ID: 972322925

View in Genome Browser
Species Human (GRCh38)
Location 4:37989438-37989460
Sequence AGCTTGCTTTATACATTTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 800
Summary {0: 5, 1: 10, 2: 31, 3: 82, 4: 672}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972322925_972322931 11 Left 972322925 4:37989438-37989460 CCCTAAAATGTATAAAGCAAGCT 0: 5
1: 10
2: 31
3: 82
4: 672
Right 972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG No data
972322925_972322935 22 Left 972322925 4:37989438-37989460 CCCTAAAATGTATAAAGCAAGCT 0: 5
1: 10
2: 31
3: 82
4: 672
Right 972322935 4:37989483-37989505 CGTGTTCTCAGGACCTCCTGGGG 0: 17
1: 409
2: 736
3: 1187
4: 1184
972322925_972322934 21 Left 972322925 4:37989438-37989460 CCCTAAAATGTATAAAGCAAGCT 0: 5
1: 10
2: 31
3: 82
4: 672
Right 972322934 4:37989482-37989504 ACGTGTTCTCAGGACCTCCTGGG No data
972322925_972322933 20 Left 972322925 4:37989438-37989460 CCCTAAAATGTATAAAGCAAGCT 0: 5
1: 10
2: 31
3: 82
4: 672
Right 972322933 4:37989481-37989503 CACGTGTTCTCAGGACCTCCTGG 0: 3
1: 27
2: 88
3: 162
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972322925 Original CRISPR AGCTTGCTTTATACATTTTA GGG (reversed) Intronic
900831355 1:4967932-4967954 AGCTGGCTTTATACATTTTAGGG + Intergenic
900921057 1:5670975-5670997 AACTGACATTATACATTTTATGG + Intergenic
901178659 1:7324146-7324168 ATGTTGCTTTAAAGATTTTAAGG + Intronic
901280356 1:8028685-8028707 AACTTGATTTATTCATTTTTTGG + Intergenic
903309495 1:22443297-22443319 AGTTTGGTTTATTCATTTTAGGG + Intergenic
903392536 1:22974711-22974733 GGCTGATTTTATACATTTTAGGG - Intergenic
903567164 1:24276406-24276428 AGCTTACTGCAGACATTTTAAGG - Intergenic
905444681 1:38018924-38018946 AACTTGCTTTATTCTTTTAAAGG - Intronic
905930890 1:41786713-41786735 AGCTTATATTATACATTTTTTGG - Intronic
907145447 1:52226683-52226705 ACTTGGTTTTATACATTTTAGGG + Intronic
908308291 1:62848157-62848179 TGTTTGTTTTATACATTTTGAGG + Intronic
908662142 1:66448335-66448357 GGTTGGTTTTATACATTTTAGGG - Intergenic
908702623 1:66919115-66919137 TCTTTGTTTTATACATTTTAGGG - Intronic
909314810 1:74202400-74202422 AGATTGTTTTACACATTTTTAGG - Intronic
909828829 1:80159940-80159962 GGTTGGTTTTATACATTTTAGGG + Intergenic
911611132 1:99960191-99960213 GGCCTGTTTTATATATTTTAGGG + Intergenic
911939652 1:104025835-104025857 AGCTTGCTTTATATATTTAGGGG - Intergenic
912810695 1:112792133-112792155 ACTTGGCTTTATACATTTTAGGG + Intergenic
913364430 1:118020545-118020567 ATTTTTCTTTATATATTTTAAGG - Intronic
913679373 1:121174206-121174228 AGGTTGGTTTATAAAGTTTAAGG + Intronic
914031204 1:143961855-143961877 AGGTTGGTTTATAAAGTTTAAGG + Intronic
914158244 1:145106108-145106130 AGGTTGGTTTATAAAGTTTAAGG - Intronic
915262956 1:154692157-154692179 TGTTTGCTTTATATATTTTAAGG + Intergenic
915652875 1:157331841-157331863 ACTTGGTTTTATACATTTTAGGG - Intergenic
915990202 1:160507374-160507396 TGTTTGCTTTATATATTTTGGGG - Intronic
916709262 1:167388097-167388119 AGCTTCCTTTATAAAATTTGAGG + Intronic
916797179 1:168178161-168178183 TCTTTGTTTTATACATTTTAGGG - Intergenic
916935451 1:169623562-169623584 AACTTGTTTTAAACATTTGAAGG + Intronic
917064152 1:171073624-171073646 AACATGGTGTATACATTTTAGGG - Intergenic
917458326 1:175205000-175205022 ACTTGGTTTTATACATTTTATGG + Intergenic
917540802 1:175912257-175912279 AGCTTTCTTTTTACATTTGGGGG + Intergenic
917984846 1:180305759-180305781 AGCATGATTTATACTTTTTTGGG - Intronic
918219049 1:182418974-182418996 AACTTGCTTTAGGCATTTAAGGG + Intergenic
918540706 1:185629272-185629294 AGCTTTCTTACTCCATTTTAAGG - Intergenic
918735351 1:188055107-188055129 AGTCTACTTTATTCATTTTAGGG - Intergenic
919168951 1:193929822-193929844 AGCTGGTTTTATGCATTTTAAGG - Intergenic
919266457 1:195273438-195273460 ACCATGATTTAAACATTTTAAGG + Intergenic
919503592 1:198369404-198369426 ACCTAGTTTTACACATTTTAGGG - Intergenic
919530768 1:198716868-198716890 ACCTTGCTTTTTACCATTTATGG - Intronic
920466674 1:206192749-206192771 AGGTTGGTTTATAAAGTTTAAGG + Intronic
921001923 1:211052786-211052808 GGCTTGCTATACACATTTTCTGG - Intronic
921635594 1:217488384-217488406 TCTTTGCTTTATACATTTTGAGG + Intronic
921665771 1:217869101-217869123 ACTTGGTTTTATACATTTTAAGG + Exonic
921760303 1:218906007-218906029 ATCCTGCTTTATTCTTTTTAAGG + Intergenic
922906366 1:229176410-229176432 AGATGGCTTTTGACATTTTAGGG - Intergenic
923754701 1:236780990-236781012 TTTTTGCTTTATATATTTTAGGG - Intergenic
923755730 1:236789527-236789549 GCTTTGTTTTATACATTTTAGGG + Intergenic
924272527 1:242348728-242348750 ACTTGGTTTTATACATTTTAGGG + Intronic
924774370 1:247105509-247105531 TGACAGCTTTATACATTTTAGGG + Intergenic
1063391949 10:5655599-5655621 AGCTTGACTTTTACATTTTGTGG - Intronic
1063773627 10:9233944-9233966 AACTTACTATATACATTTCAAGG - Intergenic
1063848476 10:10159343-10159365 GCTTTGGTTTATACATTTTAGGG + Intergenic
1063886923 10:10589062-10589084 ACTTGGTTTTATACATTTTAGGG + Intergenic
1064160856 10:12944546-12944568 AGCTTGGTTTATACATTTTAAGG - Intronic
1064628754 10:17287596-17287618 GGCCGGTTTTATACATTTTATGG - Intergenic
1064637635 10:17385769-17385791 GCCTGGTTTTATACATTTTAGGG - Intronic
1065057940 10:21866528-21866550 ATTTTGCTTTATATATTTTAAGG - Intronic
1065058219 10:21869510-21869532 ACTTGGTTTTATACATTTTAGGG - Intronic
1065365694 10:24934749-24934771 ACTTGGTTTTATACATTTTAGGG - Intronic
1065448939 10:25834817-25834839 ATCTTGCTTTATTCATTTATGGG + Intergenic
1065548821 10:26849625-26849647 GGCTTACTTTATTCATTTTTAGG - Intronic
1065609697 10:27460824-27460846 ATTTGGTTTTATACATTTTAGGG + Intergenic
1066040277 10:31542425-31542447 TTTTGGCTTTATACATTTTAGGG - Intergenic
1066364982 10:34768270-34768292 ACTTGGTTTTATACATTTTAGGG + Intronic
1067395414 10:45912105-45912127 GCTTGGCTTTATACATTTTAGGG - Intergenic
1067856250 10:49796092-49796114 GCCTAGTTTTATACATTTTAGGG + Intergenic
1067863735 10:49881229-49881251 GCTTGGCTTTATACATTTTAGGG - Intronic
1068365036 10:56037057-56037079 ACTTGGTTTTATACATTTTAGGG + Intergenic
1068438461 10:57020229-57020251 ACTTGGTTTTATACATTTTAGGG + Intergenic
1069248778 10:66243647-66243669 ACTTGGTTTTATACATTTTAGGG - Intronic
1069401905 10:68057280-68057302 ACCATGCATTCTACATTTTAAGG + Intronic
1070047486 10:72853475-72853497 GGCTTTCTTCATACATTTCAGGG - Intronic
1070956455 10:80466797-80466819 GTTTTGTTTTATACATTTTAAGG + Intronic
1071111373 10:82161429-82161451 TGATTGCTTTATATATTTAATGG - Intronic
1071223485 10:83497592-83497614 AGCTGGTTTTATACATTTTAGGG - Intergenic
1071426917 10:85566490-85566512 GCCTAGTTTTATACATTTTAGGG - Intergenic
1071674115 10:87638798-87638820 AGTTTGGTTTATACATTTTAGGG + Intergenic
1071826006 10:89326922-89326944 ACTTGGTTTTATACATTTTAGGG + Intronic
1071994031 10:91129219-91129241 ACATTAATTTATACATTTTACGG + Intergenic
1073483775 10:103803847-103803869 AGCCTGCGTTATACATTTTAGGG + Intronic
1073926965 10:108527777-108527799 ATGTGGTTTTATACATTTTAGGG - Intergenic
1074649129 10:115499543-115499565 GTCTGGTTTTATACATTTTAGGG + Intronic
1074821047 10:117178743-117178765 ACTTGGTTTTATACATTTTAGGG - Intergenic
1076709566 10:132324779-132324801 AGATGGTTTTATACATTTTAGGG + Intronic
1076997525 11:305874-305896 AGCTGGTTTTATACATTTCAGGG - Intergenic
1077471690 11:2765625-2765647 AGTTTGCTTTATGTATTTTAAGG + Intronic
1077857227 11:6140335-6140357 ATTTTGCTTCATACATTTTGGGG - Intergenic
1077859416 11:6161684-6161706 ATTTGGTTTTATACATTTTAGGG + Intergenic
1078129094 11:8597173-8597195 ATCTTTCTGTATATATTTTAGGG - Intergenic
1079420899 11:20286889-20286911 AGTTTGTTTTATACATTTTAGGG + Intergenic
1079483958 11:20914269-20914291 ACCTTGCTTTATACATCTTAGGG + Intronic
1079620294 11:22545945-22545967 TTCTTTCTTTATATATTTTATGG + Intergenic
1080045243 11:27801116-27801138 GCCTAGTTTTATACATTTTATGG + Intergenic
1081379621 11:42398753-42398775 ACTTGGTTTTATACATTTTAGGG + Intergenic
1081529781 11:43950233-43950255 GGTTGGTTTTATACATTTTAGGG - Intergenic
1081530702 11:43957196-43957218 GCTTGGCTTTATACATTTTAGGG + Intergenic
1082949641 11:58798891-58798913 AATTTGGTTTATACATTCTAGGG + Intergenic
1084220064 11:67672485-67672507 AGCTTGGTTTACACACTTTAGGG - Intronic
1084756353 11:71241284-71241306 AGCTCAGTTTATACATTCTATGG - Intronic
1085635411 11:78155634-78155656 ACCTTGCTTTTTAAATTTAATGG + Intergenic
1085758619 11:79222764-79222786 AGCTTTTTTTATACATTTGCTGG + Intronic
1085796193 11:79542227-79542249 AGCTGGTTTTATACACTTCAGGG - Intergenic
1085956910 11:81409182-81409204 AACTTGCTTTGTACTTTATATGG + Intergenic
1086283051 11:85213302-85213324 ACTTGGTTTTATACATTTTAGGG + Intronic
1087037564 11:93770507-93770529 CGTTGGTTTTATACATTTTAGGG - Intronic
1087203873 11:95373593-95373615 AGTTTGGATGATACATTTTATGG - Intergenic
1087419261 11:97899958-97899980 AGTTTGGTTTAGACATGTTATGG - Intergenic
1087471981 11:98587172-98587194 GGTTGGTTTTATACATTTTAGGG + Intergenic
1088044815 11:105436343-105436365 TGTTTGCTTTATACATGTTTAGG + Intergenic
1088432414 11:109773376-109773398 GGCTTGTTTAATACATTTTATGG + Intergenic
1088486414 11:110344961-110344983 AGCTTGTATTGTAAATTTTATGG + Intergenic
1089839985 11:121408062-121408084 GTTTTGTTTTATACATTTTAGGG - Intergenic
1090027848 11:123182967-123182989 AGCTTGCATTTTATATGTTATGG - Intronic
1090099723 11:123781483-123781505 GCCTAGTTTTATACATTTTAGGG - Intergenic
1090100265 11:123788018-123788040 ATTTGGTTTTATACATTTTAGGG + Intergenic
1090348287 11:126088944-126088966 AGCTTGCTTTACATATTTTTGGG - Intergenic
1091362810 11:134991580-134991602 AGCTTGGTTTATACTTTTTGTGG - Intergenic
1091466715 12:691236-691258 GCCTGGTTTTATACATTTTAGGG - Intergenic
1092066736 12:5596498-5596520 AGATTGTTTTATTCATTTTAAGG + Intronic
1092574257 12:9762201-9762223 AGAATGCTTTATACATAATATGG + Intergenic
1093028723 12:14268570-14268592 AGCTTGGTTTATACATTTTGGGG - Intergenic
1093136756 12:15461357-15461379 ACCTTGGTTTATACATTTTAGGG - Intronic
1093462393 12:19418690-19418712 GCTTGGCTTTATACATTTTAGGG - Intronic
1094468310 12:30778376-30778398 ACTTGGTTTTATACATTTTAGGG - Intergenic
1094655281 12:32413683-32413705 ACTTGGTTTTATACATTTTAGGG - Intronic
1095180495 12:39142612-39142634 AGCTTACTTTACACGTTTTAGGG - Intergenic
1095209645 12:39477303-39477325 GTCTGGTTTTATACATTTTAGGG - Intergenic
1095221008 12:39614564-39614586 ATGATGCTTTATATATTTTAAGG - Intronic
1095999561 12:48117810-48117832 AGTTGGTTTTATAAATTTTAGGG + Intronic
1096026371 12:48366663-48366685 TTTTTGCTTTATATATTTTAAGG + Intergenic
1096510875 12:52127606-52127628 AGCTTGCATTATGCTTGTTATGG + Intergenic
1096511179 12:52129937-52129959 AGCTTGCATTATGCTTGTTATGG + Intergenic
1097005076 12:55910736-55910758 ACCTGGTTTTATATATTTTAGGG + Intronic
1097595918 12:61630704-61630726 ACTTGGTTTTATACATTTTAGGG + Intergenic
1097718054 12:62988153-62988175 AGTTTGCTTAATCCATTTTTAGG - Intergenic
1098182547 12:67863267-67863289 ACTTGGTTTTATACATTTTAGGG + Intergenic
1098291727 12:68962979-68963001 ACTTTGTTTTATACATTTTAGGG - Intronic
1098296197 12:69006506-69006528 ACTTGGTTTTATACATTTTAGGG - Intergenic
1098831083 12:75363821-75363843 AACTTGTTTTTTACATTTTAAGG + Intronic
1098927504 12:76367195-76367217 AGTTTGCTTTGTATATTTTGGGG + Intronic
1100392325 12:94154624-94154646 AGCTTGCTCCATACAGGTTAGGG - Intronic
1100627451 12:96349918-96349940 AGTTTTCTTTCTACATCTTAAGG - Intronic
1100681117 12:96922169-96922191 ATCTCGCTTTCTGCATTTTATGG + Intronic
1100808854 12:98317041-98317063 GTTTTGCTTTATATATTTTAAGG - Intergenic
1100855252 12:98752172-98752194 GCTTGGCTTTATACATTTTAGGG - Intronic
1100929715 12:99592798-99592820 GCCTAGTTTTATACATTTTAGGG + Intronic
1101163499 12:102004693-102004715 ACTTGGTTTTATACATTTTACGG - Intronic
1101237878 12:102807623-102807645 AACATGCTTGATAGATTTTATGG - Intergenic
1101698993 12:107154004-107154026 ATCCTGCATTATACATTTAAAGG + Intergenic
1102129271 12:110512757-110512779 AGGTGGCTTTATTCTTTTTAAGG + Exonic
1102141277 12:110617316-110617338 AGAGTGCATTATACCTTTTACGG + Intronic
1102416002 12:112763388-112763410 ACTTGGCTTTATACATTTTAGGG + Intronic
1103228037 12:119304782-119304804 AGTTTGGTTTATACATTTTAGGG + Intergenic
1103877766 12:124141861-124141883 GCTTGGCTTTATACATTTTAGGG + Intronic
1104169217 12:126263641-126263663 AGCATGATTTATAAGTTTTAGGG - Intergenic
1104204126 12:126620048-126620070 ACTTGACTTTATACATTTTAGGG + Intergenic
1104321619 12:127756818-127756840 GTTTGGCTTTATACATTTTAGGG - Intergenic
1104530611 12:129567017-129567039 AGCTGGTTTTATACGTTTTAGGG - Intronic
1104680903 12:130750889-130750911 GCTTGGCTTTATACATTTTAGGG + Intergenic
1105468548 13:20670355-20670377 AGGTTTCTTTCTACATTTTATGG - Intronic
1105479266 13:20758443-20758465 AATTGGCTTTATATATTTTAAGG - Intronic
1105655978 13:22439120-22439142 GCTTTGTTTTATACATTTTAAGG + Intergenic
1105769902 13:23599445-23599467 AGTTGGTTTTATACAATTTAGGG + Intronic
1105812793 13:24009459-24009481 GCCTAGTTTTATACATTTTAGGG + Intronic
1106380691 13:29235582-29235604 TGCATGCTTTGTTCATTTTAAGG + Intronic
1107512831 13:41102339-41102361 ACTTTGTTTTATACATTTTAGGG - Intergenic
1107669683 13:42732036-42732058 GGCTGGTTTTATACATTTTAGGG + Intergenic
1108315944 13:49237701-49237723 AGTTGGTTTTATACAATTTAGGG + Intergenic
1108379572 13:49843206-49843228 AACTGGTTTTATACATTTTAGGG - Intergenic
1108509797 13:51146534-51146556 ACTTGGTTTTATACATTTTAGGG + Intergenic
1108613737 13:52109885-52109907 ACCTGGTTTTGTACATTTTAGGG - Intronic
1109157475 13:58928681-58928703 ACTTGGTTTTATACATTTTAGGG + Intergenic
1109177608 13:59175723-59175745 AGCTTGGTTTATACATTTTATGG + Intergenic
1109638403 13:65153501-65153523 AGCTGGTTATATACATTTTAGGG + Intergenic
1109780930 13:67108487-67108509 AACTTGTTTTATCCATTTCAAGG + Intronic
1109845526 13:67985314-67985336 ATCTTGCTTAATATATATTATGG + Intergenic
1109967811 13:69724258-69724280 AGCTTGCTTTATACATTTTATGG - Intronic
1110080746 13:71307610-71307632 AGCTTGATTTCTATAATTTAAGG - Intergenic
1110869670 13:80435640-80435662 ACTTGGTTTTATACATTTTAGGG - Intergenic
1110973401 13:81796723-81796745 AGCATGATTTCTAGATTTTATGG + Intergenic
1112079591 13:95954742-95954764 ACTTGGTTTTATACATTTTAGGG - Intronic
1112261385 13:97881198-97881220 ACTTGGTTTTATACATTTTAGGG - Intergenic
1112515681 13:100050911-100050933 ATTTAGTTTTATACATTTTAGGG + Intergenic
1112679262 13:101743116-101743138 ACTTGGTTTTATACATTTTAGGG - Intronic
1112784897 13:102940735-102940757 ACATTGCTTTCAACATTTTATGG + Intergenic
1112868759 13:103942281-103942303 GCCTGGCTTTATACATTTTAGGG - Intergenic
1113155315 13:107313894-107313916 GCCTGGTTTTATACATTTTAGGG - Intronic
1113294771 13:108946972-108946994 AGGTTGCTTAATACATTTGTGGG + Intronic
1113401303 13:109996148-109996170 AGCCTGCTTTGTACACTGTATGG + Intergenic
1114387477 14:22269960-22269982 AGCTTGGCTTATACATTTTAGGG + Intergenic
1114520994 14:23335863-23335885 AGCTTGCTTTATACATTTTAAGG - Intergenic
1114521945 14:23345086-23345108 AGCTTGCTTTGTACATTTTAGGG - Intergenic
1115303409 14:31910318-31910340 ACCTTGGTTTATGCATTTTAGGG + Intergenic
1115321891 14:32090064-32090086 AACCTGCTTTTTACATTATAGGG - Intronic
1115858158 14:37653916-37653938 ATCTTGTTTAATACATTTTGAGG + Intronic
1115901068 14:38148752-38148774 ACTTGGTTTTATACATTTTAGGG - Intergenic
1116322337 14:43484884-43484906 AGTTTGTTTTATATATTTCAGGG + Intergenic
1116840268 14:49813554-49813576 GGTTTGCTTTATGCATTCTAGGG + Intronic
1117048715 14:51839204-51839226 GCTTGGCTTTATACATTTTAGGG + Intronic
1117416535 14:55501625-55501647 ACTTGGTTTTATACATTTTAGGG - Intergenic
1117850292 14:59960789-59960811 AGCTTTCTTTATCCATTGAAAGG + Intronic
1117858892 14:60068605-60068627 GGCTTATTTTATACATTTTGGGG + Intergenic
1117891808 14:60430231-60430253 ACTTGGTTTTATACATTTTAGGG + Intronic
1118510884 14:66471879-66471901 AGTTTGGTTTATACATTTTAGGG - Intergenic
1119923251 14:78467111-78467133 ACATGGTTTTATACATTTTAGGG - Intronic
1120107547 14:80514220-80514242 AGCTTGGTATATGTATTTTAGGG - Intronic
1120267305 14:82267370-82267392 AGCTTTGATTATATATTTTAAGG + Intergenic
1120987624 14:90347814-90347836 ACTTGGCTTTATACATTTTAGGG + Intergenic
1122186354 14:100000196-100000218 ACTTGGTTTTATACATTTTAGGG + Intronic
1122261350 14:100524881-100524903 AATTTGATGTATACATTTTAAGG + Intronic
1122346397 14:101063556-101063578 GCTTGGCTTTATACATTTTAGGG + Intergenic
1202888379 14_KI270722v1_random:130962-130984 AGTTTGTTTTATACTGTTTATGG - Intergenic
1202891838 14_KI270722v1_random:166354-166376 AGCCACTTTTATACATTTTAGGG + Intergenic
1123669735 15:22643807-22643829 GGTTAGTTTTATACATTTTAGGG - Intergenic
1124075919 15:26444076-26444098 GCCTAGTTTTATACATTTTAGGG + Intergenic
1124571546 15:30868897-30868919 ATCTTGTATTATACATTCTATGG - Intergenic
1124664139 15:31577569-31577591 GTTTTGTTTTATACATTTTAGGG - Intronic
1125022329 15:34997622-34997644 AGAATGTTTTATACATTTTAGGG + Intergenic
1125035238 15:35116060-35116082 AGTTTGCTTTTCACATTTTGGGG + Intergenic
1125332051 15:38592008-38592030 ACTTGGCTTTATACATTTTAGGG - Intergenic
1125365498 15:38911106-38911128 TCCTTGCTTTATCCATTTGAGGG + Intergenic
1125990425 15:44101288-44101310 AGCTTGCTTTATATTCTTTCTGG - Intronic
1127230626 15:56990070-56990092 TGCCTGCTGAATACATTTTAAGG - Intronic
1127441273 15:59011084-59011106 AACTTGTTTTATACATTTTTAGG + Intronic
1127575253 15:60285674-60285696 AGTTGGTTTTATACAATTTAAGG + Intergenic
1127718685 15:61677776-61677798 CTTTTGCTTTATATATTTTAAGG + Intergenic
1128289191 15:66463787-66463809 GGTTGGTTTTATACATTTTAGGG + Intronic
1128289977 15:66470883-66470905 GGTTGGTTTTATACATTTTAGGG + Intronic
1128758917 15:70201719-70201741 AGCTGGAAATATACATTTTATGG - Intergenic
1128823566 15:70686250-70686272 ACTTGGTTTTATACATTTTAGGG + Intronic
1130742224 15:86613046-86613068 TCTTGGCTTTATACATTTTAGGG - Intronic
1131465036 15:92648161-92648183 GCCTGGTTTTATACATTTTAGGG - Intronic
1131638327 15:94261200-94261222 ACTTGGTTTTATACATTTTAGGG - Intronic
1131965271 15:97835417-97835439 AGATTGCTTCATGCATGTTAAGG - Intergenic
1132280093 15:100605581-100605603 ATCTGGCTTTAGACTTTTTAGGG - Intronic
1133534192 16:6684909-6684931 GGCATACTTTATACATTTTCTGG + Intronic
1133697783 16:8281311-8281333 GCTTTGTTTTATACATTTTAGGG + Intergenic
1133842820 16:9425427-9425449 AGATTTCCCTATACATTTTAAGG + Intergenic
1133949601 16:10379913-10379935 ACTTGGTTTTATACATTTTAGGG + Intronic
1134001720 16:10788051-10788073 ACCTGGCTTCATACATTTTAGGG + Intronic
1134171226 16:11971334-11971356 ACTTTGTTTTATACATTTTAGGG + Intronic
1135271369 16:21072632-21072654 GGCTTGTTTTATACATTTATTGG + Intronic
1135834175 16:25808575-25808597 AGATTGTTTTAAACATTCTAGGG + Intronic
1135982348 16:27157728-27157750 ACTTGGTTTTATACATTTTAAGG - Intergenic
1137361801 16:47824531-47824553 AATTTCCTTTATACATTTTGAGG - Intergenic
1137847002 16:51699734-51699756 ATCTTGCTTTATATTTTTTAGGG - Intergenic
1139086405 16:63591973-63591995 AGCTTCTTTTATCCATTTTAGGG + Intergenic
1140303077 16:73776883-73776905 TGCTTGCTTTATTTTTTTTAAGG + Intergenic
1140458492 16:75118603-75118625 AACTGGTTTTATACAGTTTAGGG - Intergenic
1140550955 16:75865060-75865082 AGGATTCTTTATACATTTTGAGG + Intergenic
1141386951 16:83630400-83630422 ACCTGGTTTTATGCATTTTAGGG + Intronic
1141747468 16:85935374-85935396 GCCTGGTTTTATACATTTTAGGG + Intergenic
1141899249 16:86979641-86979663 GCCTGGTTTTATACATTTTAGGG + Intergenic
1142879943 17:2876367-2876389 AGGTGGTTTTATACATTTTAGGG + Intronic
1143657826 17:8306972-8306994 GGTTGGTTTTATACATTTTAGGG - Intergenic
1144189751 17:12833685-12833707 ACTTGGTTTTATACATTTTAGGG + Intronic
1144238284 17:13284177-13284199 AATTGGTTTTATACATTTTAGGG + Intergenic
1144570868 17:16397974-16397996 GCCTAGTTTTATACATTTTAGGG - Intergenic
1145134985 17:20396107-20396129 ACTTGGTTTTATACATTTTAGGG + Intergenic
1145223257 17:21106428-21106450 ATCAGGTTTTATACATTTTAGGG + Intergenic
1146528787 17:33590275-33590297 AAAGTGCTTTATACCTTTTAAGG + Intronic
1146592140 17:34136679-34136701 GCCTGGTTTTATACATTTTAGGG - Intronic
1147245995 17:39121319-39121341 ACTCTGCTTTATACATTTTAGGG - Intronic
1147515006 17:41107801-41107823 CTTTTGTTTTATACATTTTAGGG - Intergenic
1148592944 17:48830435-48830457 AGAAAGCTTTATACATTTGAAGG - Intergenic
1148983551 17:51600424-51600446 ATTTGGTTTTATACATTTTAGGG - Intergenic
1149185286 17:53990404-53990426 AGCTTGAATTCTACACTTTATGG + Intergenic
1149878128 17:60259140-60259162 AGCTCCCTTTACACATTTTATGG + Intronic
1150554821 17:66244957-66244979 GCCTGGCTTTATACATTTTAGGG - Intronic
1150878023 17:68991629-68991651 AGCTTGGTTTATATTTTATATGG + Intronic
1151334328 17:73431228-73431250 AGCTGCCTTCATATATTTTAGGG - Intronic
1151510120 17:74553241-74553263 GCTTGGCTTTATACATTTTAAGG + Intergenic
1151525997 17:74668497-74668519 AGCTTGGTTTATGTATTTTAGGG - Intergenic
1152432748 17:80258605-80258627 AGCTTGGTTTATACATTTTAAGG + Intergenic
1153189980 18:2527376-2527398 CACTTTGTTTATACATTTTAGGG - Intergenic
1153655598 18:7279471-7279493 AGAATGCTTTATACATTGCAAGG - Intergenic
1154489021 18:14904761-14904783 AGCTTGGTTTATACTTTTTATGG + Intergenic
1155362065 18:25013347-25013369 ACCTTTCTCTTTACATTTTAAGG + Intergenic
1155787306 18:29916550-29916572 ACTTGGTTTTATACATTTTAGGG - Intergenic
1155838587 18:30619353-30619375 GCCTGGTTTTATACATTTTAGGG + Intergenic
1156063373 18:33109316-33109338 ACATTTCTTTAAACATTTTATGG - Intronic
1157671832 18:49536814-49536836 GCCTAGTTTTATACATTTTAGGG + Intergenic
1158871420 18:61692127-61692149 ACTTGGTTTTATACATTTTAGGG + Intergenic
1159046945 18:63377786-63377808 AGCTTGGTTTATACATCTTAGGG - Intergenic
1159490244 18:69123507-69123529 AGCTTCTTTTATAAAATTTAAGG - Intergenic
1159852646 18:73544028-73544050 TGCTTGCTTTATAGACTTTGAGG - Intergenic
1159992636 18:74928113-74928135 AGCTTGGTTTATATATTTTAGGG + Intronic
1160111366 18:76034781-76034803 TGCTTGGATCATACATTTTAGGG - Intergenic
1160291521 18:77598883-77598905 AGCTTGCTTTCTACATTTTAGGG - Intergenic
1160470316 18:79126517-79126539 AAATTGCATTATACATTATAAGG - Intronic
1162294412 19:9803246-9803268 AGTTGGTTTTGTACATTTTAGGG - Intergenic
1163060913 19:14761094-14761116 ACTTGGTTTTATACATTTTAGGG - Intronic
1163212479 19:15851441-15851463 GCTTGGCTTTATACATTTTAGGG - Intergenic
1164016115 19:21257278-21257300 AGCTTCCTTTATACCCTTGAAGG - Intronic
1164126452 19:22322729-22322751 TGTTGGTTTTATACATTTTAGGG + Intergenic
1164172896 19:22741035-22741057 TGTTAGTTTTATACATTTTAGGG - Intergenic
1164379908 19:27724781-27724803 AGCTTTGTTTCTAGATTTTAAGG + Intergenic
1165636844 19:37347481-37347503 AGATTGATTTATTCATGTTATGG + Intronic
1166655018 19:44604826-44604848 GCTTTGTTTTATACATTTTAGGG - Intergenic
1167200969 19:48065147-48065169 GCCTAGGTTTATACATTTTAGGG + Intronic
1167700777 19:51043963-51043985 AGTTTGGTTTATGCATTTTAGGG + Intergenic
1168613350 19:57818476-57818498 GGCTGGTTTAATACATTTTAGGG + Intronic
1168625927 19:57917858-57917880 GGTTGGTTTTATACATTTTAGGG - Intergenic
924979221 2:205530-205552 ACTTGGTTTTATACATTTTAGGG - Intergenic
925537551 2:4933738-4933760 GGTGGGCTTTATACATTTTAGGG - Intergenic
925981105 2:9178248-9178270 ACTTGGTTTTATACATTTTAGGG + Intergenic
926507168 2:13731562-13731584 ACTTGGTTTTATACATTTTAGGG - Intergenic
926919673 2:17927953-17927975 ACTTGGCTATATACATTTTAGGG - Intronic
927505844 2:23614235-23614257 GGTTGGTTTTATACATTTTAGGG - Intronic
927950405 2:27164423-27164445 GCTTGGCTTTATACATTTTAGGG + Intergenic
928604834 2:32936065-32936087 GCCTGGTTTTATACATTTTAGGG - Intergenic
928792958 2:34980938-34980960 AGCTTGCTGTGTGCAGTTTAAGG + Intergenic
928858078 2:35824116-35824138 GTTTTGTTTTATACATTTTAGGG + Intergenic
928991858 2:37240698-37240720 AGCATCCTTCATACATTTTAAGG - Intronic
929548189 2:42870443-42870465 GGCTTGCCTTATTTATTTTAAGG - Intergenic
929799104 2:45084115-45084137 AGCTTGCTTTATAAAGTTCCAGG + Intergenic
930080814 2:47447103-47447125 CGCTTGCATTATTCATATTAGGG + Intronic
930094792 2:47558885-47558907 AGGTTGCTTCACACATTTGACGG - Intronic
930150092 2:48050561-48050583 GCTTGGCTTTATACATTTTAGGG + Intergenic
930971409 2:57398929-57398951 AGCTGGCTTTAATCATATTAAGG - Intergenic
931704515 2:64936369-64936391 AGCTTGTGTTATTCTTTTTATGG - Intergenic
932827744 2:74957260-74957282 ACCTTTCTTTACCCATTTTAAGG - Intergenic
933059137 2:77713796-77713818 GCCTAGTTTTATACATTTTAGGG - Intergenic
933228658 2:79780225-79780247 ACTTGGTTTTATACATTTTAGGG - Intronic
933445196 2:82371105-82371127 GCTTCGCTTTATACATTTTAGGG + Intergenic
933536842 2:83585934-83585956 ACTTGGTTTTATACATTTTAGGG - Intergenic
934131313 2:88951925-88951947 CGTTGGTTTTATACATTTTAGGG - Intergenic
934133149 2:88969185-88969207 CGTTGGTTTTATACATTTTAGGG - Intergenic
935364547 2:102275625-102275647 GGTTGGTTTTATACATTTTAGGG - Intergenic
935850531 2:107214136-107214158 GGTTGGTTTTATACATTTTAGGG + Intergenic
935917739 2:107974478-107974500 TGCTTCCTTTATATATTTTGGGG - Intergenic
936781004 2:116032248-116032270 AGCATGATCCATACATTTTAGGG - Intergenic
936828860 2:116615929-116615951 TGTTTGCTTTATAGATTTTGGGG - Intergenic
937696347 2:124812791-124812813 ACTTGGTTTTATACATTTTAGGG - Intronic
937850050 2:126623899-126623921 GCCTGGTTTTATACATTTTAGGG + Intergenic
938170483 2:129071201-129071223 GGTTTTCTTTATTCATTTTAAGG - Intergenic
938311947 2:130297124-130297146 AACTTGATTTATAAATATTAAGG - Intergenic
938896405 2:135755171-135755193 ATATTGCTTAATATATTTTAAGG + Intronic
939056574 2:137372454-137372476 ACTTGGTTTTATACATTTTAGGG + Intronic
939233900 2:139466886-139466908 TCCTTGGTTAATACATTTTAGGG + Intergenic
939257735 2:139766032-139766054 AGTTTGCTTTCTACTTTTCAGGG + Intergenic
939471583 2:142628774-142628796 AGTTTGCTTTATACAATTTGAGG + Intergenic
939657214 2:144841846-144841868 AGTTTGTTTTATACTATTTATGG - Intergenic
939922952 2:148139508-148139530 GGCCTTCTTTAAACATTTTAAGG + Intronic
940486187 2:154298106-154298128 ATCTCTCTTTATACATTTCATGG - Intronic
940973753 2:159921545-159921567 AACTTGTTTTGTACATTGTAGGG - Intergenic
941227418 2:162866497-162866519 ACTTGGTTTTATACATTTTAGGG + Intergenic
942012016 2:171773670-171773692 TGTTTGCTTTTTACATTTTAAGG - Intergenic
942160690 2:173183247-173183269 AGCTTGCTTGACACATTAAATGG + Intronic
942206670 2:173626037-173626059 AGCTTCCTTTCTCCATTTAATGG + Intergenic
942227492 2:173830100-173830122 CGGTTGCTTTATACCTTTTTAGG - Intergenic
942243720 2:173988033-173988055 AGTTTGTTTTACACACTTTATGG + Intergenic
942468125 2:176230365-176230387 AGAATGCTTTATACATTTGATGG + Intergenic
942671864 2:178384411-178384433 GGTTGGGTTTATACATTTTAGGG + Intronic
942906800 2:181192335-181192357 ATCTTTCCTTTTACATTTTATGG + Intergenic
943235649 2:185315806-185315828 AGTTTCCTTTGTAGATTTTAGGG - Intergenic
943256441 2:185599387-185599409 ATTTGGTTTTATACATTTTAGGG + Intergenic
943262198 2:185680161-185680183 GCTTTGTTTTATACATTTTAGGG + Intergenic
944512489 2:200478189-200478211 AGCTTGCTTCATAATTTTCATGG + Exonic
944793106 2:203153493-203153515 AGCTCTCTTGATTCATTTTATGG - Intronic
945123139 2:206479851-206479873 AATTTCCTTTTTACATTTTATGG + Intronic
946559395 2:220896029-220896051 AGCTGTATTTAAACATTTTAAGG - Intergenic
947150876 2:227114049-227114071 ACTTTGCTTGATACATTTAATGG - Intronic
947203539 2:227638917-227638939 ATTTTGCTTAATACATTTTGAGG + Intergenic
947466864 2:230358660-230358682 AGCCTGATTGATACATTTTTGGG - Intronic
948810987 2:240478231-240478253 TCCTTTCTTTATACATTTTCCGG + Intergenic
948955417 2:241286593-241286615 GTCTGGCTTTATACATTGTAGGG - Intronic
949028824 2:241778725-241778747 GTCTGGCTTTATACATTGTAGGG + Intronic
949030318 2:241793072-241793094 GTCTGGCTTTATACATTGTAGGG - Intronic
1169117365 20:3074271-3074293 GCCTGGTTTTATACATTTTAGGG + Intergenic
1169312461 20:4556194-4556216 AGCCTGCTTTAGTGATTTTAAGG + Intergenic
1169324052 20:4661066-4661088 GATTTGTTTTATACATTTTAGGG + Intergenic
1169631581 20:7638366-7638388 GCCTAGTTTTATACATTTTATGG - Intergenic
1169731250 20:8787464-8787486 AGCTTGCCTTATATGTTTTTGGG + Intronic
1170119149 20:12893358-12893380 AGTTTGCTTTACTCATTTAATGG - Intergenic
1170907977 20:20533479-20533501 ATTTTGCTTTATATATTTTGAGG - Intronic
1170968262 20:21095575-21095597 AGGTTGGTTTATCCAATTTAGGG - Intergenic
1171506192 20:25635891-25635913 GGCCGGTTTTATACATTTTAGGG + Intergenic
1171633950 20:27246049-27246071 TGCTTTCTGTATACTTTTTATGG - Intergenic
1172157271 20:32836481-32836503 AACTTGCTTTATAAATTTAGGGG + Intronic
1173682980 20:44899962-44899984 ATAATGCTTTATACTTTTTAAGG + Intronic
1173887919 20:46478247-46478269 ACTTGGTTTTATACATTTTAGGG + Intergenic
1174296845 20:49551582-49551604 AGCTCGGTTTGTACATTTTAGGG - Intronic
1174457251 20:50658066-50658088 AGTTTGATTAAAACATTTTATGG - Intronic
1174543133 20:51305291-51305313 ATTTAGTTTTATACATTTTAGGG + Intergenic
1174888629 20:54364359-54364381 GCCTAGTTTTATACATTTTAGGG - Intergenic
1177176824 21:17708556-17708578 AACTTGTTTTATACGTTTTAGGG - Intergenic
1177262774 21:18751244-18751266 CACCTGGTTTATACATTTTAGGG + Intergenic
1178513067 21:33223222-33223244 GCCTAGTTTTATACATTTTAGGG + Intergenic
1178570559 21:33731940-33731962 ACATGGTTTTATACATTTTAGGG + Intronic
1179261512 21:39762305-39762327 ACTTAGTTTTATACATTTTAGGG + Intronic
1179460493 21:41531485-41531507 GTCTGGTTTTATACATTTTAGGG + Intergenic
1179941915 21:44645837-44645859 AGCTTGCTTGAAATATTTTCCGG + Intronic
1181329200 22:22075939-22075961 ACTTGGTTTTATACATTTTAAGG + Intergenic
1181564553 22:23727128-23727150 AAATTGCTCTTTACATTTTATGG - Intergenic
1183611844 22:38913487-38913509 TTCTTGCTTTATTCATTTTAAGG - Intergenic
1184338665 22:43872791-43872813 AGTTGGTTTTATACATTTTAGGG - Intergenic
1185076351 22:48685006-48685028 AGTTGGTTTTATACATTTTAGGG + Intronic
1185405392 22:50645346-50645368 GTTTTGTTTTATACATTTTAGGG - Intergenic
949163900 3:913891-913913 AGTTGGTTTTATACATGTTAGGG - Intergenic
949836678 3:8277821-8277843 ACTTGGTTTTATACATTTTAGGG - Intergenic
949924386 3:9029454-9029476 AGTTTGTTTTATACATTTCTTGG - Intronic
949927637 3:9054554-9054576 ACTTGGTTTTATACATTTTAGGG - Intronic
950891869 3:16411179-16411201 TGCCTGCTTTATGCATTTTCTGG - Intronic
951138273 3:19130022-19130044 GGATGGTTTTATACATTTTAGGG - Intergenic
951325620 3:21298746-21298768 TGCTTGCTTTATAGGGTTTATGG - Intergenic
951773313 3:26282577-26282599 GCCTGGTTTTATACATTTTAGGG + Intergenic
951943931 3:28113080-28113102 GGCCTGCTTCATATATTTTAGGG - Intergenic
952245815 3:31591125-31591147 TTCCTGCTTTATATATTTTAAGG + Intronic
952491585 3:33879168-33879190 AGTTCGGTTTATACATTTTAAGG + Intergenic
953453996 3:43027908-43027930 ACTTGGTTTTATACATTTTAAGG + Intronic
954066941 3:48114282-48114304 GACTGGTTTTATACATTTTAGGG - Intergenic
954606683 3:51916232-51916254 ACTTGGTTTTATACATTTTAGGG - Intergenic
955195227 3:56799817-56799839 AGTATGCTTTATACACTTTGAGG - Intronic
955424815 3:58777326-58777348 ACTTGGTTTTATACATTTTAAGG - Intronic
955909840 3:63848525-63848547 AGCTGATTTTATGCATTTTAGGG - Exonic
956986563 3:74708183-74708205 AGTTTGGTTTATACATTTTAAGG - Intergenic
957539693 3:81551687-81551709 GTTTTGTTTTATACATTTTAGGG - Intronic
957826982 3:85460093-85460115 AGCTCGTTTTGTACAGTTTAAGG - Intronic
958023287 3:88021848-88021870 GCCTGGTTTTATACATTTTAGGG + Intergenic
958573774 3:95921062-95921084 ACTTGGTTTTATACATTTTAGGG + Intergenic
959437314 3:106332440-106332462 AAATTGCTTTTTACATCTTATGG + Intergenic
959799078 3:110468422-110468444 AGAATGTTTTAAACATTTTATGG + Intergenic
960081231 3:113542759-113542781 AGCTTCCTTCTTTCATTTTATGG + Intronic
960208094 3:114927337-114927359 ACTTGGTTTTATACATTTTAGGG - Intronic
960420701 3:117441895-117441917 GTCTTGCATTCTACATTTTAAGG - Intergenic
960728810 3:120701377-120701399 AGGTTGTTTTATACATTTGCAGG + Intronic
960834391 3:121889970-121889992 AGCTGGTTTTTTACATTTTAGGG + Intergenic
960840097 3:121949071-121949093 AATTTGCTTTATATATTTTGAGG + Intergenic
961957478 3:130818921-130818943 ACTTGGCTTTATACATTTTAGGG - Intergenic
962160343 3:132992672-132992694 AGGTTGGATTATAGATTTTAGGG + Intergenic
962180170 3:133198341-133198363 AGCTTTCTTTATACCATTCAGGG + Intronic
962206840 3:133441792-133441814 AGCTTGTATTATCAATTTTATGG - Intronic
962272521 3:133988488-133988510 AGCTGGTTTTATACATTTTAGGG - Intronic
962854094 3:139328933-139328955 AGCTTGCGTTACAGATTTGATGG + Intronic
964039672 3:152244251-152244273 ATTATGCTTTATCCATTTTATGG - Intronic
964210964 3:154227579-154227601 ATCTTTCTTTATAAAATTTACGG - Intronic
964221293 3:154348562-154348584 TGCTTGCTCTATACATATTTAGG - Intronic
964486522 3:157190913-157190935 GCCTCGGTTTATACATTTTAGGG - Intergenic
964575612 3:158163376-158163398 AAGTTGCTGTAGACATTTTAGGG + Intronic
965827913 3:172749608-172749630 AGATTGCTTCATTCATTTTGTGG + Intergenic
965998533 3:174917334-174917356 AAAATGCATTATACATTTTATGG + Intronic
966796151 3:183715909-183715931 AGCTTGCTTAAGACATTCTGAGG - Intronic
967088177 3:186112699-186112721 AACTTGCTTTTGGCATTTTAGGG - Intronic
967162930 3:186755301-186755323 GTTTGGCTTTATACATTTTAGGG - Intergenic
967195278 3:187020813-187020835 GTCTGGTTTTATACATTTTAGGG + Intronic
967365846 3:188685661-188685683 AGCTGGGTTTATCCATTTGAGGG - Intronic
969346387 4:6573220-6573242 CTATAGCTTTATACATTTTATGG - Intergenic
970205710 4:13653883-13653905 ACCTAGATGTATACATTTTAGGG - Intergenic
970696423 4:18683433-18683455 TGCTTGCTTTATAGATTTGCTGG - Intergenic
970971335 4:21987822-21987844 ACTTGGTTTTATACATTTTAGGG - Intergenic
971261158 4:25057999-25058021 GCTTGGCTTTATACATTTTAGGG - Intergenic
971751995 4:30662344-30662366 ACTTGGTTTTATACATTTTAGGG - Intergenic
971793818 4:31201162-31201184 AGCTTAATTTATAAATTTTCAGG - Intergenic
971998052 4:33992974-33992996 AATTGGTTTTATACATTTTAGGG + Intergenic
972055118 4:34792387-34792409 AGCTGGTTTTATACGTTTTCGGG + Intergenic
972258239 4:37382104-37382126 AACTTGTTTTCTACATTTCATGG - Intronic
972322925 4:37989438-37989460 AGCTTGCTTTATACATTTTAGGG - Intronic
972529506 4:39948998-39949020 GGCTTTCATTATACCTTTTATGG - Intronic
972732949 4:41813230-41813252 AAGGTGCTTGATACATTTTATGG + Intergenic
972863712 4:43203908-43203930 AGCTTGTTTTATATCTTCTAAGG + Intergenic
972911884 4:43827165-43827187 ATCTTTCTTTAAACATTTTGGGG - Intergenic
973064212 4:45767190-45767212 ATATTCCTTTATACATTTTGAGG - Intergenic
973193550 4:47414297-47414319 GTTTTGCTTTATACATTTTAGGG + Intronic
973336921 4:48965998-48966020 ATTTGGCTTGATACATTTTAGGG - Intergenic
973941361 4:55914132-55914154 AACTTGGTTTATAAATTTCAAGG - Intergenic
974789104 4:66662993-66663015 GTTTAGCTTTATACATTTTAGGG - Intergenic
975042771 4:69764272-69764294 AGATTGCTTTTTTCTTTTTAAGG + Intronic
975660729 4:76686368-76686390 AGCTTTTTTTATATATATTATGG - Intronic
975797602 4:78025501-78025523 ACTTGGCTTTATAAATTTTAGGG + Intergenic
976112045 4:81685945-81685967 GCCTAGTTTTATACATTTTAGGG + Intronic
976736849 4:88318850-88318872 GCTTTGTTTTATACATTTTAGGG - Intergenic
977107874 4:92912528-92912550 AACTTTCTTTATATATATTATGG - Intronic
977345505 4:95811680-95811702 AGCTGGTTTCATACATTTTAGGG - Intergenic
977681286 4:99801220-99801242 GCTTTGTTTTATACATTTTAGGG + Intergenic
977720683 4:100236660-100236682 GGTTGGTTTTATACATTTTAGGG + Intergenic
977927398 4:102716727-102716749 AGTTTGGGTCATACATTTTATGG + Intronic
978024812 4:103860319-103860341 GGCCAGTTTTATACATTTTATGG - Intergenic
978275469 4:106944082-106944104 AGCTTCCTTTAAACATCTTGGGG + Intronic
978337576 4:107686182-107686204 ACCTTGCTTTTTAGGTTTTATGG - Intronic
978468575 4:109036419-109036441 AACTTACTTTGTACATTATATGG - Intronic
978991895 4:115094228-115094250 ATTTTGCTTTATTCATTTTGAGG - Intronic
979199163 4:117956223-117956245 AACTTGCTTTTAACATTTTAAGG + Intergenic
979441635 4:120757251-120757273 AGCTTTTTTCATACATTTTTTGG + Intronic
979617075 4:122755160-122755182 GCTTTGTTTTATACATTTTAGGG + Intergenic
979790175 4:124770336-124770358 ATCTTGCTTTTTACTTTTTTGGG + Intergenic
980259716 4:130432795-130432817 ATTTGGTTTTATACATTTTAGGG + Intergenic
980484101 4:133431479-133431501 AGCTTGCTTTAGGCTTTTTCAGG - Intergenic
980648490 4:135677610-135677632 TGTTTGCTTCATACATTTGAGGG - Intergenic
980983581 4:139674191-139674213 GCCTGGTTTTATACATTTTAGGG + Intronic
980984961 4:139686061-139686083 ACTTGGCGTTATACATTTTAGGG + Intronic
981422936 4:144571959-144571981 AGCTTGATTTATATATTTTTAGG - Intergenic
981736546 4:147958622-147958644 AGCTTGATGTATTCATTTCACGG + Intronic
982449355 4:155533568-155533590 GCCTAGTTTTATACATTTTAGGG - Intergenic
982462577 4:155689329-155689351 AAATTGTTTTATATATTTTAGGG + Intronic
982509409 4:156262514-156262536 GCCTGGTTTTATACATTTTAGGG - Intergenic
982663804 4:158236112-158236134 AGTTTGCATTTTACATTTGATGG + Intronic
983631763 4:169856609-169856631 ACTTGGTTTTATACATTTTAGGG + Intergenic
983728719 4:170966023-170966045 TACTTGCTTTATTCATTTTTGGG + Intergenic
984312243 4:178077017-178077039 AGCTTGCTTTCTTCAATATATGG - Intergenic
984393293 4:179166285-179166307 ATTTGGCTTTATATATTTTAGGG - Intergenic
984650930 4:182269865-182269887 GTTTTGTTTTATACATTTTAGGG + Intronic
984869336 4:184312808-184312830 ACTTGGTTTTATACATTTTAGGG - Intergenic
985080946 4:186263295-186263317 AGCTGATTTTGTACATTTTAGGG - Intergenic
985226835 4:187770454-187770476 AGCTTGGTTTATACATTTTAGGG + Intergenic
985233818 4:187851060-187851082 AGATTGCTTGATTGATTTTAAGG + Intergenic
986015018 5:3750076-3750098 AGCATGCATTATGCAATTTAGGG - Intergenic
986241731 5:5965997-5966019 AGCTTGCTTTGAAAATTATATGG - Intergenic
986379397 5:7168131-7168153 AGCATGGTTTATTCTTTTTATGG - Intergenic
986550161 5:8944714-8944736 AGCTTACTGTATTCATTTAATGG + Intergenic
986646921 5:9925838-9925860 ACTTGGTTTTATACATTTTAGGG - Intergenic
986825329 5:11514410-11514432 AGCTGGCTGTATTCATTTGATGG + Intronic
986873013 5:12072810-12072832 AGCATTCTGTATACAATTTAGGG - Intergenic
987096587 5:14555996-14556018 AACTTGGTTTATACATTTTAGGG + Intergenic
987265760 5:16253376-16253398 ACTTGGTTTTATACATTTTAGGG + Intergenic
987474094 5:18369417-18369439 GTTTGGCTTTATACATTTTAGGG - Intergenic
987718771 5:21608180-21608202 AGCTTGCTTTAAAAATATTTAGG + Intergenic
987892365 5:23896140-23896162 AGCTTTTTTTATAGTTTTTATGG - Intergenic
988769990 5:34422729-34422751 GCTTTGTTTTATACATTTTAGGG - Intergenic
988932153 5:36047232-36047254 GGCTGGTTTTATACATTTTAGGG - Intronic
989031486 5:37123506-37123528 TGCTTGGTTTATAGATTTTGTGG - Intronic
991202187 5:64007252-64007274 ACTTGGTTTTATACATTTTATGG - Intergenic
991773065 5:70057895-70057917 GCTTTGTTTTATACATTTTAGGG - Intronic
991852358 5:70933319-70933341 GCTTTGTTTTATACATTTTAGGG - Intronic
992240094 5:74759582-74759604 AGCTTTCCTTATACATTGCAAGG - Intronic
992283064 5:75202100-75202122 GCCTAGTTTTATACATTTTAGGG - Intronic
992291669 5:75285777-75285799 GTCTGGTTTTATACATTTTAGGG - Intergenic
992351743 5:75936723-75936745 ATTTTGCTTTATACCTTATAAGG + Intergenic
992369167 5:76125451-76125473 AGTTCTCATTATACATTTTATGG - Intronic
992674385 5:79091291-79091313 TGCTTGCTTCATAGATTTTGTGG + Intronic
992883780 5:81137477-81137499 TGCTTGCTTTATATCTGTTATGG + Intronic
993331390 5:86604869-86604891 AGCTTCATTTATTCTTTTTAGGG - Intergenic
993415857 5:87629430-87629452 ATCTAGGTTTACACATTTTAAGG - Intergenic
993747702 5:91621642-91621664 GGTTTGTGTTATACATTTTATGG + Intergenic
993764427 5:91838140-91838162 ACATTGGTTTATACATTTAAAGG + Intergenic
994283511 5:97936222-97936244 ACCTTGCTTGATACATTTAATGG + Intergenic
995128004 5:108599338-108599360 AGGTTGCTTAATAAATATTATGG - Intergenic
995486988 5:112649166-112649188 TGTTTGCTTTATACTTTTTTTGG + Intergenic
995566554 5:113436971-113436993 ACTTGGTTTTATACATTTTAGGG - Intronic
996281007 5:121728981-121729003 GGTTAGTTTTATACATTTTAGGG - Intergenic
997124014 5:131207556-131207578 ACTTGGTTTTATACATTTTAGGG + Intergenic
997158838 5:131585965-131585987 ATTTTGTTTTATACGTTTTAGGG - Intronic
997223584 5:132191576-132191598 AGCTAGCTTGGTACATGTTACGG - Intergenic
997258110 5:132444645-132444667 ATTTGGTTTTATACATTTTAGGG + Intronic
997344665 5:133179151-133179173 ATTTTGCTTTATATATTTTGAGG + Intergenic
998000889 5:138624812-138624834 AGCTTACTTTGTTCATTTTTGGG + Intronic
998305124 5:141068595-141068617 TGTTTGCTTTATAAATTTTGAGG - Intergenic
998773464 5:145572272-145572294 GGTTAGATTTATACATTTTATGG - Intronic
999939132 5:156521577-156521599 AGCTTTTTTTATACATTTGTTGG - Intronic
1000218970 5:159193220-159193242 AGCTTGATTTAAACATTGTGAGG + Intronic
1000476735 5:161717584-161717606 CGCTTGTTTTATATATTTCAAGG + Intergenic
1000793392 5:165634271-165634293 ACCTGGCTTCATACATTTTAGGG + Intergenic
1000798930 5:165700220-165700242 AACTTGCTTTCTACATGTCAGGG - Intergenic
1000966418 5:167662412-167662434 GGTTTGCTTAATAGATTTTATGG + Intronic
1001856652 5:175017177-175017199 TATTTGCTTTATATATTTTAAGG + Intergenic
1001973657 5:175978915-175978937 GCCTAGTTTTATACATTTTAGGG - Intronic
1002243775 5:177864864-177864886 GCCTAGTTTTATACATTTTAGGG + Intergenic
1002768436 6:264980-265002 AGTTTGCTTCATATATTTTGAGG + Intergenic
1003013589 6:2449807-2449829 AGTTTGCTTTATTGCTTTTAGGG + Intergenic
1003204145 6:3991787-3991809 GCCTAGTTTTATACATTTTAGGG - Intergenic
1004200920 6:13547155-13547177 ACTTGGTTTTATACATTTTAGGG - Intergenic
1004481126 6:16020211-16020233 ACTTGGTTTTATACATTTTAGGG - Intergenic
1004671897 6:17805020-17805042 AGCTTGCATAATCCATTTTTTGG - Intronic
1005171873 6:22995732-22995754 AGCTTGCTGTAAGGATTTTAGGG + Intergenic
1005449201 6:25956573-25956595 CCTTGGCTTTATACATTTTAGGG + Intergenic
1005671684 6:28112730-28112752 ATCTTGCTCTGTGCATTTTAAGG + Intergenic
1005876757 6:30016600-30016622 ACTTGGTTTTATACATTTTAAGG + Intergenic
1006993701 6:38238269-38238291 GCCTAGTTTTATACATTTTAGGG + Intronic
1008175435 6:48262956-48262978 AGCTTGGTTTATACATTTTAGGG + Intergenic
1008226549 6:48925334-48925356 GCTTTGTTTTATACATTTTAGGG - Intergenic
1008659738 6:53654230-53654252 AGCTTGCTCCATCCATTTTCAGG + Exonic
1008754341 6:54776534-54776556 ACTTGGTTTTATACATTTTAGGG + Intergenic
1009052128 6:58288950-58288972 AGCTTTCTTGATATATTTCAAGG + Intergenic
1009630351 6:66191198-66191220 GGTTAGTTTTATACATTTTAGGG - Intergenic
1010055753 6:71561829-71561851 AGGTTGGTTCATGCATTTTAAGG + Intergenic
1010669025 6:78664514-78664536 ATATTGCTTTTTACATATTAGGG - Intergenic
1011162543 6:84407774-84407796 AAATTGCTCTATTCATTTTAAGG + Intergenic
1011594764 6:89005825-89005847 GCCTGGTTTTATACATTTTAGGG - Intergenic
1011777133 6:90743550-90743572 TGTTTGCTTCATACATTTTGAGG + Intergenic
1011951896 6:92977236-92977258 AGGTTGCATGATAAATTTTATGG + Intergenic
1012181817 6:96164013-96164035 GTTTGGCTTTATACATTTTAGGG + Intronic
1012205761 6:96458546-96458568 ACTTGGTTTTATACATTTTAAGG + Intergenic
1012432471 6:99179074-99179096 AACTTGGTTTATACATTTTAGGG - Intergenic
1012573864 6:100765624-100765646 GCTTGGCTTTATACATTTTAGGG - Intronic
1012766049 6:103368181-103368203 GCTTTGTTTTATACATTTTAGGG - Intergenic
1013462165 6:110385249-110385271 AGATAGATTTTTACATTTTAAGG + Intergenic
1013888131 6:114996142-114996164 ACATGGTTTTATACATTTTAGGG + Intergenic
1014241901 6:119027244-119027266 AACTTGGTTTATACATTGTAGGG - Intronic
1014838475 6:126188001-126188023 AGGTTTCTGTAGACATTTTATGG - Intergenic
1014848823 6:126314313-126314335 AACTTGGTTTAAACATTTTAGGG - Intergenic
1014957334 6:127636981-127637003 AGGCTGCTTTATACACTTTCTGG + Intergenic
1016293848 6:142552823-142552845 GCTTTGTTTTATACATTTTAGGG - Intergenic
1016381028 6:143480281-143480303 ATCTTGCTATATACAGATTATGG - Intronic
1016404098 6:143712000-143712022 ATCTTTCTTTATACAGTTGACGG + Exonic
1016631179 6:146233952-146233974 TTTTTGCTTTATACATTATAAGG + Intronic
1018067242 6:160132718-160132740 AGTTTGCTGTATTTATTTTAAGG - Intronic
1018447977 6:163875435-163875457 AGCTGGATTTATAGATATTAAGG - Intergenic
1018542292 6:164895262-164895284 ATTTAGTTTTATACATTTTAGGG - Intergenic
1019046113 6:169147477-169147499 AGTTGGTTTTATACATTTTTAGG - Intergenic
1019233432 6:170587569-170587591 GGGTGGTTTTATACATTTTAGGG + Intergenic
1019992040 7:4698850-4698872 AGCTAGCTTTTTATTTTTTATGG + Intronic
1020833361 7:13118844-13118866 AGCTTGGTTTATGAAATTTAAGG + Intergenic
1021304694 7:19018061-19018083 TGTTTGCTTTATATATTTTAGGG - Intergenic
1021328251 7:19301300-19301322 AGCTTGCTTTACACAATCTGTGG - Intergenic
1022005766 7:26264269-26264291 AGCTTGTTTTATACATTTTTGGG + Intergenic
1022310250 7:29190271-29190293 AACTAGCTTTAAATATTTTATGG - Intronic
1022418998 7:30202719-30202741 AGCTTGCTTGTTACAGTTGAAGG + Intergenic
1022458805 7:30584807-30584829 ACTTGGTTTTATACATTTTAGGG - Intergenic
1022985415 7:35649547-35649569 CCCTAGTTTTATACATTTTAGGG + Intronic
1023027916 7:36068059-36068081 AACTTGCTTTATATATCTCAAGG + Intergenic
1023411673 7:39894392-39894414 GCCTAGTTTTATACATTTTAGGG - Intergenic
1023568074 7:41543206-41543228 AGATTGGGTGATACATTTTAAGG + Intergenic
1023910361 7:44551028-44551050 TGTTTGCTTTACATATTTTAAGG - Intergenic
1024388371 7:48779575-48779597 AGGTTGGTTTGCACATTTTAAGG + Intergenic
1024484961 7:49907633-49907655 GCTTGGCTTTATACATTTTAGGG + Intronic
1024736848 7:52314435-52314457 ATCTTGTTCTATAGATTTTAGGG + Intergenic
1025115919 7:56257991-56258013 GCTTTGTTTTATACATTTTAGGG + Intergenic
1026118998 7:67520229-67520251 ACTTGGTTTTATACATTTTAGGG - Intergenic
1026200363 7:68209172-68209194 AGCTTGGTTTACACATTTTAGGG + Intergenic
1026520207 7:71110853-71110875 ACTTGGTTTTATACATTTTAGGG + Intergenic
1026814267 7:73497490-73497512 AGATTTCTGTATATATTTTATGG + Intronic
1027517859 7:79164785-79164807 GGTTTGTTTTATACATTTTAGGG - Intronic
1028683810 7:93569777-93569799 AGAATGATTAATACATTTTAAGG + Intronic
1028763473 7:94522417-94522439 TTTTTGCTTTATAAATTTTAAGG - Intronic
1029002206 7:97166270-97166292 AGCTTGCTTTATACATTTTAGGG + Intronic
1029933111 7:104394506-104394528 AGCATGTTTTATTTATTTTAGGG + Intronic
1030061043 7:105621524-105621546 AGTGTGCTTTAAACATTTTGTGG - Intronic
1030346464 7:108439114-108439136 AGTTTTCCATATACATTTTAAGG - Intronic
1030606443 7:111643550-111643572 AACTCTGTTTATACATTTTAGGG - Intergenic
1031081156 7:117258128-117258150 ACTTAGCTTTATACATTTTAAGG + Intergenic
1031197987 7:118640897-118640919 AGTTTGTTTTATACATTTTAGGG - Intergenic
1031453295 7:121949038-121949060 GTCTGGCTTTATACATTCTAGGG + Intronic
1031563465 7:123265741-123265763 ACCTTCCTTTTTAGATTTTATGG - Intergenic
1031625908 7:123992553-123992575 ACTTGGTTTTATACATTTTAGGG - Intergenic
1032235172 7:130115325-130115347 AGATTGGTATAAACATTTTAAGG + Intronic
1032338760 7:131051032-131051054 AGCTTGCATTATACTTCTTTTGG - Intergenic
1032422947 7:131797827-131797849 AACTTACTTTATATACTTTATGG - Intergenic
1032717507 7:134522550-134522572 GCCTGGTTTTATACATTTTAGGG - Intergenic
1032801327 7:135319382-135319404 AGGTGGTTTTATACATTTTAGGG - Intergenic
1033120039 7:138659622-138659644 AGCTTGTTTTATATATTTTAGGG - Intronic
1034000206 7:147403318-147403340 ACTTGGTTTTATACATTTTAGGG - Intronic
1034243700 7:149628338-149628360 TGGTGGTTTTATACATTTTAGGG + Intergenic
1034333772 7:150307166-150307188 GCCTAGTTTTATACATTTTAGGG + Intronic
1034387956 7:150756189-150756211 ATCTTTCTTGAAACATTTTATGG + Intergenic
1035217144 7:157376570-157376592 AGCTTGGTTTATACATTATAGGG + Intronic
1035286774 7:157811851-157811873 AGGCTGTTTTATACATTTTGGGG + Intronic
1035562961 8:620769-620791 AGTTTGCTTTATATATTTTGGGG - Intronic
1035810986 8:2490996-2491018 GCCTTGTTTTATACATTTTAGGG + Intergenic
1035837312 8:2768307-2768329 AGACTGCCATATACATTTTAGGG - Intergenic
1036455618 8:8904139-8904161 AGCTTGGTTTATACATTTTTGGG - Intergenic
1036486403 8:9183416-9183438 AGTTTTTTTTATACATTGTAGGG + Intergenic
1037421211 8:18704944-18704966 AACTTGCTTTCTTCATTTTGGGG - Intronic
1037502336 8:19498013-19498035 GTTTGGCTTTATACATTTTAGGG - Intronic
1037578203 8:20228021-20228043 AGATAGCTTTCTTCATTTTAAGG + Intergenic
1037965820 8:23133408-23133430 AGCTGGTTTTATACATTTTAGGG - Intergenic
1038605483 8:28998309-28998331 TTTTTGCTTTATGCATTTTAGGG + Intronic
1038710076 8:29935207-29935229 AGCTTGCTTTTTAGATTGTTAGG - Intergenic
1039121009 8:34146351-34146373 AGCTTGCTTTATACAGTCAAAGG + Intergenic
1039373827 8:37013551-37013573 GCTTAGCTTTATACATTTTAGGG - Intergenic
1039665284 8:39519265-39519287 AATTTGCTTTATACATTTAGGGG + Intergenic
1039713066 8:40077827-40077849 TTTTTGCTTTATACATTTTGAGG - Intergenic
1040417746 8:47210192-47210214 AGTTTGCTTTATACATTTCAGGG - Intergenic
1040622870 8:49109114-49109136 AGTTATTTTTATACATTTTAGGG - Intergenic
1040779426 8:51090590-51090612 AGTTGGCTTTATACATTTTAGGG + Intergenic
1040997924 8:53420505-53420527 GTTTGGCTTTATACATTTTAGGG - Intergenic
1041085873 8:54255769-54255791 AGCGTGCTTCTTACAATTTAAGG - Intergenic
1041592219 8:59601407-59601429 AGATTGGTTCATATATTTTAGGG - Intergenic
1042176265 8:66039646-66039668 AGCCCACTTTATACTTTTTAGGG + Intronic
1042357569 8:67845869-67845891 ATTTGGTTTTATACATTTTAAGG - Intergenic
1043676859 8:82967650-82967672 ACTTGGTTTTATACATTTTAGGG + Intergenic
1045156554 8:99480902-99480924 GGCTTGTTTTATACAGTATATGG + Intronic
1045253049 8:100497232-100497254 ACTTGGTTTTATACATTTTAGGG + Intergenic
1045645471 8:104293048-104293070 ACTTGGTTTTATACATTTTAGGG - Intergenic
1045660645 8:104434045-104434067 GTCTAGTTTTATACATTTTAGGG + Intronic
1046040763 8:108900999-108901021 ATTTTTCTTTATACATTTTGAGG - Intergenic
1046901625 8:119529725-119529747 GCCTTGCTTTTTCCATTTTATGG - Intergenic
1046919992 8:119717798-119717820 ATTTGGTTTTATACATTTTAGGG - Intergenic
1047353888 8:124101847-124101869 ACTTGGTTTTATACATTTTAGGG + Intronic
1048388510 8:133937061-133937083 GTTTTGTTTTATACATTTTAGGG - Intergenic
1048517006 8:135120409-135120431 AGCTTGCTGAATAAATTATATGG - Intergenic
1048520131 8:135146146-135146168 GGTTGGTTTTATACATTTTAGGG + Intergenic
1048642164 8:136375783-136375805 GCTTTGTTTTATACATTTTAGGG + Intergenic
1048766990 8:137855248-137855270 AGCTTGCCTTATTTATTTTAGGG + Intergenic
1049459563 8:142718567-142718589 TGTTTGCTTTATATATTTTGAGG - Intergenic
1049903371 9:191665-191687 AACATGCTTTATAAGTTTTATGG + Intergenic
1050118335 9:2283110-2283132 GCCTGGTTTTATACATTTTAGGG + Intergenic
1050445676 9:5719843-5719865 AGTTGGGTTTATTCATTTTATGG + Intronic
1050636686 9:7619944-7619966 AACTTGGTTTTTACATTTTAGGG + Intergenic
1050893836 9:10859591-10859613 AGGTTTGTGTATACATTTTATGG - Intergenic
1050951022 9:11593558-11593580 AGGTTGATTTATACATTTGTAGG + Intergenic
1050983737 9:12054915-12054937 ACTTGGTTTTATACATTTTAGGG + Intergenic
1050990473 9:12144867-12144889 GTGTGGCTTTATACATTTTAAGG - Intergenic
1051036658 9:12755059-12755081 TGATTACTTTATATATTTTAGGG + Intergenic
1051271001 9:15354726-15354748 ACATGGTTTTATACATTTTAGGG + Intergenic
1051544763 9:18261275-18261297 ATTTTGCTTGACACATTTTAAGG + Intergenic
1051717809 9:20003147-20003169 ACCATTCTTTATACATTTTGGGG - Intergenic
1052206977 9:25854385-25854407 GTTTTGTTTTATACATTTTAGGG - Intergenic
1053044757 9:34906262-34906284 ATTTGGTTTTATACATTTTAGGG + Intergenic
1053083291 9:35195409-35195431 GACTGGTTTTATACATTTTAAGG - Intronic
1053746383 9:41201959-41201981 AACATGCTTTATAAGTTTTATGG + Intergenic
1053852084 9:42299410-42299432 GCCTAGTTTTATACATTTTAGGG - Intergenic
1054480885 9:65663263-65663285 AACATGCTTTATAAGTTTTATGG - Intergenic
1054571950 9:66820592-66820614 GCCTAGTTTTATACATTTTAGGG + Intergenic
1054681960 9:68229319-68229341 AACATGCTTTATAAGTTTTATGG - Intergenic
1054947502 9:70811193-70811215 CGCTTGTTTTATTCATTTTGGGG - Intronic
1055214417 9:73840978-73841000 TCCCTGTTTTATACATTTTAGGG + Intergenic
1055329797 9:75171780-75171802 AGCTTTTTTTATACATATAAAGG - Intergenic
1055449488 9:76418040-76418062 GCCTAGTTTTATACATTTTAGGG + Intergenic
1055649585 9:78394249-78394271 ACTTAGTTTTATACATTTTAGGG - Intergenic
1056289250 9:85126210-85126232 GCCTAGTTTTATACATTTTAGGG - Intergenic
1056423935 9:86457310-86457332 GATTTGCATTATACATTTTATGG + Intergenic
1056699615 9:88891305-88891327 TGCATGTTTTATACAATTTATGG + Intergenic
1057256358 9:93550990-93551012 AACTTGCCTTTTATATTTTAGGG + Intronic
1057257041 9:93558221-93558243 AGCTTGATTGACAGATTTTACGG - Intronic
1057943985 9:99308747-99308769 GTTTTGTTTTATACATTTTAGGG - Intergenic
1058383767 9:104409241-104409263 ACTTGGTTTTATACATTTTAGGG - Intergenic
1058784885 9:108377226-108377248 TCATAGCTTTATACATTTTAGGG + Intergenic
1059536192 9:115083318-115083340 AGCTTGCTTTTTAGATATGAAGG + Intronic
1059572474 9:115454323-115454345 AGCTTGCTTCATAATATTTAAGG - Intergenic
1061031239 9:128084650-128084672 AGGTTGATTTATACATTTTAGGG - Intronic
1061726260 9:132583504-132583526 AGTTTGCTTTGTGCATTTTGGGG - Intronic
1202782515 9_KI270718v1_random:12734-12756 AACATGCTTTATAAGTTTTATGG + Intergenic
1185795638 X:2962160-2962182 AGCTTGTTTTATACATTTTAGGG - Intronic
1185817450 X:3169410-3169432 ACTTGGTTTTATACATTTTAGGG + Intergenic
1186003412 X:5040589-5040611 ATTTTGTTTTATATATTTTAGGG + Intergenic
1186218353 X:7324071-7324093 AGCTTGATTTATACATTTTAGGG + Intronic
1186255579 X:7714939-7714961 ACTTGGTTTTATACATTTTAGGG + Intergenic
1186440278 X:9580121-9580143 ACTTGGTTTTATACATTTTAGGG + Intronic
1187013039 X:15299264-15299286 GCCTAGTTTTATACATTTTAGGG + Intronic
1187223207 X:17349638-17349660 ATGTTGTTTTATGCATTTTAAGG + Intergenic
1187575670 X:20551746-20551768 TAGTTGCTTTATACATTTTGAGG - Intergenic
1187637558 X:21248221-21248243 AGATTGTTTTATATATTCTATGG - Intergenic
1188142075 X:26563290-26563312 AGTTTATTTTATACATTTTCAGG + Intergenic
1188624912 X:32271971-32271993 AGCTTATTATATACATTTAAGGG + Intronic
1189092836 X:38105360-38105382 GTTTTGTTTTATACATTTTAGGG + Intronic
1189187784 X:39069096-39069118 GGTTGGTTTTATACATTTTAGGG + Intergenic
1189691380 X:43620421-43620443 AACTGGCTTAATAGATTTTATGG - Intergenic
1189748345 X:44193326-44193348 AGCTTGGTTTATGTATTTTAGGG - Intronic
1190342920 X:49311631-49311653 AGCTTCCTTTATATCTTTGAAGG - Intronic
1190718412 X:53125069-53125091 TTCTTGCTTTATATATTTTGAGG + Intergenic
1190990318 X:55542526-55542548 ATTTTGCTTTATATATTTTGGGG + Intergenic
1191588462 X:62854282-62854304 GGTTAGTTTTATACATTTTAGGG + Intergenic
1191653429 X:63567718-63567740 AGTTTGTCTTATACATTTTTTGG - Intergenic
1191741183 X:64436748-64436770 GGTTGGTTTTATACATTTTAGGG - Intergenic
1191840131 X:65507544-65507566 AGTTTGCTTTATCCATTTGTGGG + Exonic
1191845275 X:65542625-65542647 GGTTGGTTTTATACATTTTAGGG - Intergenic
1192035641 X:67560063-67560085 AGTTTGCTTTAGACATTTTCTGG + Intronic
1192052508 X:67738603-67738625 ACTTTGCTTTATATATTTTGAGG - Intergenic
1192070712 X:67937675-67937697 AACTTGCTCTATAAATTTGAAGG + Intergenic
1192596953 X:72420627-72420649 CGTTTGCTTCATATATTTTAAGG + Intronic
1192623427 X:72703060-72703082 ACTTAGTTTTATACATTTTAGGG - Intronic
1192819972 X:74635214-74635236 ATCTTGATTTAGAGATTTTATGG - Intergenic
1192862382 X:75089496-75089518 AGTTTGCATTATACATTTATAGG - Intronic
1193372610 X:80714596-80714618 ACTTGGTTTTATACATTTTAGGG - Intronic
1193383789 X:80847359-80847381 AACTGGTTTTATACATTTTAGGG + Intergenic
1193530228 X:82647074-82647096 ACTTGGTTTTATACATTTTAGGG + Intergenic
1193631166 X:83889970-83889992 AGCTTGGTTTATAAATATTTCGG - Intergenic
1194084838 X:89513501-89513523 ATTTTGCTTTGTACATTTTGCGG - Intergenic
1194159407 X:90432391-90432413 AGCTTGGTTTTTACATTTTAGGG + Intergenic
1194197742 X:90915997-90916019 ACTTGGTTTTATACATTTTAGGG - Intergenic
1194199084 X:90933378-90933400 ACTTGGTTTTATACATTTTATGG - Intergenic
1194234284 X:91362652-91362674 GCTTGGCTTTATACATTTTAGGG + Intergenic
1194262201 X:91710219-91710241 ACTTTGTTTTATGCATTTTATGG + Intergenic
1194476546 X:94366144-94366166 GGTTGGTTTTATACATTTTAGGG - Intergenic
1194541065 X:95173012-95173034 GCTTTGTTTTATACATTTTAGGG - Intergenic
1194780077 X:98013443-98013465 ATCTTGCTATATTCAATTTATGG + Intergenic
1194824109 X:98540624-98540646 ACTTGGTTTTATACATTTTAGGG + Intergenic
1195463412 X:105153597-105153619 GCTTGGCTTTATACATTTTAGGG + Intronic
1196487124 X:116225094-116225116 ACTTGGTTTTATACATTTTAGGG + Intergenic
1196492533 X:116285506-116285528 GTTTGGCTTTATACATTTTAGGG + Intergenic
1197007413 X:121518536-121518558 AGCTAGATATATACATTTTAAGG + Intergenic
1197122743 X:122911505-122911527 AGCTTTCTTTATACGTTTGTTGG - Intergenic
1198156710 X:133967924-133967946 AGCCTGCTTTTTACTTTTTAAGG + Intronic
1198372425 X:136003590-136003612 ACCTTGTTTTATACATGTTTAGG + Intronic
1198880101 X:141271820-141271842 GGTTGGTTTTATACATTTTAGGG + Intergenic
1198913595 X:141640348-141640370 AGCTGGTTTTATACATTTTAGGG - Intronic
1198982891 X:142419378-142419400 GCCTAGTTTTATACATTTTAGGG - Intergenic
1199279255 X:145980925-145980947 ACTTGGTTTTATACATTTTAGGG - Intergenic
1199377357 X:147129526-147129548 GCCTAGTTTTATACATTTTAGGG - Intergenic
1200392443 X:155957671-155957693 AGCTTGCTTTATACATTTTAGGG - Intergenic
1200437486 Y:3169386-3169408 ATCTTGCTTTGTACATTTTGCGG - Intergenic
1200501865 Y:3960056-3960078 AAAATGGTTTATACATTTTAAGG - Intergenic
1200505707 Y:4009361-4009383 AGCTTGGTTTTTACATTTTAGGG + Intergenic
1200543997 Y:4496817-4496839 ACTTGGTTTTATACATTTTAGGG + Intergenic
1200581495 Y:4955052-4955074 ACTTTGTTTTATGCATTTTATGG + Intergenic
1200813701 Y:7509930-7509952 ACTTGGTTTTATACATTTTAGGG - Intergenic
1200968293 Y:9121654-9121676 ACCTAGTTTTATACATTTTAGGG + Intergenic
1201280127 Y:12335341-12335363 GCCTGGTTTTATACATTTTAGGG + Intergenic
1201296233 Y:12465572-12465594 AGCTTGGTTTACACATTTTAGGG - Intergenic
1201337225 Y:12893958-12893980 AGCTTGCTTTAGATAGTTAAAGG - Intergenic
1201357273 Y:13111397-13111419 AGCTACCTTTAAACATTTTGTGG - Intergenic
1201403358 Y:13627207-13627229 ACTTGGCTTAATACATTTTAGGG - Intergenic
1201667118 Y:16470786-16470808 AGCTGGCTTTATATATCTTAGGG + Intergenic
1201755368 Y:17481173-17481195 AGCTTCCTTTATACCTTTCAAGG + Intergenic
1201846184 Y:18424812-18424834 AGCTTCCTTTATACCTTTCAAGG - Intergenic
1201891651 Y:18949195-18949217 GCCTGGTTTTATACATTTTAGGG - Intergenic
1201921359 Y:19236417-19236439 AGTTTTCTTTATAGATTATATGG - Intergenic
1202103467 Y:21335741-21335763 CACTTGCTTTATTCATTTAATGG - Intergenic
1202142462 Y:21742422-21742444 ATCTAGTTTTATACATTTTAGGG - Intergenic
1202144396 Y:21763196-21763218 ATCTAGTTTTATACATTTTAGGG + Intergenic