCCATGCAGCTGCTCCAAGG + Intronic
972316888 4:37935024-37935046 CCTTCTGTGCAGGTGCTCCAAGG - Intronic
978410466 4:108419224-108419246 ACTCTTGGGCAGGTGCTCCAGGG + Intergenic
979276013 4:118815081-118815103 CCATCTGTGCAGGACCTCCAGGG + Exonic
985171830 4:187158221-187158243 CCTTCTCTGCAGCTCCTCAACGG + Intergenic
986747347 5:10756180-10756202 CCTTCTGTCAAGGTGGCCCATGG - Intronic
989665467 5:43848611-43848633 TCTTCTGTGCAGATGATACAGGG + Intergenic
990432544 5:55750676-55750698 CCTTCTGTGCTGATGCTGCCCGG - Intronic
991009481 5:61868016-61868038 CCATCTTTGCAGGTGCAGCAGGG + Intergenic
995530209 5:113085006-113085028 CCTTCTATGCAGGAGCTGCAAGG - Intronic
997226178 5:132211011-132211033 CTTTCTGGGTAGGTGCTCCCTGG - Intronic
998411237 5:141913161-141913183 CCTTCTCTGCATGTACTACATGG - Intergenic
999323132 5:150626876-150626898 CTCTCTCTCCAGGTGCTCCATGG - Intronic
1002925745 6:1604907-1604929 CCTTCTGGGCAGGAGCCCCGGGG - Intergenic
1005064871 6:21808152-21808174 GCTTCTGTCCTTGTGCTCCATGG + Intergenic
1005852569 6:29832768-29832790 CCTTCAGTGCAGATGCACTAGGG + Intergenic
1005876161 6:30011291-30011313 CCTTCAGTGCAGATGCACTAGGG + Intergenic
1006854684 6:37124621-37124643 CCTTCTGTGCAGATTCGCCTTGG - Intergenic
1011627580 6:89296183-89296205 CCTTCCCTGCAGGTGCTCCTGGG - Intronic
1011668752 6:89661763-89661785 CTTTCTGTGCAGGTTATCCAAGG + Intronic
1016346977 6:143124473-143124495 CCTTCTGTGCACCTGCTCATCGG + Intronic
1017994599 6:159521161-159521183 CCTTCAGTGCAGCTGCCCTATGG - Intergenic
1018777023 6:167026983-167027005 ACTTCTGTGCAGAAGCTTCATGG + Intronic
1018927258 6:168215051-168215073 CCTTCAATGCAGGTGTTCCTTGG + Intergenic
1019322206 7:420874-420896 GCTTCTCTGCAGGGGCTCCGGGG + Intergenic
1019502366 7:1370573-1370595 CCTTCTGTGCAAATACCCCAAGG - Intergenic
1020156713 7:5731575-5731597 ACTACTGTGCAGTTGTTCCAAGG - Intronic
1027516386 7:79147505-79147527 TCATCTGTGCAGGTGCTCTTTGG - Intronic
1028309336 7:89310839-89310861 CCTGCTGTGCAGCTCCTTCATGG - Intronic
1028540828 7:91940797-91940819 CCTCGTGGGCAGGTGCTCCTGGG - Intergenic
1029852601 7:103479901-103479923 GCTTCTGTGCATGTGCACCAAGG - Intronic
1031198807 7:118650870-118650892 ACCTCTGAGCAGGTCCTCCAGGG + Intergenic
1032332904 7:130996633-130996655 ACTCCTGTGGAAGTGCTCCAAGG + Intergenic
1032828025 7:135591510-135591532 CCTTATTTGAAGATGCTCCAGGG + Exonic
1033498950 7:141928212-141928234 ACTTCTGTGCAGGTTCTAAAAGG - Exonic
1033591190 7:142809699-142809721 CCTGCTCTGCAGGAGCTCAAGGG + Intergenic
1033980483 7:147158432-147158454 CCTTTTGTGCATGTAATCCATGG - Intronic
1034411627 7:150945281-150945303 CCTCCTGAGCAGGGCCTCCAAGG + Exonic
1034957990 7:155346578-155346600 CCCTCTGTGTGGGTGCTCTATGG - Intergenic
1035559540 8:594205-594227 CCTAGAGTGCAGGTTCTCCAAGG + Intergenic
1035951054 8:4021545-4021567 CCTTCTGAGCAGGTGCACCTGGG + Intronic
1038493744 8:27987620-27987642 CCTTCTCTGCAGCTGTTGCAGGG - Exonic
1039221768 8:35339609-35339631 CCTTGTGTGCTGCTGCTGCATGG + Intronic
1039409900 8:37344164-37344186 CTTTCTGTCCAGTTGCTCCTTGG + Intergenic
1040711108 8:50189690-50189712 CCTTGTGTCTAGGTGCTGCATGG + Intronic
1040829931 8:51664990-51665012 CCTCCTGTGCGGGTGCTCCCAGG - Intronic
1041691627 8:60693394-60693416 CTCTCTCTGCAGGTGCCCCAAGG - Intronic
1042806439 8:72775624-72775646 GCTTCTCTGCTGTTGCTCCAAGG - Intronic
1049222743 8:141435339-141435361 CCTGCTGTGCGGGTGTTCCCTGG + Intergenic
1049228563 8:141470130-141470152 CCTTCAGGGCAGGTTCTGCAGGG + Intergenic
1049374939 8:142284928-142284950 CCTTCTGTGCAGGAGCACCCAGG - Intronic
1049744191 8:144256290-144256312 CCTCCTGGGCAGGTGCGGCATGG - Intronic
1050019544 9:1268993-1269015 CCCTCTCTGCAGCTGCTCTAAGG + Intergenic
1056221248 9:84452545-84452567 CCTACTGTCCAGGTGTCCCAAGG + Intergenic
1056778908 9:89534593-89534615 CCGTCTGTGGAGGTTTTCCATGG + Intergenic
1056934220 9:90903491-90903513 CCTGCTGGGCAGGTCCTTCAGGG - Intergenic
1060196820 9:121629280-121629302 CCTTCTCCCCAGGTACTCCAGGG - Intronic
1060311513 9:122466729-122466751 CTTTCAGTGAAGGGGCTCCAAGG + Intergenic
1060888744 9:127174969-127174991 CCCTCTGTGCCGGGGCTCCCTGG + Intronic
1062213967 9:135379072-135379094 ACTTCTGAGCAGGGGCTCCCGGG - Intergenic
1187093253 X:16119550-16119572 CCTTCAGAGCAAGTGATCCAAGG + Intergenic
1188224765 X:27583598-27583620 CCTGCTGTGCAGGTGCAGCCTGG - Intergenic
1190435311 X:50418673-50418695 ACTTCTGTGGAGCTTCTCCAGGG - Intronic
1195000856 X:100641948-100641970 ACGTCTGTGCAGAGGCTCCAGGG + Intergenic
1195011498 X:100736266-100736288 CCTTCTTTGCAGGTGGTGCTTGG + Intergenic
1196437721 X:115690028-115690050 CCTTTTCTGGAGGTGCTCCATGG + Intergenic
1198729793 X:139716991-139717013 GCTGCTGTGAAGGTGTTCCATGG - Intergenic
1199240596 X:145543879-145543901 CCCTCTGAGCAGGTGATACAGGG - Intergenic
1199714860 X:150500273-150500295 CCCTCTGTGCTTGTGCTCCTTGG - Intronic
1201065384 Y:10090843-10090865 CCCTTTTTGCAGATGCTCCAGGG + Intergenic