ID: 972316938

View in Genome Browser
Species Human (GRCh38)
Location 4:37935538-37935560
Sequence ACTGTATCTTGGGTTACCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 105}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972316938_972316943 4 Left 972316938 4:37935538-37935560 CCTCTGGTAACCCAAGATACAGT 0: 1
1: 1
2: 0
3: 7
4: 105
Right 972316943 4:37935565-37935587 CTCATCTGGACTACTTTGGCAGG 0: 1
1: 0
2: 0
3: 11
4: 80
972316938_972316941 -10 Left 972316938 4:37935538-37935560 CCTCTGGTAACCCAAGATACAGT 0: 1
1: 1
2: 0
3: 7
4: 105
Right 972316941 4:37935551-37935573 AAGATACAGTATTTCTCATCTGG 0: 1
1: 0
2: 1
3: 23
4: 244
972316938_972316942 0 Left 972316938 4:37935538-37935560 CCTCTGGTAACCCAAGATACAGT 0: 1
1: 1
2: 0
3: 7
4: 105
Right 972316942 4:37935561-37935583 ATTTCTCATCTGGACTACTTTGG 0: 1
1: 0
2: 1
3: 13
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972316938 Original CRISPR ACTGTATCTTGGGTTACCAG AGG (reversed) Intronic
900367206 1:2316138-2316160 ACTGCATCTTGGCTCCCCAGTGG - Intergenic
904058838 1:27690595-27690617 ACTGCATCCTGTTTTACCAGTGG + Intergenic
906999225 1:50833205-50833227 ACTGCATTGTGGGTAACCAGGGG - Intronic
907109170 1:51910798-51910820 TCTGTTTCTGGGGTTAACAGTGG - Exonic
907998861 1:59660350-59660372 GCTGTATCTTGGGGAGCCAGTGG - Intronic
908212482 1:61915293-61915315 GCTGTATCTCAGGTTACAAGGGG + Intronic
911278509 1:95894351-95894373 ACTGCATCCTGTTTTACCAGTGG + Intergenic
911655547 1:100438937-100438959 TCTGTTTCTTGGGTCAGCAGTGG + Intronic
914764764 1:150628386-150628408 ACTGTATCTTTGTTTTCCTGAGG - Intronic
915279094 1:154810228-154810250 ACTGTGCCTTGGGCTGCCAGTGG - Intronic
915745953 1:158158020-158158042 ACTGTATGTTGTTTTATCAGTGG + Intergenic
916293159 1:163188412-163188434 ACTATCTTTTGGGTGACCAGAGG - Intronic
916436656 1:164784072-164784094 CTTGTATCATGGGTTACCACAGG + Intronic
919270521 1:195337252-195337274 ACTGTATCCTCTGTTATCAGTGG + Intergenic
919467866 1:197944256-197944278 GGTCTATCTTGGGGTACCAGAGG + Intergenic
920349854 1:205330535-205330557 ACTGCAGCTTGGGGTTCCAGAGG + Intergenic
920843947 1:209577872-209577894 ACTGTACCTTGGGTGACGTGGGG - Intergenic
1066046034 10:31596397-31596419 ACTGCATCCTGGGATAACAGTGG + Intergenic
1066379733 10:34891074-34891096 ACTGTGTATTGTGTTAGCAGGGG + Intergenic
1076187704 10:128461853-128461875 ACTGTATCCGGGGGCACCAGGGG + Intergenic
1077958824 11:7051082-7051104 TCTGTATCAAGGCTTACCAGCGG - Intronic
1078810147 11:14752046-14752068 ACTGTGACATGGGTTATCAGTGG + Intronic
1085296189 11:75433120-75433142 ACTGGAGCTTGGGCTGCCAGGGG - Intergenic
1088371394 11:109092012-109092034 AATGTATCTTGTATTACCAAAGG - Intergenic
1088397272 11:109382522-109382544 TCTGATTCTTGGTTTACCAGGGG + Intergenic
1089059212 11:115612459-115612481 ACTGTAGATTGGGTTCCCTGCGG + Intergenic
1090317717 11:125809704-125809726 ACTGTATCTTGGATAATAAGAGG + Intergenic
1092656389 12:10689319-10689341 ATTGGATCTTGGGGTAGCAGAGG - Intergenic
1093814179 12:23523595-23523617 TCTTTATCTTTGGTTTCCAGTGG + Intergenic
1094338059 12:29382962-29382984 ACTTAATCTTGTGTTATCAGTGG + Intergenic
1094466254 12:30756114-30756136 ACTGTTTTTTGTGTTACCAAAGG - Intergenic
1098127981 12:67320106-67320128 AATGTATCTAGTGTTACCAGTGG + Intergenic
1098470429 12:70837155-70837177 ACAGTATCTTGGGTTTCTATTGG - Intronic
1098501424 12:71196869-71196891 ACTGGCTTTTGGGTTAACAGAGG + Intronic
1101519788 12:105470984-105471006 ACTGTCTCTGGGGGTAACAGGGG + Intergenic
1101589607 12:106113916-106113938 AGCGTCTCTTGTGTTACCAGAGG - Intronic
1104040125 12:125124387-125124409 ATTGTATCTTGGGGGACCAAAGG - Intronic
1109177414 13:59173493-59173515 ACTGTATCCTGTTTTATCAGTGG - Intergenic
1111222804 13:85226848-85226870 ACTGTAGCCTGGGTGACAAGAGG - Intergenic
1114310566 14:21463014-21463036 ATGGTATCTTCGGTAACCAGTGG - Intronic
1115707017 14:36009175-36009197 ACTCTATTTTGGATTTCCAGTGG - Intergenic
1115777457 14:36731532-36731554 CCTGTAACTTAGGTTACCAAAGG + Intronic
1115902632 14:38170008-38170030 ACTGTATATTGTGTGGCCAGAGG + Intergenic
1117477799 14:56115390-56115412 GCTATTTCTTGGGCTACCAGAGG - Intergenic
1120230171 14:81833296-81833318 ACTGGGTCTTGGGTCAGCAGAGG + Intergenic
1124168067 15:27347110-27347132 ACTGTAGCTTTGGGTGCCAGAGG + Intronic
1126275504 15:46874872-46874894 ATTGTATCAGTGGTTACCAGGGG + Intergenic
1127058322 15:55155115-55155137 GCTGTAACTTGTGTAACCAGAGG - Intergenic
1130792725 15:87172837-87172859 ACTGTCTCCTGGGTAACCAATGG + Intergenic
1144509323 17:15861755-15861777 GCTGTAACCTGGGTGACCAGGGG - Intergenic
1145173436 17:20679402-20679424 GCTGTAACCTGGGTGACCAGGGG - Intergenic
1149185467 17:53992096-53992118 ACTGTCTCCTTGGTGACCAGAGG + Intergenic
1156597276 18:38561978-38562000 AATGTCTCATGGGTTGCCAGAGG - Intergenic
1159664798 18:71145050-71145072 GCTATCTCATGGGTTACCAGTGG - Intergenic
1165476219 19:36032507-36032529 ACTGGATCTTGGGCAACCATAGG + Intronic
930028904 2:47046445-47046467 ATTGTCTCTTGGGTTGCCAGAGG + Intronic
937654850 2:124362972-124362994 GCTGTATCTTGAGTTGCCAAAGG - Intronic
937957191 2:127428012-127428034 TCTGTGTCTGGGGTTTCCAGGGG + Intronic
940197608 2:151113385-151113407 ACTGTATCCTGTTTTATCAGTGG - Intergenic
940604679 2:155905668-155905690 AGTGTACCTTTGGTCACCAGAGG - Intergenic
941173554 2:162169400-162169422 ACTTTATCTAGGGATACCACAGG - Intergenic
941728965 2:168894742-168894764 ACTTTTTCTTGGATTACCAAAGG - Intronic
947752110 2:232538608-232538630 ACTGCATCTAGGGGGACCAGAGG + Intergenic
947946778 2:234110615-234110637 ACTGTTTCTTTTGTTTCCAGTGG + Intergenic
1171243112 20:23587353-23587375 ACTGGTACTTGGGATACCAGCGG - Intergenic
1174738252 20:52985976-52985998 ACTTTCTCTTGACTTACCAGAGG - Intronic
1174747132 20:53074331-53074353 ACTGGATTTTGAGTTTCCAGAGG + Intronic
1177793731 21:25749796-25749818 ACTGCATCTTGGGCAACAAGAGG + Intronic
1184599602 22:45535273-45535295 ACTGTAGCTTGGGTCGGCAGCGG - Exonic
952091342 3:29890247-29890269 ACTGTTTCTTGAGTTAACATTGG + Intronic
957702322 3:83731999-83732021 TCTTTATCTTGGGTTTACAGTGG + Intergenic
962436494 3:135371782-135371804 ACTGTTGCTTGGGTCACCGGAGG + Intergenic
966188401 3:177248505-177248527 ATTGTATCTTGAGTTTCAAGGGG - Intergenic
967511083 3:190313179-190313201 ACTGTATATTGGGTTACCAGCGG - Intronic
968717174 4:2169004-2169026 ACTGTAGTCTGGGTGACCAGAGG + Intronic
969292563 4:6249594-6249616 ACTGTATCTTGAATTACAAGGGG - Intergenic
972316938 4:37935538-37935560 ACTGTATCTTGGGTTACCAGAGG - Intronic
974283729 4:59836129-59836151 ACTTTATCTTGGGTTGGGAGAGG + Intergenic
974588314 4:63910592-63910614 ACTGTATCTTAGGGTAACAGGGG - Intergenic
975029044 4:69590993-69591015 ACTATACCTTGTGTTCCCAGAGG + Intronic
975755472 4:77567592-77567614 ACTGCATCTTGTTTTATCAGAGG - Intronic
978819116 4:112945089-112945111 CATGTATCTTGGGTTGGCAGGGG + Intronic
988680524 5:33480601-33480623 ACATTATCTTGGATTACCTGTGG + Intergenic
992365254 5:76083780-76083802 ACTTTATCTGGGATTCCCAGAGG + Intronic
992938972 5:81743003-81743025 ACAGTATACTGGGTTAACAGAGG - Intronic
1002773234 6:307199-307221 ACTGGTTCTTGTGTTACAAGAGG - Intronic
1003684695 6:8290378-8290400 ACTGTATCTTGGGGGAAAAGGGG - Intergenic
1004236975 6:13882800-13882822 ACTGGGGCTTGGTTTACCAGAGG - Intergenic
1005001677 6:21247973-21247995 ACAGAAGGTTGGGTTACCAGAGG - Intergenic
1009696715 6:67115352-67115374 TCTGTATCCTGGGTTTACAGTGG - Intergenic
1015218447 6:130777254-130777276 CCTGGATTTTTGGTTACCAGAGG - Intergenic
1016342872 6:143081828-143081850 ACTGGAGCTTGGTTTCCCAGAGG + Intronic
1016564217 6:145434787-145434809 ACTGTATCAGTGGTTGCCAGGGG - Intergenic
1017269365 6:152488858-152488880 ACTGTCTTCTGGGTTACCAATGG - Intronic
1020134550 7:5579704-5579726 AGTGTATCGTGGGTGACAAGAGG - Intergenic
1024140611 7:46459716-46459738 ACTGCATCTTGTTTTATCAGTGG + Intergenic
1025867114 7:65393019-65393041 ACTGCAGCTTGGGTGACAAGTGG + Intronic
1030265124 7:107612925-107612947 ACTGTATCCTGGACTAGCAGTGG + Intronic
1030517258 7:110553620-110553642 TCTGTATTTGGAGTTACCAGAGG + Intergenic
1030619809 7:111776750-111776772 ACTTTATCTTTGGTTTTCAGTGG - Intronic
1030620509 7:111785157-111785179 ACTGTTTCTTAGGTTAAGAGTGG + Intronic
1031748858 7:125543816-125543838 ACTGTATGTTGGGATACCACAGG + Intergenic
1032347476 7:131130173-131130195 ACTGTATCTAGGGATACAAAAGG + Intronic
1038385411 8:27139965-27139987 ACTTTATCCTGGGTTATCTGAGG - Intergenic
1043116165 8:76255731-76255753 ACTGTATCTTTGGGTCCCAGTGG - Intergenic
1047655003 8:126967833-126967855 ACTGTGTCTGGGCTTACCAGTGG - Intergenic
1047789392 8:128187155-128187177 ACTGGATGGTGGGTTAGCAGGGG + Intergenic
1049316578 8:141972303-141972325 ACTGTATCTTTCCTGACCAGTGG + Intergenic
1051605481 9:18914106-18914128 TCTGTATATTGTGTTATCAGAGG - Intergenic
1060780264 9:126407066-126407088 ATTTTCTCTTGGGTTATCAGTGG + Intronic
1188995282 X:36877479-36877501 ACTGTAATGTTGGTTACCAGGGG + Intergenic
1192261067 X:69506016-69506038 ACTGTATCGAGGCGTACCAGCGG + Exonic
1195680385 X:107541583-107541605 ACTGAATCTTTGGTTTTCAGTGG + Intronic
1198491619 X:137147124-137147146 ACTCTATCTTAGCTTCCCAGAGG - Intergenic