ID: 972322926

View in Genome Browser
Species Human (GRCh38)
Location 4:37989439-37989461
Sequence TAGCTTGCTTTATACATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 2, 2: 17, 3: 61, 4: 411}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972322926_972322934 20 Left 972322926 4:37989439-37989461 CCTAAAATGTATAAAGCAAGCTA 0: 1
1: 2
2: 17
3: 61
4: 411
Right 972322934 4:37989482-37989504 ACGTGTTCTCAGGACCTCCTGGG No data
972322926_972322931 10 Left 972322926 4:37989439-37989461 CCTAAAATGTATAAAGCAAGCTA 0: 1
1: 2
2: 17
3: 61
4: 411
Right 972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG No data
972322926_972322935 21 Left 972322926 4:37989439-37989461 CCTAAAATGTATAAAGCAAGCTA 0: 1
1: 2
2: 17
3: 61
4: 411
Right 972322935 4:37989483-37989505 CGTGTTCTCAGGACCTCCTGGGG 0: 17
1: 409
2: 736
3: 1187
4: 1184
972322926_972322933 19 Left 972322926 4:37989439-37989461 CCTAAAATGTATAAAGCAAGCTA 0: 1
1: 2
2: 17
3: 61
4: 411
Right 972322933 4:37989481-37989503 CACGTGTTCTCAGGACCTCCTGG 0: 3
1: 27
2: 88
3: 162
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972322926 Original CRISPR TAGCTTGCTTTATACATTTT AGG (reversed) Intronic
900831354 1:4967931-4967953 CAGCTGGCTTTATACATTTTAGG + Intergenic
901585960 1:10292486-10292508 TACCCTGCTTTATAACTTTTTGG + Intronic
902662043 1:17911406-17911428 CAGCTTGGTTTATACATTTAGGG - Intergenic
903309494 1:22443296-22443318 CAGTTTGGTTTATTCATTTTAGG + Intergenic
903392537 1:22974712-22974734 TGGCTGATTTTATACATTTTAGG - Intergenic
904011000 1:27390651-27390673 TCTCTTGATTTATTCATTTTTGG - Intergenic
907617987 1:55944226-55944248 TAGCTGCCTTTCTCCATTTTTGG - Intergenic
908568275 1:65381384-65381406 TGGCTAACTTTTTACATTTTTGG - Intronic
908686605 1:66727190-66727212 AAGGTTTCTTTATACATTCTGGG - Intronic
908704661 1:66938586-66938608 TAGCTTGCTTAACATCTTTTGGG - Intronic
910426346 1:87123147-87123169 TGGCTTCCCTGATACATTTTGGG - Intronic
910525226 1:88170045-88170067 TAGCTTGCTTACTTCCTTTTGGG + Intergenic
911192483 1:94961514-94961536 TAGCCTCCATGATACATTTTGGG + Intergenic
911324763 1:96457363-96457385 TAACTTTTTTTATACATTGTTGG + Intergenic
911611131 1:99960190-99960212 TGGCCTGTTTTATATATTTTAGG + Intergenic
911939653 1:104025836-104025858 AAGCTTGCTTTATATATTTAGGG - Intergenic
912004535 1:104880792-104880814 TAGCTTGCTGTATCCTTCTTTGG - Intergenic
912810694 1:112792132-112792154 AACTTGGCTTTATACATTTTAGG + Intergenic
912981365 1:114376329-114376351 AGGCTGGTTTTATACATTTTAGG - Intergenic
913316508 1:117558384-117558406 TAGCTTGCTTTAGATTTTATAGG - Intergenic
913414286 1:118588393-118588415 CAGCTGGTTTTATACATTTCAGG + Intergenic
915990203 1:160507375-160507397 CTGTTTGCTTTATATATTTTGGG - Intronic
917251409 1:173065881-173065903 TAGGTTGCTTTTTATAGTTTTGG - Intergenic
917540801 1:175912256-175912278 TAGCTTTCTTTTTACATTTGGGG + Intergenic
917555317 1:176080184-176080206 TAGCTTTCTTTTTATTTTTTAGG - Intronic
917984847 1:180305760-180305782 CAGCATGATTTATACTTTTTTGG - Intronic
918735352 1:188055108-188055130 TAGTCTACTTTATTCATTTTAGG - Intergenic
919545625 1:198914518-198914540 TGGCCTGCTCTATAGATTTTGGG + Intergenic
920187788 1:204172389-204172411 TAGGTTACTTTTTACATTTAGGG - Intergenic
920603753 1:207358223-207358245 GAGCTAGCTTTATATATGTTTGG + Intronic
921231102 1:213072232-213072254 TGGCTTGATTCATACATTTAAGG + Intronic
921662684 1:217824600-217824622 TAGTTTGTTTTGTATATTTTAGG + Intronic
921662694 1:217825104-217825126 TAGTTTGTTTTGTATATTTTAGG - Intronic
922020285 1:221697642-221697664 TAGGTTACTTTGTCCATTTTGGG - Intergenic
924420372 1:243903835-243903857 AGACTTCCTTTATACATTTTTGG - Intergenic
1064527383 10:16271532-16271554 TAGCTAGCAGTTTACATTTTTGG + Intergenic
1065448938 10:25834816-25834838 GATCTTGCTTTATTCATTTATGG + Intergenic
1065512966 10:26497642-26497664 TATTTTGCTTTTCACATTTTTGG - Intronic
1065890944 10:30120526-30120548 TACCTTGCTTTATTCCTTGTGGG - Intergenic
1066322030 10:34312466-34312488 TAGTTTGGATTATACATCTTAGG - Intronic
1067520259 10:46995126-46995148 TTCCTTGCTTTATCCATTTGGGG + Intronic
1068316942 10:55357557-55357579 TACCTTCCTTTAGAGATTTTTGG + Intronic
1068729240 10:60337735-60337757 TATCTTGCTTTATTCATTTGTGG - Intronic
1068991080 10:63151249-63151271 TTGCTTGTTATAAACATTTTTGG - Intronic
1070622166 10:78021379-78021401 CAGTTTGCTTTATACATAGTTGG - Intronic
1071223486 10:83497593-83497615 AAGCTGGTTTTATACATTTTAGG - Intergenic
1071338322 10:84620444-84620466 TAGCTTTCTCTCTAGATTTTGGG + Intergenic
1071674114 10:87638797-87638819 CAGTTTGGTTTATACATTTTAGG + Intergenic
1072478831 10:95790940-95790962 AAGCATGCTTTCTAAATTTTTGG - Intronic
1073409731 10:103330412-103330434 TTGCTTGGTGTAAACATTTTGGG - Intronic
1073483774 10:103803846-103803868 CAGCCTGCGTTATACATTTTAGG + Intronic
1073645901 10:105303670-105303692 AAGCATGCTTTATACACTTCTGG - Intergenic
1073657192 10:105429315-105429337 TAGTTTCAGTTATACATTTTGGG + Intergenic
1076709565 10:132324778-132324800 AAGATGGTTTTATACATTTTAGG + Intronic
1076997526 11:305875-305897 CAGCTGGTTTTATACATTTCAGG - Intergenic
1077857228 11:6140336-6140358 TATTTTGCTTCATACATTTTGGG - Intergenic
1078202884 11:9199856-9199878 TAGAGTGCTTTAAACAATTTAGG - Intronic
1079420898 11:20286888-20286910 CAGTTTGTTTTATACATTTTAGG + Intergenic
1079483957 11:20914268-20914290 TACCTTGCTTTATACATCTTAGG + Intronic
1079530093 11:21441714-21441736 TATCTTTCTTTATAAATTGTTGG + Intronic
1080980220 11:37393925-37393947 TATTTTGCTTCATGCATTTTTGG + Intergenic
1081698077 11:45132348-45132370 GAGCTTGGTTTATGCCTTTTTGG - Intronic
1081949922 11:47036497-47036519 TAGCTAGCTCAGTACATTTTAGG + Intronic
1082565369 11:54671234-54671256 TAGAATGCTTTATATTTTTTTGG - Intergenic
1084220065 11:67672486-67672508 CAGCTTGGTTTACACACTTTAGG - Intronic
1084339406 11:68484882-68484904 CAGCCTTCTTTATATATTTTTGG + Intronic
1085004090 11:73068560-73068582 TAGATTCCTTTATATATTTTTGG + Intronic
1085240790 11:75053149-75053171 TTGCATGCCTTATAAATTTTTGG + Intergenic
1085626147 11:78074696-78074718 TTTATTGTTTTATACATTTTCGG - Intronic
1086201408 11:84207295-84207317 TATATTTCTTTATACACTTTGGG - Intronic
1086254247 11:84855706-84855728 TAGCTTCATTAATACATTCTTGG + Intronic
1086470025 11:87098309-87098331 AAGCTTGTTTTAAATATTTTAGG + Intronic
1086902194 11:92380584-92380606 TAGCTTGCTTTATAGAGCTGAGG + Intronic
1087844209 11:102953194-102953216 TAGGTTCCTTTATAAATTCTGGG - Intronic
1087964929 11:104400594-104400616 TAGCTATATATATACATTTTAGG - Intergenic
1089670813 11:120055846-120055868 TATCTTGCTTTCTCCATTGTAGG + Intergenic
1090302776 11:125660536-125660558 AATTTTGCTTTATACATTTTGGG + Intronic
1090348288 11:126088945-126088967 CAGCTTGCTTTACATATTTTTGG - Intergenic
1090598082 11:128341206-128341228 CAGCTTTATTTTTACATTTTGGG + Intergenic
1093028724 12:14268571-14268593 CAGCTTGGTTTATACATTTTGGG - Intergenic
1093136757 12:15461358-15461380 CACCTTGGTTTATACATTTTAGG - Intronic
1093157688 12:15707311-15707333 GAGAATGCTTTTTACATTTTTGG - Intronic
1093198033 12:16151985-16152007 TTGCTTCCTTCACACATTTTTGG + Intergenic
1093778367 12:23104461-23104483 AACCTTGCATTGTACATTTTTGG + Intergenic
1095180496 12:39142613-39142635 CAGCTTACTTTACACGTTTTAGG - Intergenic
1095257971 12:40062913-40062935 TAGCTTGCTATTAACTTTTTTGG - Intronic
1096340301 12:50792602-50792624 TATCTTGGTTTATATATTATAGG - Intronic
1097737813 12:63201866-63201888 TAGCATGATTTATAAACTTTTGG - Intergenic
1097817046 12:64086258-64086280 TCGGTTGCTTTGTACATTTAGGG - Intronic
1098291728 12:68962980-68963002 GACTTTGTTTTATACATTTTAGG - Intronic
1098330867 12:69351855-69351877 TAGCTTTTTGTATACATCTTTGG + Intronic
1098927503 12:76367194-76367216 CAGTTTGCTTTGTATATTTTGGG + Intronic
1099876616 12:88415246-88415268 AAATTTGCTTAATACATTTTTGG - Intergenic
1100392326 12:94154625-94154647 TAGCTTGCTCCATACAGGTTAGG - Intronic
1100548988 12:95629032-95629054 TATTTGGTTTTATACATTTTAGG + Intergenic
1100910051 12:99349666-99349688 AAATTTGCTTTATATATTTTGGG - Intronic
1101368793 12:104104398-104104420 TAACTTGTTTTAAACCTTTTAGG + Exonic
1101783071 12:107853815-107853837 TATCTTGCTTTTTGCATTTAGGG + Intergenic
1102378694 12:112444951-112444973 TATCTTGGTTTCTACATATTGGG - Intronic
1102416001 12:112763387-112763409 AACTTGGCTTTATACATTTTAGG + Intronic
1103228036 12:119304781-119304803 CAGTTTGGTTTATACATTTTAGG + Intergenic
1104530612 12:129567018-129567040 AAGCTGGTTTTATACGTTTTAGG - Intronic
1105461283 13:20590898-20590920 TAACTTGGTTTAAACATTTAAGG + Intronic
1106977822 13:35243050-35243072 TAGGTTTGTTTTTACATTTTTGG - Intronic
1107512832 13:41102340-41102362 AACTTTGTTTTATACATTTTAGG - Intergenic
1107669682 13:42732035-42732057 AGGCTGGTTTTATACATTTTAGG + Intergenic
1107901620 13:45021322-45021344 AAGCATGCTTAAAACATTTTGGG + Intronic
1108379573 13:49843207-49843229 AAACTGGTTTTATACATTTTAGG - Intergenic
1109401895 13:61843148-61843170 TAGATTGCTTTTTTCCTTTTTGG + Intergenic
1109526196 13:63579921-63579943 TAGCTTGCTTTTTATTTTATAGG - Intergenic
1109532828 13:63674580-63674602 TACATTGTTTTTTACATTTTTGG + Intergenic
1109638402 13:65153500-65153522 CAGCTGGTTATATACATTTTAGG + Intergenic
1109966814 13:69710663-69710685 TAGATTGCTTATTTCATTTTGGG - Intronic
1110388441 13:74942736-74942758 TACGTTACTTTATACATTGTTGG - Intergenic
1110781755 13:79474136-79474158 TAGCATGATTTATACTCTTTTGG + Intergenic
1111205335 13:85000584-85000606 TATCTTTCTTAATACAATTTAGG + Intergenic
1111571245 13:90088782-90088804 TAACTTGCTTCATGTATTTTGGG - Intergenic
1112868760 13:103942282-103942304 AGCCTGGCTTTATACATTTTAGG - Intergenic
1113294770 13:108946971-108946993 GAGGTTGCTTAATACATTTGTGG + Intronic
1113299610 13:109003553-109003575 TAGATTGCTTTAGACGTTTGTGG + Intronic
1114387476 14:22269959-22269981 CAGCTTGGCTTATACATTTTAGG + Intergenic
1114521946 14:23345087-23345109 CAGCTTGCTTTGTACATTTTAGG - Intergenic
1114707542 14:24742637-24742659 AAGTTGGTTTTATACATTTTAGG - Intergenic
1114798827 14:25747704-25747726 TAGCTTGCTTCATTCACATTTGG + Intergenic
1115303408 14:31910317-31910339 CACCTTGGTTTATGCATTTTAGG + Intergenic
1115509187 14:34123342-34123364 TAGCTTACTTTACTCATTTATGG + Intronic
1115901396 14:38152909-38152931 TAGCTGGATTTATCAATTTTGGG + Intergenic
1116003771 14:39270835-39270857 AAGCATTCTTTATACATTTAGGG + Intronic
1116194728 14:41709356-41709378 TAACCTGCTCTGTACATTTTTGG + Intronic
1116322336 14:43484883-43484905 TAGTTTGTTTTATATATTTCAGG + Intergenic
1116439119 14:44931087-44931109 AAACTTGCTGAATACATTTTGGG - Intronic
1116718715 14:48464142-48464164 CACCTTGCTTTATTGATTTTTGG - Intergenic
1116975451 14:51110647-51110669 TAGCTTCCTTTATTCAATGTAGG + Intergenic
1117395303 14:55303438-55303460 TATTTTGCTTTAAAAATTTTGGG + Intronic
1117707525 14:58486985-58487007 TATCTTGTTTTATTTATTTTAGG + Exonic
1117788242 14:59310000-59310022 TAGGTTTCTGTATAAATTTTAGG + Intronic
1117858891 14:60068604-60068626 AGGCTTATTTTATACATTTTGGG + Intergenic
1117901004 14:60533181-60533203 TTCCTTGCTTTATAAATTTTTGG + Intergenic
1118510885 14:66471880-66471902 CAGTTTGGTTTATACATTTTAGG - Intergenic
1119121279 14:72080400-72080422 TCGCATTCCTTATACATTTTGGG + Intronic
1120987623 14:90347813-90347835 TACTTGGCTTTATACATTTTAGG + Intergenic
1123808969 15:23904419-23904441 TAGATTGCTTTTCACTTTTTTGG + Intergenic
1125022328 15:34997621-34997643 TAGAATGTTTTATACATTTTAGG + Intergenic
1125035237 15:35116059-35116081 TAGTTTGCTTTTCACATTTTGGG + Intergenic
1125053010 15:35323307-35323329 TGTCTGGCTTTACACATTTTTGG + Intronic
1125332052 15:38592009-38592031 AACTTGGCTTTATACATTTTAGG - Intergenic
1125365497 15:38911105-38911127 TTCCTTGCTTTATCCATTTGAGG + Intergenic
1126036165 15:44547854-44547876 TAGGATGCTTTTTACATTTGGGG + Intronic
1127341779 15:58053359-58053381 TAGCATGCTTTTTGCTTTTTTGG - Intronic
1127883344 15:63177197-63177219 TAAGTTGCTTTATATATTGTAGG + Intergenic
1128048106 15:64637468-64637490 TAAATTGGTTTACACATTTTGGG - Intronic
1128400443 15:67274661-67274683 TTCCTTGCTTTGTTCATTTTGGG + Intronic
1128490736 15:68140433-68140455 TAGCTGGTTTTCTACATTCTGGG + Intronic
1129050578 15:72778378-72778400 TAATATGCTTTTTACATTTTGGG - Intronic
1129579137 15:76787140-76787162 TGTCTTTCTATATACATTTTTGG - Intronic
1131409957 15:92199383-92199405 TAGCTTGCTGAATATATATTTGG - Intergenic
1131826411 15:96325320-96325342 TTGCTTCCTTTATTCGTTTTGGG + Intergenic
1132280094 15:100605582-100605604 TATCTGGCTTTAGACTTTTTAGG - Intronic
1134001719 16:10788050-10788072 AACCTGGCTTCATACATTTTAGG + Intronic
1134171225 16:11971333-11971355 AACTTTGTTTTATACATTTTAGG + Intronic
1134201251 16:12201120-12201142 TGCCTTGCTTTATTCATATTTGG + Intronic
1135788661 16:25373469-25373491 AAGTTGGTTTTATACATTTTAGG - Intergenic
1137847003 16:51699735-51699757 CATCTTGCTTTATATTTTTTAGG - Intergenic
1139086404 16:63591972-63591994 CAGCTTCTTTTATCCATTTTAGG + Intergenic
1139246918 16:65453750-65453772 TTGCCTGCTTTATTCATTGTGGG - Intergenic
1139307270 16:65997707-65997729 TACCTTGCTTTGAACATTTTTGG + Intergenic
1140746026 16:77981055-77981077 TAGGTTGCCTTATAAATGTTTGG - Intergenic
1142879942 17:2876366-2876388 CAGGTGGTTTTATACATTTTAGG + Intronic
1143657827 17:8306973-8306995 TGGTTGGTTTTATACATTTTAGG - Intergenic
1144238283 17:13284176-13284198 TAATTGGTTTTATACATTTTAGG + Intergenic
1144330622 17:14220849-14220871 TAACATGCTTGATTCATTTTGGG + Intergenic
1146008223 17:29175741-29175763 AAGCTTGTTATATATATTTTAGG - Intronic
1146442812 17:32912067-32912089 TATCTTGCTTTAAGTATTTTGGG - Intergenic
1146592141 17:34136680-34136702 TGCCTGGTTTTATACATTTTAGG - Intronic
1146947239 17:36882213-36882235 CAGGTTGCATTGTACATTTTGGG - Intergenic
1147245996 17:39121320-39121342 AACTCTGCTTTATACATTTTAGG - Intronic
1147434446 17:40399803-40399825 AAACTTTCTTTAAACATTTTTGG - Intronic
1150274688 17:63888941-63888963 TAGCTTTCCTAATATATTTTTGG - Intergenic
1150554822 17:66244958-66244980 AGCCTGGCTTTATACATTTTAGG - Intronic
1151129774 17:71884622-71884644 TAGCTTGTTTTTTAAATTTATGG - Intergenic
1151525998 17:74668498-74668520 CAGCTTGGTTTATGTATTTTAGG - Intergenic
1151798759 17:76364879-76364901 AGGCTTGATTTATACATTTTAGG - Intronic
1153680792 18:7498817-7498839 AAGCTTGCCTTACATATTTTTGG + Intergenic
1153730570 18:8007377-8007399 TGGATTGCTTTATGGATTTTTGG - Intronic
1153847715 18:9064722-9064744 TAGGCTGTTTTATACTTTTTAGG + Intergenic
1154990917 18:21597775-21597797 CAGCTTCCTTTAGACATTTATGG - Intronic
1156178529 18:34576043-34576065 AAGCTTGCTTTATAAATGTAGGG - Intronic
1157069780 18:44392577-44392599 TGGCTTGCTTTTTTCATTTTTGG - Intergenic
1158718543 18:59901298-59901320 TGCCTTGTTTTCTACATTTTTGG + Intronic
1159046946 18:63377787-63377809 CAGCTTGGTTTATACATCTTAGG - Intergenic
1159104733 18:63993099-63993121 TTGCTGGCTCTCTACATTTTGGG + Intronic
1159239056 18:65717364-65717386 ATGTTTGCTTCATACATTTTGGG - Intergenic
1159338908 18:67109205-67109227 AAGCATGCTTTATACATCTGTGG + Intergenic
1159437740 18:68440573-68440595 TAGCTTGGCTTATACAATATGGG - Intergenic
1159992635 18:74928112-74928134 TAGCTTGGTTTATATATTTTAGG + Intronic
1160291522 18:77598884-77598906 CAGCTTGCTTTCTACATTTTAGG - Intergenic
1162688464 19:12408492-12408514 TAGTTTTCTTTATACATTCATGG - Intronic
1164450343 19:28356714-28356736 TCTCTTTCTTTATTCATTTTTGG - Intergenic
1165155946 19:33787699-33787721 TAGCTTGATTTACACCTTTTAGG + Intergenic
1165251788 19:34543939-34543961 TTGCTTTCTTTATATATTTCAGG - Intergenic
1165347293 19:35256997-35257019 TAGCTAATTTTTTACATTTTTGG + Intronic
1167200648 19:48062911-48062933 CAGCTTGGTTTAGACATTTTAGG + Intronic
1167700776 19:51043962-51043984 CAGTTTGGTTTATGCATTTTAGG + Intergenic
1167731551 19:51261064-51261086 TTTTTTGCTTTATATATTTTTGG + Intronic
926488256 2:13490711-13490733 TAGCTTTCTTTTTCCCTTTTGGG + Intergenic
926533220 2:14078234-14078256 TAGCTATCTACATACATTTTTGG + Intergenic
927252959 2:21014966-21014988 AAGCATGCCTTATACATCTTTGG + Intronic
928237179 2:29554173-29554195 TACCTTGCTTTATGGATCTTTGG + Intronic
929376065 2:41288655-41288677 TAGCTTGCTTTAGACTTTACAGG - Intergenic
930010056 2:46930398-46930420 CATCTAGCTTTTTACATTTTAGG - Intronic
932041019 2:68299801-68299823 GAGCTTGTTTTAAACAATTTTGG + Intronic
933141527 2:78796411-78796433 GAGGTTGTTTTATACATTGTAGG + Intergenic
933171124 2:79127161-79127183 GATTTTGCTTTATGCATTTTGGG + Intergenic
933514733 2:83286225-83286247 TAGCATCCTGTGTACATTTTAGG + Intergenic
935138095 2:100325263-100325285 TGGATTTCTTTATATATTTTTGG - Intergenic
935364548 2:102275626-102275648 TGGTTGGTTTTATACATTTTAGG - Intergenic
935818558 2:106870268-106870290 TAACTATCTTTATTCATTTTTGG - Intronic
935917740 2:107974479-107974501 TTGCTTCCTTTATATATTTTGGG - Intergenic
936734953 2:115429165-115429187 TTTTTTGCTTTATACATTTAAGG + Intronic
936828861 2:116615930-116615952 ATGTTTGCTTTATAGATTTTGGG - Intergenic
937777887 2:125802583-125802605 GTGTTTGCTTTATACATTTAAGG - Intergenic
939233899 2:139466885-139466907 TTCCTTGGTTAATACATTTTAGG + Intergenic
939347145 2:140980248-140980270 TAGATTGCTTATTACCTTTTTGG + Intronic
939744881 2:145956534-145956556 CAGTTTGGTGTATACATTTTAGG + Intergenic
941251105 2:163163963-163163985 AATTTTGCTTTATATATTTTTGG + Intergenic
941584360 2:167338637-167338659 ATGCTTGCTTTATACATTTTGGG - Intergenic
942675827 2:178426171-178426193 TTCCTTGCTTTATTCATTTGGGG + Intergenic
943235650 2:185315807-185315829 TAGTTTCCTTTGTAGATTTTAGG - Intergenic
944282474 2:197913630-197913652 CAGCTTGCTTTATAAACTTGAGG + Intronic
944359469 2:198835885-198835907 TAGCTTGGTTTATTTAATTTTGG - Intergenic
944509816 2:200453528-200453550 AAACTTCCTTTATACATTTAAGG - Intronic
944754889 2:202750778-202750800 TAGCTTGCTTCTGATATTTTGGG + Intronic
947253840 2:228139644-228139666 TCACTTGCTTGATACTTTTTCGG - Intronic
947466865 2:230358661-230358683 GAGCCTGATTGATACATTTTTGG - Intronic
948099878 2:235365197-235365219 TAACTTGCTTTATTCCTCTTTGG + Intergenic
948501013 2:238394279-238394301 TGCCTTTCTGTATACATTTTAGG + Intronic
1169731249 20:8787463-8787485 CAGCTTGCCTTATATGTTTTTGG + Intronic
1169797672 20:9481951-9481973 TAGGTTGCTCTTCACATTTTGGG + Intergenic
1170113786 20:12835135-12835157 TAAATTACTTTAGACATTTTGGG + Intergenic
1170376929 20:15710343-15710365 TAGCTTGCTGTTGTCATTTTAGG - Intronic
1171107102 20:22445016-22445038 TTGCTAGCTATGTACATTTTGGG + Intergenic
1171337998 20:24404348-24404370 TGCATTTCTTTATACATTTTAGG + Intergenic
1171506191 20:25635890-25635912 TGGCCGGTTTTATACATTTTAGG + Intergenic
1172157270 20:32836480-32836502 AAACTTGCTTTATAAATTTAGGG + Intronic
1173086966 20:39930862-39930884 AAGAATGCTTTATATATTTTAGG - Intergenic
1174236621 20:49098831-49098853 TATCTGGCTTTAAAGATTTTAGG + Intergenic
1174296846 20:49551583-49551605 CAGCTCGGTTTGTACATTTTAGG - Intronic
1174491673 20:50902575-50902597 TAGCTTTCTTTCTGCCTTTTTGG - Intronic
1174962123 20:55170305-55170327 GAGATTGCTTTATTCACTTTAGG + Intergenic
1176728412 21:10464634-10464656 TAACTTGCTCTAGCCATTTTAGG - Intergenic
1177176825 21:17708557-17708579 CAACTTGTTTTATACGTTTTAGG - Intergenic
1177557171 21:22706571-22706593 TAGCTTACCTTATTCCTTTTGGG - Intergenic
1177710396 21:24766275-24766297 TAGCTTTCTGCATACATTGTTGG - Intergenic
1178068150 21:28930253-28930275 TAGATTGCTTTGTAAATGTTTGG - Exonic
1178400623 21:32281962-32281984 CAGATTGCTACATACATTTTTGG - Intergenic
1178793584 21:35722718-35722740 TAGCTCTCTTTATCCAATTTGGG + Intronic
1183137686 22:35905161-35905183 TAATTTGCTTTGTAAATTTTTGG - Intronic
1184338666 22:43872792-43872814 AAGTTGGTTTTATACATTTTAGG - Intergenic
1184812465 22:46845713-46845735 TGGCATGCATTATTCATTTTGGG - Intronic
1185007298 22:48288580-48288602 TAGCATGCTTTAAACATTTATGG + Intergenic
1185076350 22:48685005-48685027 TAGTTGGTTTTATACATTTTAGG + Intronic
949242307 3:1887587-1887609 CAGCTTGGTTTATACATTTAGGG - Intergenic
950338133 3:12216010-12216032 TAGGGTGCTTTACATATTTTAGG - Intergenic
951230314 3:20171109-20171131 GGGCTTGCTTTATTCTTTTTTGG + Exonic
951287412 3:20831260-20831282 TAGAATGATTTATACACTTTTGG + Intergenic
951641309 3:24839321-24839343 TTTCTTGATTTATACTTTTTAGG + Intergenic
951943932 3:28113081-28113103 TGGCCTGCTTCATATATTTTAGG - Intergenic
951959911 3:28306262-28306284 TAGATTGCTTTGTGCATTATGGG + Intronic
952075440 3:29691001-29691023 TAGCAAGGTTTATACATGTTTGG + Intronic
952475140 3:33701200-33701222 TACCTTTCTATATACATTTCAGG - Intronic
952661422 3:35853920-35853942 TAGGATGATTTATATATTTTGGG + Intergenic
952913435 3:38210717-38210739 TATCTTCCTGTCTACATTTTTGG + Intronic
952988724 3:38812194-38812216 TTGCTTGCTTTCTATATTTTGGG + Intergenic
955439970 3:58945035-58945057 TAGAGTGCTTAATACATTGTTGG - Intronic
955822935 3:62915435-62915457 TAGCTTGTTTTATAATCTTTTGG + Intergenic
957027260 3:75195932-75195954 AACTTGGCTTTATACATTTTAGG - Intergenic
957449814 3:80365237-80365259 TAGATTCCTGTATGCATTTTAGG - Intergenic
957777112 3:84767506-84767528 AAGCTTGATTTATTCTTTTTTGG - Intergenic
958024450 3:88034341-88034363 AAGCTTTCTTTCTTCATTTTTGG - Intergenic
958110853 3:89142514-89142536 TACTTTGCTGTAAACATTTTGGG - Intronic
958581854 3:96036676-96036698 TAATTCTCTTTATACATTTTTGG + Intergenic
959365102 3:105447918-105447940 TATCTTGCTTGTTATATTTTTGG - Intronic
960641225 3:119825250-119825272 TAGTTTGTTTTATACTTTTAAGG - Intronic
960834390 3:121889969-121889991 TAGCTGGTTTTTTACATTTTAGG + Intergenic
960976732 3:123182789-123182811 TAACTGGCTTTATTCATTTGTGG + Intronic
961061982 3:123836457-123836479 TATTTTGCTTAATATATTTTGGG + Intronic
961316977 3:126044996-126045018 TTGCTTGATTTCCACATTTTTGG - Intronic
961946919 3:130700964-130700986 TAGCTGACTTTATAGAATTTGGG - Intronic
961957479 3:130818922-130818944 AACTTGGCTTTATACATTTTAGG - Intergenic
962272522 3:133988489-133988511 CAGCTGGTTTTATACATTTTAGG - Intronic
962651977 3:137504685-137504707 TAATTTGCTTTATACCTTTAGGG + Intergenic
963391450 3:144669322-144669344 TGACTTGCCTTATAAATTTTAGG - Intergenic
964303983 3:155321033-155321055 TAGCTTGTTCAATATATTTTAGG - Intergenic
965133206 3:164727357-164727379 ATTTTTGCTTTATACATTTTTGG + Intergenic
965423491 3:168492223-168492245 TAGCTTAATTTATTCATGTTTGG + Intergenic
967088178 3:186112700-186112722 TAACTTGCTTTTGGCATTTTAGG - Intronic
967365847 3:188685662-188685684 TAGCTGGGTTTATCCATTTGAGG - Intronic
967523114 3:190458597-190458619 TAGGTAGCTTTTTTCATTTTTGG + Intergenic
970697303 4:18693326-18693348 TAGCTTGTTGTAGAAATTTTGGG + Intergenic
970930070 4:21500099-21500121 TTGCTTGCTTCCTACATGTTGGG - Intronic
971565628 4:28136985-28137007 TAGGTTGCTTTCAATATTTTTGG + Intergenic
971632730 4:29015287-29015309 TAGCATGCTTTATATTTTTTTGG + Intergenic
971794438 4:31208639-31208661 TATATTACTTTATACATTTAAGG - Intergenic
972055117 4:34792386-34792408 CAGCTGGTTTTATACGTTTTCGG + Intergenic
972322926 4:37989439-37989461 TAGCTTGCTTTATACATTTTAGG - Intronic
972911885 4:43827166-43827188 AATCTTTCTTTAAACATTTTGGG - Intergenic
973193549 4:47414296-47414318 AGTTTTGCTTTATACATTTTAGG + Intronic
974678469 4:65128990-65129012 AAGATTGCTTTGTATATTTTGGG + Intergenic
975029069 4:69591256-69591278 CAGCTTGGTTTTTACATTTTAGG + Intronic
975090685 4:70400003-70400025 TACTTTGCATTATATATTTTTGG - Intronic
975682567 4:76890934-76890956 TTGATTCCTCTATACATTTTTGG - Intergenic
975735819 4:77380000-77380022 GAGCTGGCTTTATACATTCAGGG - Intronic
975843531 4:78501449-78501471 TAGCATGATTTATAATTTTTTGG + Intronic
976253458 4:83076837-83076859 TAGCATGCTTTATAATTTTTTGG - Intergenic
977345506 4:95811681-95811703 CAGCTGGTTTCATACATTTTAGG - Intergenic
978129308 4:105175175-105175197 TAGCATGCCTTATAATTTTTTGG - Intronic
978213504 4:106168117-106168139 TAATTTGTTTTATACATTGTTGG - Intronic
978275468 4:106944081-106944103 CAGCTTCCTTTAAACATCTTGGG + Intronic
978597553 4:110394504-110394526 CATTTTGCTTTATGCATTTTAGG - Intronic
978904218 4:113986657-113986679 TAGCTACATTTATACATGTTTGG - Intergenic
979266644 4:118711115-118711137 ATGCTTGGTTTATACATTTTGGG + Exonic
979790174 4:124770335-124770357 TATCTTGCTTTTTACTTTTTTGG + Intergenic
980772043 4:137386943-137386965 TATCTGGCTTTATACAAATTGGG - Intergenic
981473412 4:145162654-145162676 GAGCTTTCTTTATACTTTATGGG + Exonic
981802021 4:148668915-148668937 AAGCTTGATCTAAACATTTTTGG + Intergenic
981966613 4:150611228-150611250 TAGCATGCCTAATACATTATTGG - Intronic
982767104 4:159361641-159361663 AAGCTTGCATTATTCATTTTGGG - Intergenic
982875376 4:160641632-160641654 TAGCTTTATTTATTTATTTTTGG - Intergenic
983728718 4:170966022-170966044 GTACTTGCTTTATTCATTTTTGG + Intergenic
984357337 4:178679736-178679758 TAGCTTACTTAGCACATTTTGGG + Intergenic
985226834 4:187770453-187770475 CAGCTTGGTTTATACATTTTAGG + Intergenic
987096586 5:14555995-14556017 CAACTTGGTTTATACATTTTAGG + Intergenic
987341404 5:16942675-16942697 TAGCTTGAATTATAGATTTGGGG - Intergenic
987449042 5:18058915-18058937 TACATTGCTTTATACATTTATGG + Intergenic
988932154 5:36047233-36047255 AGGCTGGTTTTATACATTTTAGG - Intronic
989555348 5:42788648-42788670 TAGTGTTCTTTATATATTTTTGG + Intronic
989555485 5:42790078-42790100 TAGTGTTCTTTATATATTTTTGG - Intronic
989971371 5:50528721-50528743 CATTGTGCTTTATACATTTTTGG - Intergenic
991100181 5:62783453-62783475 GGGCTTGCTTTTTACTTTTTTGG + Intergenic
992147826 5:73869743-73869765 TAGCTTAGTTTTTATATTTTTGG - Intronic
993227107 5:85181455-85181477 TTGTTTGCTTTATATGTTTTGGG - Intergenic
993331391 5:86604870-86604892 TAGCTTCATTTATTCTTTTTAGG - Intergenic
994312775 5:98294916-98294938 TATCTTCCCATATACATTTTAGG - Intergenic
995884699 5:116881131-116881153 TTGCATGTTTTATATATTTTTGG + Intergenic
996000882 5:118362124-118362146 TAGAATGATTTATATATTTTTGG - Intergenic
996979714 5:129475870-129475892 TATATTTCTATATACATTTTAGG + Intronic
998000888 5:138624811-138624833 AAGCTTACTTTGTTCATTTTTGG + Intronic
999564630 5:152843821-152843843 AAGCTTGCTGTAACCATTTTAGG - Intergenic
999832055 5:155329857-155329879 TATGTTGTTTTCTACATTTTAGG - Intergenic
1000568764 5:162883969-162883991 TAGTTTTTTTTTTACATTTTAGG + Intergenic
1000793391 5:165634270-165634292 AACCTGGCTTCATACATTTTAGG + Intergenic
1002049766 5:176563853-176563875 AAGCTTGTTTAATTCATTTTTGG + Intronic
1003133858 6:3418070-3418092 CAGCTTGGTTTATACACTCTGGG + Intronic
1007366201 6:41395568-41395590 TCTCTTGATTTATTCATTTTAGG - Intergenic
1008175434 6:48262955-48262977 CAGCTTGGTTTATACATTTTAGG + Intergenic
1008829683 6:55742564-55742586 TTTCTTTCTTTCTACATTTTCGG + Intergenic
1009784143 6:68310090-68310112 TAACTTGTTTGATTCATTTTGGG - Intergenic
1010741498 6:79510729-79510751 TTGTTTGCTTTATCTATTTTTGG - Intronic
1011235087 6:85207644-85207666 TAGCATGATTTATAATTTTTTGG - Intergenic
1012165424 6:95944733-95944755 GTTCTTGCTTTATATATTTTGGG - Intergenic
1012264051 6:97119739-97119761 TGGCTTCCTGTATACATTTAGGG + Intronic
1012432472 6:99179075-99179097 TAACTTGGTTTATACATTTTAGG - Intergenic
1013385236 6:109622737-109622759 TATTTTGGTATATACATTTTTGG + Intronic
1014241902 6:119027245-119027267 CAACTTGGTTTATACATTGTAGG - Intronic
1014536924 6:122625436-122625458 TAACCTGCTTTATACATTCATGG - Intronic
1014848824 6:126314314-126314336 TAACTTGGTTTAAACATTTTAGG - Intergenic
1015283726 6:131461466-131461488 ATGTTTGCCTTATACATTTTTGG - Intergenic
1015754836 6:136596732-136596754 CAGTTTGCTTTATACGTTTGTGG + Intronic
1016049205 6:139512992-139513014 TAGTTTGCGTGATACATTTATGG + Intergenic
1016176409 6:141081958-141081980 TAGCTTGCTTTCTATTTTGTAGG + Intergenic
1016806273 6:148215429-148215451 TAGCATGATTTAAACATATTAGG - Intergenic
1016859528 6:148703350-148703372 TTGTTTGTTTTATACATTGTTGG + Intergenic
1017635112 6:156436071-156436093 AAGCTTGCTTTCTAGATGTTTGG + Intergenic
1018137762 6:160794387-160794409 TAGCTTTCTTTCTACCTTTAGGG - Intergenic
1018881027 6:167880953-167880975 TATGTTTCTTTATAAATTTTAGG + Intronic
1019131458 6:169880050-169880072 TAGCTTTGCTTGTACATTTTTGG + Intergenic
1019860602 7:3655042-3655064 TAGCTTGCTTTTTTTTTTTTTGG + Intronic
1020226369 7:6283573-6283595 TAGAGTTCTTTATACATTCTAGG - Intergenic
1020764370 7:12302193-12302215 TAGCTTTCTTTATTCCTTTAGGG - Intergenic
1020939609 7:14515577-14515599 TTCCTTGATTTATACATTTTTGG - Intronic
1021304695 7:19018062-19018084 ATGTTTGCTTTATATATTTTAGG - Intergenic
1022005765 7:26264268-26264290 CAGCTTGTTTTATACATTTTTGG + Intergenic
1022693088 7:32677310-32677332 TAGTTTTCTAGATACATTTTAGG - Intergenic
1022891617 7:34706690-34706712 TTGCATTCTTTTTACATTTTGGG - Intronic
1023599712 7:41869618-41869640 CAGATTGCTTTATCCATTTGGGG - Intergenic
1024634928 7:51279245-51279267 TAGCTTCTTCCATACATTTTTGG - Intronic
1026200362 7:68209171-68209193 CAGCTTGGTTTACACATTTTAGG + Intergenic
1026623204 7:71969569-71969591 TACCATGCTTTATTCAATTTGGG + Intronic
1027517860 7:79164786-79164808 AGGTTTGTTTTATACATTTTAGG - Intronic
1027837984 7:83270457-83270479 TAACTTGGTTCATTCATTTTAGG + Intergenic
1027980583 7:85215039-85215061 TAGCTTGTATTATAAAATTTAGG + Intergenic
1028215594 7:88128318-88128340 TAACTTGCTATATCCATTGTGGG + Intronic
1028497994 7:91483632-91483654 TTGCTTTCTTTTTACATTGTTGG + Intergenic
1029002205 7:97166269-97166291 CAGCTTGCTTTATACATTTTAGG + Intronic
1030146994 7:106367030-106367052 TGTCATGTTTTATACATTTTTGG + Intergenic
1030848056 7:114447082-114447104 TAGCTTGCTTTCTTCATTTGTGG - Intronic
1031092803 7:117381259-117381281 TAGCTATATTTATACTTTTTAGG - Intronic
1031197988 7:118640898-118640920 TAGTTTGTTTTATACATTTTAGG - Intergenic
1031828546 7:126597661-126597683 TAGCTTCTTTTATCCATCTTTGG + Intronic
1032801328 7:135319383-135319405 AAGGTGGTTTTATACATTTTAGG - Intergenic
1033120040 7:138659623-138659645 TAGCTTGTTTTATATATTTTAGG - Intronic
1033874647 7:145800064-145800086 TAGCTTGATTTATGCTTTTGAGG - Intergenic
1034320721 7:150179058-150179080 AAGATTTCTTTCTACATTTTGGG - Intergenic
1034601677 7:152263336-152263358 TAACTTGCTCTAGCCATTTTAGG + Intronic
1034772015 7:153788190-153788212 AAGATTTCTTTCTACATTTTGGG + Intergenic
1035217143 7:157376569-157376591 CAGCTTGGTTTATACATTATAGG + Intronic
1035286773 7:157811850-157811872 GAGGCTGTTTTATACATTTTGGG + Intronic
1035562962 8:620770-620792 CAGTTTGCTTTATATATTTTGGG - Intronic
1035810985 8:2490995-2491017 AGCCTTGTTTTATACATTTTAGG + Intergenic
1035837313 8:2768308-2768330 TAGACTGCCATATACATTTTAGG - Intergenic
1035982677 8:4390896-4390918 TAACTACCTTTCTACATTTTGGG - Intronic
1036071580 8:5446235-5446257 AAGATTGCTTTATCTATTTTAGG + Intergenic
1036455619 8:8904140-8904162 CAGCTTGGTTTATACATTTTTGG - Intergenic
1037421212 8:18704945-18704967 AAACTTGCTTTCTTCATTTTGGG - Intronic
1037965821 8:23133409-23133431 CAGCTGGTTTTATACATTTTAGG - Intergenic
1038217499 8:25576163-25576185 TAGCATTTGTTATACATTTTTGG - Intergenic
1038605482 8:28998308-28998330 TTTTTTGCTTTATGCATTTTAGG + Intronic
1039377777 8:37053873-37053895 TGGTTTGCATAATACATTTTTGG - Intergenic
1039665283 8:39519264-39519286 AAATTTGCTTTATACATTTAGGG + Intergenic
1040417747 8:47210193-47210215 CAGTTTGCTTTATACATTTCAGG - Intergenic
1040659335 8:49551997-49552019 TAGTGTGCTTCATATATTTTAGG + Intronic
1040779425 8:51090589-51090611 CAGTTGGCTTTATACATTTTAGG + Intergenic
1041210517 8:55545927-55545949 CAGCTTTGTATATACATTTTAGG - Intergenic
1042682684 8:71403911-71403933 TATCTTTCTTTACACATATTTGG + Exonic
1042999008 8:74734404-74734426 CAGTGTGTTTTATACATTTTTGG - Intronic
1043203202 8:77399278-77399300 TAGCTTGCATAATATATTATTGG + Intergenic
1043322511 8:79007288-79007310 TAGCTTCCCTTATAAATTTTGGG - Intergenic
1044013331 8:87021117-87021139 CAGCTTGGTTTATGTATTTTAGG - Intronic
1046373002 8:113335905-113335927 TATTTTGGTTTATCCATTTTGGG + Intronic
1046484200 8:114863956-114863978 TAACTTTTTTAATACATTTTTGG - Intergenic
1046959409 8:120094422-120094444 TACCTTGCTTTGATCATTTTTGG - Intronic
1046966697 8:120175291-120175313 CAGCTTTCTTTAATCATTTTTGG + Intronic
1047135141 8:122069508-122069530 CAGCTTGATTTTTACATTTTAGG + Intergenic
1047386480 8:124414935-124414957 TTGGTTGCTTTATTTATTTTGGG - Intergenic
1047979329 8:130164032-130164054 TACCTTGCATTAGAAATTTTAGG - Intronic
1048266653 8:132993036-132993058 TTGCTTGCTTGTTAGATTTTGGG + Intronic
1048766989 8:137855247-137855269 AAGCTTGCCTTATTTATTTTAGG + Intergenic
1049953548 9:670230-670252 TTCCTTGCTTTATACATTTGGGG + Intronic
1050280007 9:4040537-4040559 TTGCTTGCATTAAAGATTTTAGG - Intronic
1050636685 9:7619943-7619965 CAACTTGGTTTTTACATTTTAGG + Intergenic
1050800417 9:9605255-9605277 CAGAGTGCTTTATACATATTAGG - Intronic
1051717810 9:20003148-20003170 GACCATTCTTTATACATTTTGGG - Intergenic
1052308786 9:27041326-27041348 TATGTTGCATTATAAATTTTTGG + Intronic
1052912429 9:33895535-33895557 TAAATTGCTATATAAATTTTAGG + Intronic
1053540442 9:38968258-38968280 CAGCTTGATTTTTACATTTAGGG - Intergenic
1053611616 9:39719401-39719423 TTGCATGCTTATTACATTTTTGG - Intergenic
1053804791 9:41790416-41790438 CAGCTTGATTTTTACATTTAGGG - Intergenic
1054086639 9:60751759-60751781 TTGCATGCTTATTACATTTTTGG + Intergenic
1054140494 9:61525050-61525072 CAGCTTGATTTTTACATTTAGGG + Intergenic
1054241905 9:62622988-62623010 TTGCATGCTTATTACATTTTTGG + Intergenic
1054556029 9:66657502-66657524 TTGCATGCTTATTACATTTTTGG + Intergenic
1054625698 9:67395665-67395687 CAGCTTGATTTTTACATTTAGGG + Intergenic
1054947503 9:70811194-70811216 CCGCTTGTTTTATTCATTTTGGG - Intronic
1055154861 9:73049593-73049615 TATCTTGCTTTAAATTTTTTTGG + Intronic
1056739314 9:89239962-89239984 TATCTTGCTTATTATATTTTAGG + Intergenic
1058303978 9:103413318-103413340 TAGCTCTCTTTCTACATTATAGG + Intergenic
1058577131 9:106415709-106415731 TACCTTCCTTTCTACATTTAAGG - Intergenic
1059266420 9:113036050-113036072 TAGATTGCTTTATACATCCTTGG + Intergenic
1059931124 9:119262203-119262225 TAGCTTGCTAGAGAGATTTTTGG - Intronic
1060655045 9:125365979-125366001 TTGCTTTCTTTCTCCATTTTAGG + Intronic
1061031240 9:128084651-128084673 CAGGTTGATTTATACATTTTAGG - Intronic
1061726261 9:132583505-132583527 AAGTTTGCTTTGTGCATTTTGGG - Intronic
1185715100 X:2335288-2335310 ACGCTGGTTTTATACATTTTAGG + Intronic
1185795639 X:2962161-2962183 CAGCTTGTTTTATACATTTTAGG - Intronic
1186218352 X:7324070-7324092 CAGCTTGATTTATACATTTTAGG + Intronic
1187845726 X:23534611-23534633 TAGCTTGCCTTTTAACTTTTTGG - Intergenic
1187896417 X:23984130-23984152 TGGTTTTCTTTTTACATTTTGGG - Exonic
1188788368 X:34377128-34377150 TAGCTTTCTGTTTACATCTTAGG - Intergenic
1189547931 X:42062057-42062079 TAGATTGCTTTAGACAGTATGGG + Intergenic
1189748346 X:44193327-44193349 CAGCTTGGTTTATGTATTTTAGG - Intronic
1190001336 X:46690462-46690484 TGGGTTCCCTTATACATTTTGGG + Intronic
1190990317 X:55542525-55542547 TATTTTGCTTTATATATTTTGGG + Intergenic
1191169786 X:57431722-57431744 TACTTTGCTCTATATATTTTGGG + Intronic
1191195975 X:57723414-57723436 TTTCTTGCTTTATCCATTTGGGG + Intergenic
1191830884 X:65415001-65415023 CAGCTTGTTTTATACATTTTGGG + Intronic
1191840130 X:65507543-65507565 TAGTTTGCTTTATCCATTTGTGG + Exonic
1193383788 X:80847358-80847380 CAACTGGTTTTATACATTTTAGG + Intergenic
1194159406 X:90432390-90432412 CAGCTTGGTTTTTACATTTTAGG + Intergenic
1197577690 X:128237472-128237494 TAGCATTCTTTGCACATTTTGGG - Intergenic
1197956661 X:131957468-131957490 ATTCTTGCTTCATACATTTTAGG - Intergenic
1197996343 X:132379308-132379330 TGGCTTACTATATACATTCTTGG - Exonic
1198913596 X:141640349-141640371 CAGCTGGTTTTATACATTTTAGG - Intronic
1199932959 X:152543551-152543573 CAGCTTGCTTTCCACAATTTGGG - Intergenic
1200392444 X:155957672-155957694 CAGCTTGCTTTATACATTTTAGG - Intergenic
1200505706 Y:4009360-4009382 CAGCTTGGTTTTTACATTTTAGG + Intergenic
1200819622 Y:7569163-7569185 TAGCATGATTTATAAACTTTTGG - Intergenic
1200968292 Y:9121653-9121675 AACCTAGTTTTATACATTTTAGG + Intergenic
1201296234 Y:12465573-12465595 CAGCTTGGTTTACACATTTTAGG - Intergenic
1201605946 Y:15785307-15785329 GAAGTTGCTTAATACATTTTAGG - Intergenic
1201667117 Y:16470785-16470807 CAGCTGGCTTTATATATCTTAGG + Intergenic
1202142463 Y:21742423-21742445 AATCTAGTTTTATACATTTTAGG - Intergenic
1202144395 Y:21763195-21763217 AATCTAGTTTTATACATTTTAGG + Intergenic