ID: 972319970

View in Genome Browser
Species Human (GRCh38)
Location 4:37964547-37964569
Sequence GTGCCTGCCTTCCCGAGATC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972319966_972319970 7 Left 972319966 4:37964517-37964539 CCTGACCAGTTTTTCACAGAAAG 0: 1
1: 0
2: 2
3: 13
4: 161
Right 972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG No data
972319964_972319970 19 Left 972319964 4:37964505-37964527 CCTGTCCACTAGCCTGACCAGTT 0: 1
1: 0
2: 0
3: 2
4: 71
Right 972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG No data
972319965_972319970 14 Left 972319965 4:37964510-37964532 CCACTAGCCTGACCAGTTTTTCA 0: 1
1: 0
2: 0
3: 12
4: 140
Right 972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG No data
972319968_972319970 2 Left 972319968 4:37964522-37964544 CCAGTTTTTCACAGAAAGGACCA 0: 1
1: 0
2: 2
3: 19
4: 202
Right 972319970 4:37964547-37964569 GTGCCTGCCTTCCCGAGATCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972319970 Original CRISPR GTGCCTGCCTTCCCGAGATC CGG Intronic
No off target data available for this crispr