ID: 972318293

View in Genome Browser
Species Human (GRCh38)
Location 4:37948207-37948229
Sequence AAGGCGGACTGGAGGGCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 241}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972318287_972318293 -5 Left 972318287 4:37948189-37948211 CCATGTCAGAGGAGCAGCAAGGC 0: 1
1: 0
2: 0
3: 17
4: 233
Right 972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 20
4: 241
972318284_972318293 19 Left 972318284 4:37948165-37948187 CCAGAAAGAAGATTATAAGAGGC 0: 1
1: 0
2: 0
3: 14
4: 186
Right 972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG 0: 1
1: 0
2: 4
3: 20
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972318293 Original CRISPR AAGGCGGACTGGAGGGCAGT GGG Intronic
901322000 1:8345719-8345741 AAGGGGCACTGGGAGGCAGTGGG - Intergenic
901343014 1:8512537-8512559 AGGGGAGATTGGAGGGCAGTTGG - Intronic
901757457 1:11449920-11449942 AAGGGGGACTGAAGGGCACACGG + Intergenic
904401512 1:30259803-30259825 AGGGCGACCTGGAGGGCAGGAGG - Intergenic
905226604 1:36482977-36482999 AAGGCGCAAGGGAGGGCAGGAGG - Exonic
905537054 1:38730280-38730302 AAGGTGGATTGGAGGGCAGTGGG + Intergenic
906036545 1:42754018-42754040 AACACAGACTGGTGGGCAGTGGG + Intronic
906744675 1:48213464-48213486 AAGGAGGACTGGAGGGTGGAAGG + Intergenic
906800969 1:48736483-48736505 TAGTCCGACAGGAGGGCAGTGGG + Intronic
907293442 1:53433479-53433501 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
907712913 1:56900962-56900984 AAGGCTGTCTGGAGCTCAGTGGG + Intronic
907962298 1:59295135-59295157 GTGGAGGTCTGGAGGGCAGTGGG + Intergenic
908703303 1:66924904-66924926 GAGGCGGAGGGGAGGGCAGAGGG + Intronic
910736301 1:90461603-90461625 AAGGCCTACTTGAGGGCAGAGGG - Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
913232750 1:116755319-116755341 GAGGCTGACTGGAGAGCAGCGGG + Intronic
915025974 1:152830357-152830379 AAGGGGGAGTGCAGGACAGTGGG + Intergenic
915079742 1:153343991-153344013 AAAGCAGACTGGGGGGCGGTGGG + Intronic
916608796 1:166369620-166369642 AAGGAGGAAAGGAGGGCAGGAGG - Intergenic
916679440 1:167090536-167090558 AAGGGGAACTTGAGGGAAGTAGG - Exonic
920422071 1:205841754-205841776 AGGGAGGAGTGGAGGGCGGTAGG + Intronic
920868781 1:209775659-209775681 AAGGAGGACTGGAGGACCCTTGG + Exonic
921474992 1:215595981-215596003 AAAGTGGACTGGAGGTCAGGAGG + Intronic
921553500 1:216568504-216568526 CTGGCAGACTGGAGGGAAGTTGG - Intronic
923546514 1:234927479-234927501 CAGGCTGGGTGGAGGGCAGTGGG - Intergenic
1064118201 10:12596793-12596815 AAGGGGGACTGGAGGCCAGGAGG - Intronic
1064340957 10:14484856-14484878 AAGGCAGCTTGGAGGGCAGTCGG - Intergenic
1064697975 10:17987423-17987445 AGGCCGGAATGGAGGGCACTGGG + Intronic
1065482984 10:26213352-26213374 AAGAAGGCCTGGAGGGCACTTGG - Intergenic
1066303504 10:34117421-34117443 CACACAGACTGGAGGGCAGTGGG + Intronic
1067166740 10:43871271-43871293 AAGGCTGACCGGAGAGCAGGAGG + Intergenic
1071115195 10:82210461-82210483 AAGGAGAAGTGGAGGGCAGGGGG + Intronic
1071233108 10:83612015-83612037 AAGGAGCACTGGAGGACAATTGG - Intergenic
1071897875 10:90085490-90085512 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1074740631 10:116481907-116481929 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1074764163 10:116688235-116688257 AAGGCTGGCTGGAGGGCTGGTGG - Intronic
1075911113 10:126126581-126126603 AAGGTGGGCTGGAGTGCAATGGG + Intronic
1079284552 11:19117179-19117201 AAGGCGGGCTGGCGGGCTGGCGG + Exonic
1079964394 11:26963197-26963219 AAGGAGGAAAGGAGGGCAGGAGG + Intergenic
1080410031 11:32014573-32014595 AAGGAGGACAGCAGGGCAGAAGG + Intronic
1082005542 11:47417045-47417067 AAGGTGGAATGGGGGGCAGGTGG - Intergenic
1083365501 11:62139417-62139439 AAAGAGGGCTGGAGAGCAGTGGG + Intronic
1084608536 11:70186473-70186495 AGGACAGACAGGAGGGCAGTGGG + Intronic
1085573824 11:77584658-77584680 CATGCAGACTGGAGTGCAGTGGG + Intronic
1088791858 11:113233254-113233276 AAAGCTGAGTGGAGAGCAGTTGG + Exonic
1089257355 11:117200874-117200896 AAGGCAGACATGAGGGCAGGTGG + Intronic
1090288031 11:125517183-125517205 AAGGAGGAAAGGAGGGCAGCTGG - Intergenic
1090461933 11:126898924-126898946 AAGGAGGTTTGGAGGACAGTTGG - Intronic
1092063448 12:5569422-5569444 AAGGAGGACTGGAGGGGTGAGGG - Intronic
1095963018 12:47847193-47847215 GAGAAGGACTGGAGGACAGTAGG - Intronic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1096869177 12:54582869-54582891 AAGGGGGGCTGGAGGGCATGGGG - Intronic
1097114683 12:56688543-56688565 AAGGCGCATGGCAGGGCAGTTGG - Intergenic
1097781264 12:63707643-63707665 AGGGTGGACTAGAGGGTAGTGGG + Intergenic
1098069288 12:66654673-66654695 AAGGAGGAGAGGAGGGCTGTGGG + Intronic
1098251028 12:68569806-68569828 AAGCAAGACTGGAGGGCATTGGG - Intergenic
1100516155 12:95329813-95329835 CACCCAGACTGGAGGGCAGTGGG - Intergenic
1100614342 12:96219589-96219611 TAGGGGGACAGGTGGGCAGTGGG - Intronic
1105829971 13:24155519-24155541 AAGTGGGACTGATGGGCAGTGGG + Intronic
1105974156 13:25458637-25458659 AAGGTGGAGTGGAAGGCAGGAGG + Intronic
1106547522 13:30743511-30743533 GAGGGGGAATGGAGGGCACTGGG - Intronic
1110872773 13:80471820-80471842 AAGAAGGAATGGAGAGCAGTGGG - Intergenic
1110904400 13:80867358-80867380 AAGGCTGGCTTGAGGGGAGTAGG - Intergenic
1111450854 13:88413378-88413400 GAGGCCTACTGGAGGGCAGAGGG + Intergenic
1113815614 13:113168476-113168498 AAGGCAGACAGGAAGGCAGTGGG - Intronic
1113852572 13:113426266-113426288 AAGGCAGGCAGGAGGGCAGTGGG - Intronic
1118039411 14:61900917-61900939 AAGGTGGACTGGATGCCAGGTGG + Intergenic
1120759159 14:88270639-88270661 AAGGCAGACTGGGGGGAAGAGGG + Intronic
1121525153 14:94614356-94614378 CAGGCTGGGTGGAGGGCAGTGGG + Exonic
1121555861 14:94836531-94836553 AAGCCAGACTGGAGGGGAGCAGG - Intergenic
1122030156 14:98906208-98906230 GAGGGGGACTGGATGGCAGGTGG - Intergenic
1122072597 14:99214206-99214228 AATCTGGAGTGGAGGGCAGTAGG - Intronic
1123017348 14:105381773-105381795 AGGGCTGACTGATGGGCAGTGGG - Intronic
1125426622 15:39555610-39555632 GAGGCAGAATAGAGGGCAGTGGG - Intergenic
1125635243 15:41182477-41182499 AAGGCAGGCCTGAGGGCAGTTGG - Intergenic
1129463910 15:75713152-75713174 AAGGCAGAAAGGAGGGAAGTAGG - Intergenic
1130847150 15:87758153-87758175 AAGGAGGACAGGAGGGGAGAAGG + Intergenic
1131164707 15:90134038-90134060 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
1132049705 15:98596836-98596858 CAGGACGACTGGAGGGCAGCAGG - Intergenic
1132335499 15:101045946-101045968 AAGGGGGACTGGTGAACAGTGGG - Intronic
1132367012 15:101265042-101265064 AAGGCCGGCTGGAGGGCAGTGGG - Intergenic
1133048425 16:3102282-3102304 TAGGCGGAGTGCAGGGCACTGGG + Intergenic
1133850665 16:9500373-9500395 GAGGAGCACTGGAGGCCAGTAGG - Intergenic
1134375536 16:13669339-13669361 AAGGTGGTCAGGAGGGCAGATGG + Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1137055532 16:35744765-35744787 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1138158690 16:54731775-54731797 AAGGAGGACTGGAGGGGAGGAGG - Intergenic
1138538040 16:57670129-57670151 AAAGTGGACTGGAGGTCAGAGGG - Intronic
1139614429 16:68080336-68080358 GAGGCTGGCTGGAGGACAGTAGG + Intergenic
1139921249 16:70461760-70461782 AAGGAGGAAGGGAGGGCAGCAGG - Intronic
1141265272 16:82490939-82490961 AAGGAGGAGTGGACAGCAGTAGG + Intergenic
1141530108 16:84640509-84640531 AAGGAGGACTGCAGGGCCCTGGG - Intergenic
1141695300 16:85616248-85616270 GAGGCGGACTGGGGGGCCTTTGG + Intronic
1142501760 17:336957-336979 AATGCTGACGGGAGGGCGGTGGG - Intronic
1142668946 17:1478567-1478589 AAGGCAGAAGGGAGGGCCGTCGG - Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144872065 17:18377820-18377842 AAGGAGGGCAGGAGGGCAGGTGG - Exonic
1145164835 17:20605342-20605364 AAGGCGGCCTGGTGGGGAGGAGG + Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1148868904 17:50643977-50643999 CAGGGGCACTGGAGGGCAGAGGG + Intronic
1153010010 18:529896-529918 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1154158834 18:11965060-11965082 CACACAGACTGGAGGGCAGTGGG - Intergenic
1154307420 18:13240753-13240775 TAGGCGCTCTGGAGGGCAGCTGG - Intronic
1155336492 18:24770387-24770409 AAGGGGGCCAGGAGGGCAGGTGG - Intergenic
1156665327 18:39398609-39398631 CACGCAGGCTGGAGGGCAGTGGG + Intergenic
1156683914 18:39621542-39621564 GAGAGGGAATGGAGGGCAGTTGG - Intergenic
1158667658 18:59447561-59447583 AAGGAAGACTGGGGAGCAGTAGG + Intronic
1159424094 18:68261380-68261402 AAGGAGGCCTGGAGAGCAGCCGG - Intergenic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1164004230 19:21134243-21134265 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1165326097 19:35115432-35115454 AAGGCGGAATTGAGGGGAGGGGG + Intergenic
1165862313 19:38915709-38915731 AGGTAGGACTGGAGGGCAGGGGG + Exonic
1166054132 19:40278648-40278670 AAGGGGCTCTGCAGGGCAGTGGG - Intronic
1166074802 19:40407862-40407884 AAGGCGCACTTGAGGGCAATGGG - Intronic
1167429435 19:49446148-49446170 AAGGGAGACTGGAGGCCAGGAGG + Intergenic
928189399 2:29148212-29148234 AAGGTGGAGGGGAGGGGAGTTGG + Intronic
929024875 2:37590576-37590598 AAGGCGGAGAGGAGAGGAGTTGG - Intergenic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
933047384 2:77556549-77556571 AAGGAGGGCTGTAGGGCAGTGGG - Intronic
937964167 2:127488585-127488607 AGGATGGATTGGAGGGCAGTGGG - Intronic
938899729 2:135789879-135789901 AAGGCGGTGGGGAGAGCAGTAGG - Intronic
941239957 2:163024994-163025016 AGGGCCTACTGGAGGGCAGAGGG + Intergenic
943430075 2:187788647-187788669 AAGGTGGGGTGGAGGGGAGTGGG + Intergenic
943835004 2:192507301-192507323 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
944591328 2:201220453-201220475 AAAGCAGACTGGAGGGGGGTGGG + Exonic
944707129 2:202301700-202301722 AAGGCGTTTTGGAGGGCAGATGG - Intronic
946322399 2:218961493-218961515 AAGGCAGACAGGAGGGAAGATGG - Exonic
946409915 2:219510754-219510776 AAGGAGTACTGGCGGACAGTGGG + Intergenic
947412568 2:229856598-229856620 GAGGCAGACTGGAAGGCAGAAGG + Intronic
949075760 2:242056763-242056785 CAGGGGGACTGGAGGGCCGTGGG + Intergenic
1169144723 20:3244857-3244879 AGGCCTGACAGGAGGGCAGTGGG - Intergenic
1169485392 20:6026855-6026877 AAGGGGCACTGGAGTGCAATAGG - Intronic
1170958381 20:21002575-21002597 AAGGCGGGGTGGCGGGGAGTGGG - Intergenic
1173253302 20:41375783-41375805 AAGGCTGTCTGGAGGGCAGCAGG + Intergenic
1173791114 20:45828359-45828381 AATCCTGACTGGAGGGAAGTTGG + Intronic
1175442462 20:59001413-59001435 AAGAGGGAGTGGAGGGCAGGAGG + Intronic
1176093387 20:63328817-63328839 AAGGAGGACAGGAGGGCGGGAGG - Intronic
1178669109 21:34575317-34575339 AAGGAGGAAAGGAGGGAAGTGGG - Intronic
1179427114 21:41290421-41290443 AAGCGGGGCTGCAGGGCAGTGGG - Intergenic
1181036363 22:20171632-20171654 AGGGAGGGCTGGAGGGGAGTGGG + Intergenic
1181869327 22:25885614-25885636 AAGCCGGACTGGATCGCAGGGGG + Intronic
1184113734 22:42410001-42410023 AAGGAGGACTGGATGCCAGCAGG - Intronic
1184630966 22:45779421-45779443 AAGACGGACTGGAAGGAAGAGGG + Intronic
949538934 3:5017307-5017329 AAGGTGGACAGGAGAGAAGTTGG + Intergenic
950747529 3:15102387-15102409 AGGCCAGCCTGGAGGGCAGTTGG - Intergenic
952663604 3:35878801-35878823 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
952960961 3:38588862-38588884 GAGGTGGGCTGGAGGGCAGCGGG + Intronic
953190117 3:40677950-40677972 AAGGTGCACTGGTGGGCAGACGG - Intergenic
953599582 3:44349458-44349480 AAGGAGGAATGGAGGGTAGAAGG + Intronic
954071239 3:48144272-48144294 TAGGCTGACTGGTGGGAAGTTGG - Intergenic
954648430 3:52145276-52145298 AAGGCAGGGTGGCGGGCAGTGGG - Intronic
956675229 3:71725904-71725926 AAGGAGGGATGGAGGGCAGATGG + Intronic
958806714 3:98819774-98819796 AAGGAGGACTGGATTGAAGTTGG - Intronic
959619975 3:108389509-108389531 AAGCAGGACTGGAGGGTTGTGGG - Intronic
962368502 3:134801920-134801942 AGGGAGGCCTGGAGGGCAGTGGG + Intronic
962425977 3:135269809-135269831 AAGGTGGACTGGAGGGGTGGTGG + Intergenic
962803829 3:138913169-138913191 AGGGAGGACTGGAGGGGACTTGG - Intergenic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
967290868 3:187918867-187918889 AGGGAGGAGTGGGGGGCAGTTGG + Intergenic
968089770 3:195892780-195892802 AGGGCGGCCGGGCGGGCAGTTGG - Intronic
968173801 3:196531341-196531363 AAGGCGGGCAGGCGGGCAGGCGG - Intergenic
968817715 4:2830286-2830308 AAGGCGGACTGGAGGCAACCGGG - Intronic
971018073 4:22508966-22508988 AAGGCAGGCGTGAGGGCAGTGGG - Intronic
972318293 4:37948207-37948229 AAGGCGGACTGGAGGGCAGTGGG + Intronic
972739767 4:41878627-41878649 GAGGCAGAGCGGAGGGCAGTGGG - Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
977062657 4:92275943-92275965 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
980802085 4:137765214-137765236 AGGAAGGACTGGAGGGCAGGTGG - Intergenic
981040110 4:140214826-140214848 AAGGAGGAATGGAGGGTAGAAGG - Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
986502439 5:8414982-8415004 AAGGAGGAATGGAAGGCAGAAGG - Intergenic
987594328 5:19976619-19976641 AATGAGGACTGGAGGGGATTGGG + Intronic
989615304 5:43332426-43332448 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
992073530 5:73170572-73170594 GAGGCTGATTGGAGGGCAGGAGG + Intergenic
992452200 5:76885204-76885226 AAGGAGGAATGGAGGGTAGAAGG + Intronic
992561624 5:77958104-77958126 CGGGCGGCCGGGAGGGCAGTTGG + Intergenic
993011058 5:82483508-82483530 AAGATGGCCTGGAGTGCAGTGGG + Intergenic
994596400 5:101843227-101843249 AAGGAGGAAAGGAGGGAAGTAGG + Intergenic
994699083 5:103110953-103110975 GTGGCAGATTGGAGGGCAGTAGG - Intronic
994879969 5:105478137-105478159 CACGCAGACTGGAGTGCAGTAGG + Intergenic
996509759 5:124305034-124305056 AAGGAGGACTGGAGGGTGGAAGG - Intergenic
996575161 5:124971079-124971101 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
996872643 5:128208743-128208765 AAGTTGTACTGGAGAGCAGTAGG - Intergenic
998348642 5:141486353-141486375 AAGGCAGACTTGAGGGCAAATGG - Exonic
998460651 5:142307672-142307694 AAGGCTGTCTGGAGAGCTGTAGG + Intergenic
999400363 5:151259393-151259415 AAGGCTGGCTGGAGAGGAGTGGG + Intronic
1000950630 5:167477827-167477849 AAGGAGGAAAGGAGGGCAATAGG + Intronic
1001855363 5:175005703-175005725 AAAGCAGAGTGGGGGGCAGTGGG - Intergenic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002332624 5:178455085-178455107 AAGTCAGACTGGAGGGGAGCAGG - Intronic
1002820128 6:717126-717148 AAGGCTGACCGGAGGGCAGGGGG + Intergenic
1003157296 6:3607607-3607629 AAGGAGGTCTGATGGGCAGTAGG + Intergenic
1003194293 6:3901472-3901494 AGGGAGGACTTGAGGACAGTGGG + Intergenic
1003498738 6:6687036-6687058 AAGGCGGACTGGAGGGGGCGGGG - Intergenic
1003499087 6:6689568-6689590 AAGACAGACAGGAGGACAGTTGG - Intergenic
1005786728 6:29251690-29251712 AAAGGGGAATGGAGGGCAGAAGG + Intergenic
1006950631 6:37819308-37819330 AAGGCGGAGTGCGGGGCTGTGGG - Intergenic
1007199552 6:40095190-40095212 AAGGGGGATGGGAGGGGAGTTGG - Intergenic
1007842842 6:44730799-44730821 CAGGGGGGCTGGAGGGAAGTAGG - Intergenic
1008952578 6:57176616-57176638 AAGGCTGACAGGAAGGCAGAAGG - Intronic
1009893325 6:69715776-69715798 AGGGCCCACTGGAGGGCAGAGGG - Intronic
1011363646 6:86555392-86555414 AAAGGGGACTGGTGGGCAGATGG + Intergenic
1014794138 6:125706313-125706335 AAGGAGGAATGGAGGGTAGAAGG + Intergenic
1015540111 6:134305317-134305339 CAGGCTGGCTGGAGTGCAGTGGG - Intronic
1016443752 6:144111313-144111335 AAGGTGCACTGCAGGGCAGCGGG + Intergenic
1019493708 7:1326594-1326616 AGGGCGGGCTGGGGGGCAGTGGG - Intergenic
1020541274 7:9462967-9462989 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
1022107601 7:27208054-27208076 AAGCCTGGCTGGGGGGCAGTGGG + Intergenic
1022939853 7:35223708-35223730 AGGGTGGACTAGAGGGTAGTGGG + Intronic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023845161 7:44116341-44116363 AAGGCAGGCAGGAGGGCAGGGGG - Intronic
1025739723 7:64184575-64184597 CAGGTGGACTGCAGCGCAGTGGG + Intronic
1025977303 7:66379095-66379117 CAGGCTGACTGGAGGACATTTGG + Intronic
1026001052 7:66558903-66558925 CAGGTGGACTGCAGCGCAGTGGG + Intergenic
1026815968 7:73512147-73512169 AAGGTGGACTGGAGGGCTGTGGG - Intronic
1028658820 7:93242948-93242970 AAGGAGAACTGAAGGGCACTAGG + Intronic
1028659560 7:93253721-93253743 CAGGTGGCATGGAGGGCAGTGGG + Intronic
1029546438 7:101212758-101212780 ACAGCGGACTGGGGGGCGGTGGG - Intronic
1030147610 7:106372257-106372279 AAGACGGACTGAAGAACAGTGGG + Intergenic
1031357457 7:120804758-120804780 AGGTCCGACTGGAGGACAGTGGG + Intronic
1033414345 7:141148996-141149018 AAGATGAAGTGGAGGGCAGTAGG + Intronic
1037994660 8:23343464-23343486 AAGCCGGGCTGGAAGGCAGGAGG + Intronic
1038303287 8:26375974-26375996 CACCCAGACTGGAGGGCAGTAGG + Intergenic
1039499149 8:38003160-38003182 AAGGAGGAATGGAGGGCAGAAGG + Intergenic
1040610741 8:48979126-48979148 AAGGCGGACTGGCCGCCAGAGGG + Intergenic
1041722952 8:60992878-60992900 GAGGTGGTCTGGAGGGCATTAGG + Intergenic
1043016906 8:74950260-74950282 AAGGCGGTCTTGAGGGCACAGGG - Intergenic
1043597605 8:81902998-81903020 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1044208725 8:89523501-89523523 CACCCAGACTGGAGGGCAGTGGG + Intergenic
1045274573 8:100691471-100691493 CAGGCAGGCTGGAGTGCAGTGGG - Intronic
1046724060 8:117655506-117655528 AAGGCTGAGTGGAGGGCAGGGGG - Intergenic
1047915728 8:129582130-129582152 AAGGCTGAAAGGAGGGCACTGGG - Intergenic
1048742556 8:137578237-137578259 AAGGAGGAATGGAGGGAAGGAGG - Intergenic
1049190467 8:141284768-141284790 AAGAAGGACTGAAGGGCAGGAGG + Intronic
1049702410 8:144021204-144021226 AAGGCGGTCTTGAGGGGAGGGGG - Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1051911222 9:22155061-22155083 CAGGTGGACTGCAGCGCAGTGGG + Intergenic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055627377 9:78188000-78188022 AAGGCAGAAGGGAGGGAAGTTGG - Intergenic
1056547468 9:87624697-87624719 AAAGCTGACTCGAGGTCAGTCGG - Intronic
1056655131 9:88502840-88502862 AAGATGGACAGGAGGGCAGCGGG + Intergenic
1060319022 9:122538140-122538162 CAGGGGGACTGGGGGGCTGTTGG - Intergenic
1060530538 9:124344924-124344946 AAGGGTGACTGGAGGCCAGGAGG - Intronic
1060716113 9:125930780-125930802 AGGATGGGCTGGAGGGCAGTAGG - Intronic
1060867406 9:127011164-127011186 AAGGCGGGCTGGGGGGTGGTGGG - Intronic
1061369817 9:130191948-130191970 ATGGGGGGCTGGAGGGCAGAAGG + Intronic
1061416084 9:130447594-130447616 AAGGAGGGCTGGAGGGCAGTGGG + Intronic
1062545735 9:137063094-137063116 CAGGTGGACTGCAGCGCAGTGGG - Exonic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1185581241 X:1212975-1212997 AAGGGGGAGGGGAGGGGAGTGGG - Intergenic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1188177579 X:27010967-27010989 AAGGGGGACTGGAGAGAAGGGGG - Intergenic
1188463522 X:30453522-30453544 AAGGGGGAATGGAGGGTAGAAGG + Intergenic
1188927370 X:36061149-36061171 AAGGAGGAAGAGAGGGCAGTGGG - Intronic
1189567905 X:42262319-42262341 AAGGCAGACAGCAGGGTAGTTGG + Intergenic
1190750578 X:53358271-53358293 AGTGCGGAGGGGAGGGCAGTGGG - Intergenic
1190988618 X:55522782-55522804 AAGGAAGTCTGGAGGGCTGTAGG - Intergenic
1193127934 X:77889410-77889432 CAGGCTGGCTGGAGTGCAGTGGG + Intronic
1194167028 X:90529875-90529897 AAGGCGGGGTGGCGGGGAGTGGG + Intergenic
1195825384 X:108994488-108994510 AAGACGGGCTGGAAAGCAGTGGG - Intergenic
1196469703 X:116011566-116011588 AAGGAGGAATGGAGGGCAGAAGG - Intergenic
1197783622 X:130179545-130179567 CAGGAGGAATGGAGGTCAGTAGG - Intronic
1199311807 X:146329646-146329668 AAAGCAGACTGGGGGGCAGGGGG - Intergenic
1200063288 X:153493192-153493214 AAAGCGGATTTGTGGGCAGTGGG - Intronic
1200513296 Y:4107650-4107672 AAGGCGGGGTGGCGGGGAGTCGG + Intergenic