ID: 972322931

View in Genome Browser
Species Human (GRCh38)
Location 4:37989472-37989494
Sequence CACCTTGAGCACGTGTTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972322925_972322931 11 Left 972322925 4:37989438-37989460 CCCTAAAATGTATAAAGCAAGCT 0: 5
1: 10
2: 31
3: 82
4: 672
Right 972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG No data
972322926_972322931 10 Left 972322926 4:37989439-37989461 CCTAAAATGTATAAAGCAAGCTA 0: 1
1: 2
2: 17
3: 61
4: 411
Right 972322931 4:37989472-37989494 CACCTTGAGCACGTGTTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972322931 Original CRISPR CACCTTGAGCACGTGTTCTC AGG Intronic
No off target data available for this crispr