ID: 972324883

View in Genome Browser
Species Human (GRCh38)
Location 4:38006027-38006049
Sequence CCTGCTATGTAAAATGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 6, 3: 31, 4: 324}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972324883_972324888 -6 Left 972324883 4:38006027-38006049 CCTTTCTCATTTTACATAGCAGG 0: 1
1: 0
2: 6
3: 31
4: 324
Right 972324888 4:38006044-38006066 AGCAGGGAGCAGAGAGGGCATGG 0: 1
1: 0
2: 8
3: 150
4: 1263
972324883_972324889 -5 Left 972324883 4:38006027-38006049 CCTTTCTCATTTTACATAGCAGG 0: 1
1: 0
2: 6
3: 31
4: 324
Right 972324889 4:38006045-38006067 GCAGGGAGCAGAGAGGGCATGGG 0: 1
1: 0
2: 4
3: 84
4: 847
972324883_972324890 2 Left 972324883 4:38006027-38006049 CCTTTCTCATTTTACATAGCAGG 0: 1
1: 0
2: 6
3: 31
4: 324
Right 972324890 4:38006052-38006074 GCAGAGAGGGCATGGGAATAAGG 0: 1
1: 0
2: 1
3: 43
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972324883 Original CRISPR CCTGCTATGTAAAATGAGAA AGG (reversed) Intronic
900457157 1:2782759-2782781 CCTCCTCTGTAAAAGGAGGAGGG - Intronic
902113808 1:14104732-14104754 CCTGCTCTGAAAAATGATAAGGG - Intergenic
902244032 1:15107545-15107567 CCTCATTTGTAAAATGAGTATGG + Intronic
902708355 1:18221965-18221987 CCTCATCTGTAAAATGAGAAGGG - Intronic
903497990 1:23784014-23784036 CCTCATCTGTAAAATGGGAATGG - Intronic
906834075 1:49064045-49064067 TCTGATTTGTAAAATGGGAATGG + Intronic
907044699 1:51293502-51293524 ACTGCTCTGTAAAATGGGAAAGG + Intronic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907590064 1:55658049-55658071 CCTGCTTTTTAAACTGAGACTGG + Intergenic
909205234 1:72748096-72748118 CCTACTATTTAAAATGTAAATGG + Intergenic
909859333 1:80585147-80585169 CGTGGTATATATAATGAGAAGGG + Intergenic
912282573 1:108331898-108331920 AGTGCTATGGAAATTGAGAAGGG + Intergenic
916462347 1:165039248-165039270 CCTGATAAGTAGAATTAGAAAGG + Intergenic
918655140 1:187016097-187016119 CCTCATCTCTAAAATGAGAATGG + Intergenic
918854158 1:189729490-189729512 CCTGCTAACTAAAATGGAAATGG - Intergenic
920095584 1:203484348-203484370 CCTCATCTGTAAAGTGAGAATGG + Intronic
920177403 1:204111270-204111292 CCTCATCTGTAAAATGAGCATGG - Intronic
920436032 1:205947791-205947813 CCTCATATGTAAAATGAGGGAGG - Intergenic
920918901 1:210281578-210281600 CCTGCTATAAAAACTGAGAAAGG - Intergenic
921445438 1:215241793-215241815 CCTAATATGTAAAATGACGATGG + Intergenic
921490735 1:215772716-215772738 CTTGCTATGTGAAATTATAATGG - Intronic
922994770 1:229946797-229946819 CCTGATATGTAAAATAAGATTGG - Intergenic
923262419 1:232279830-232279852 CTTCCTCTGTAAAATGAGGATGG + Intergenic
923315008 1:232771899-232771921 CCTTCTATGTGACATGAAAAAGG + Intergenic
923854536 1:237831701-237831723 CCTGTTATGTTGAATGAGTATGG + Intronic
924219883 1:241863221-241863243 CCTCATCTGTAAAATGAGAATGG - Intronic
924588905 1:245384585-245384607 CCTTATCTTTAAAATGAGAATGG - Intronic
1063523155 10:6758991-6759013 CCTTCTATCAAAAATGAAAATGG + Intergenic
1063618446 10:7623074-7623096 ACTGCTATGTAAAATGCCAAAGG + Intronic
1065469041 10:26057569-26057591 ACTGCTATGTAAAATGAGCTAGG + Intronic
1065469520 10:26063022-26063044 ACTGCTATCTAAAATGAGCTAGG + Intronic
1065865214 10:29909124-29909146 CCTCCTGTGCAAAATGAGCAAGG + Intergenic
1065982973 10:30920565-30920587 ACTGCCAAGTAAAATGAGGATGG - Intronic
1067915621 10:50394984-50395006 CCTGTTATGTAAAAGCAAAAAGG - Intronic
1068870379 10:61937065-61937087 CCTCATCAGTAAAATGAGAAAGG + Intronic
1069865807 10:71502065-71502087 CCCTCTCTGCAAAATGAGAAGGG + Intronic
1070348572 10:75569609-75569631 CCTGCTAAGTGAAATGAAAATGG - Intronic
1070433384 10:76363574-76363596 TGTGGTATGTAAAATTAGAAAGG + Intronic
1071710203 10:88042394-88042416 CTTGATATGAAAAATGTGAATGG + Intergenic
1074048302 10:109859681-109859703 AATGCTATGTAAACTTAGAAAGG - Intergenic
1074059086 10:109948693-109948715 CCTCCTCTGTGAAATGAGGATGG - Intronic
1074102666 10:110365728-110365750 CCTCATCTGTAAAATGGGAATGG + Intergenic
1074374848 10:112931782-112931804 TATTCTATGTAAAATGATAATGG + Intergenic
1075601061 10:123769691-123769713 CCTGCCATGTAAGACAAGAAGGG + Intronic
1076297165 10:129395099-129395121 CCTGACATGTCAGATGAGAAGGG - Intergenic
1076355593 10:129850667-129850689 CCTGCAATTTAAAAAGAGAGGGG - Intronic
1077900527 11:6483872-6483894 CCTGCTGTGTAAAATGAACATGG - Exonic
1078450906 11:11440170-11440192 TCTGCTATGTAAAATGTAGACGG + Intronic
1079282404 11:19099160-19099182 CCATCTCTGTGAAATGAGAAGGG - Intergenic
1079400301 11:20101613-20101635 CCTTCTCTGTAAAATGGGGATGG - Intronic
1079576589 11:22011108-22011130 CCTCATTTATAAAATGAGAATGG + Intergenic
1079718362 11:23777665-23777687 ACTTCTATGTTAAAAGAGAAAGG + Intergenic
1080139453 11:28898489-28898511 CCTCCTATATAAGAAGAGAAAGG - Intergenic
1081226025 11:40523353-40523375 CCTGATTTTAAAAATGAGAAAGG - Intronic
1081354583 11:42096501-42096523 CCTCCTCTGTAAAATGAGGTGGG + Intergenic
1081689769 11:45069954-45069976 CCTTTTCTGTAAAATGAGAGAGG - Intergenic
1082730960 11:56797024-56797046 CCTGCTCTATGAAATGAGGAGGG - Intergenic
1083319172 11:61834852-61834874 CCGCCTATGCAAAATGAGCAAGG - Intronic
1085067479 11:73510555-73510577 CTTCCTCTGTAAAATGAGCAGGG + Intronic
1085876924 11:80418754-80418776 CCTTGTCTGTAAAATGGGAAGGG + Intergenic
1086165721 11:83775449-83775471 CCTCATCTGTAAAATGAGTAAGG + Intronic
1086231196 11:84571991-84572013 CTCTCCATGTAAAATGAGAATGG - Intronic
1087382024 11:97417393-97417415 ACTGATTAGTAAAATGAGAAAGG - Intergenic
1088692548 11:112340066-112340088 GCTGCTATGTACAATGATTAAGG + Intergenic
1088739797 11:112757885-112757907 TCTTCTCTGTAAAATGGGAATGG + Intergenic
1089225044 11:116912148-116912170 CCTGCTCTGTATTAAGAGAAAGG - Intronic
1089601106 11:119615857-119615879 CCTCCTTGGTAAAATGAGTAAGG - Intergenic
1089637437 11:119824410-119824432 CCTCATCTGTAAAATGAGAATGG - Intergenic
1090428999 11:126630312-126630334 CCTTGTCTATAAAATGAGAATGG - Intronic
1091320167 11:134643721-134643743 CCTCCTCTGTAAAATGAGAATGG + Intergenic
1091997188 12:5002861-5002883 CCTGCTCCGCAAAATGAGGAAGG - Intergenic
1092860471 12:12715970-12715992 GCTGCTGTGTAATATTAGAACGG + Intronic
1095656509 12:44675735-44675757 CATCCTATGTAAAATGGGAAAGG + Intronic
1095662692 12:44756167-44756189 CCTTCTATGTACAAACAGAAGGG - Intronic
1096983204 12:55740849-55740871 GCTGCTCTGGAAAATCAGAAAGG + Intergenic
1097718286 12:62991875-62991897 ACTGATATGTTAAAAGAGAAGGG - Intergenic
1098624192 12:72642432-72642454 AATCCTATTTAAAATGAGAATGG + Intronic
1098695249 12:73544974-73544996 CATGCTATGTAAAATAAGCCAGG + Intergenic
1098879181 12:75899160-75899182 CCTGACATCTAAAATGAAAACGG + Intergenic
1101347783 12:103902402-103902424 TCTCATCTGTAAAATGAGAATGG - Intergenic
1101912261 12:108869058-108869080 CCTCCTAAGTAAAATGGGAAGGG - Intronic
1102529207 12:113533542-113533564 CTTGTTAAGTAAAATGAGAACGG + Intergenic
1103236075 12:119373686-119373708 CCTTATCTGTAAAATGAGATGGG + Intronic
1103272146 12:119682165-119682187 AATGCTATGTAAAATAAGACTGG + Intergenic
1103365340 12:120378428-120378450 AATACTATGTAAAATGAAAAGGG + Intergenic
1104528717 12:129548848-129548870 TCTTGTTTGTAAAATGAGAAAGG - Intronic
1107902070 13:45026902-45026924 CCTCCTTTGTTAAATGAGAAAGG + Intronic
1107953741 13:45488669-45488691 CCTGCTACGTAGAATGAATAAGG - Intronic
1108026358 13:46182486-46182508 CTTGCTATCTAGAATCAGAAAGG - Intronic
1108096013 13:46902037-46902059 CCTGCCAAGTAGAATGAAAAGGG + Intergenic
1110210697 13:72968769-72968791 CCTCATATGTGAAATGAGAGTGG + Intronic
1110322033 13:74171459-74171481 CCTCCTATTTAGAATGAGATGGG - Intergenic
1110816643 13:79867678-79867700 CCTACTCAGTAAAAGGAGAATGG + Intergenic
1111220744 13:85202758-85202780 CATGTTATGTAAAATGAGCTAGG + Intergenic
1111226755 13:85283727-85283749 CCAGCAAAGTAAAAGGAGAATGG + Intergenic
1112448669 13:99490172-99490194 TCTGCTACGTACAAAGAGAAGGG + Intergenic
1114345643 14:21791756-21791778 ACTGCAAAGGAAAATGAGAATGG + Intergenic
1114841175 14:26263657-26263679 CCAGCTGACTAAAATGAGAACGG + Intergenic
1115146758 14:30235759-30235781 CCTGGTGTGTTAAATTAGAAAGG + Intergenic
1115652787 14:35415129-35415151 CATCCTTTGTAAAATGGGAATGG - Intergenic
1115788331 14:36851472-36851494 CCTGCTCCTTAAAATGACAAAGG - Intronic
1115882893 14:37939926-37939948 CCTACAATGTAAAATGAGAATGG + Intronic
1116135063 14:40912515-40912537 CCTAATCTATAAAATGAGAATGG + Intergenic
1116656365 14:47658221-47658243 GCTGTTATGTAACATGAGCAGGG + Intronic
1117408055 14:55424021-55424043 CCTGGAATGAAAAATAAGAAAGG - Intronic
1118909591 14:70050128-70050150 CCTCCTTTGTAAAAGGAGCAGGG + Intronic
1120154605 14:81079396-81079418 TCTGCTATGTCAAATGAAGATGG + Intronic
1120698127 14:87666944-87666966 GCTGCTCTGTAAAATGAGAGAGG - Intergenic
1121037357 14:90717514-90717536 CCTTCTATTGAAAATGAGAGGGG - Intronic
1121248468 14:92482164-92482186 CCTCATCTGTTAAATGAGAAAGG - Intronic
1122169230 14:99858114-99858136 ACTGCTAAGTAAAAAGAGCAAGG - Intronic
1123874215 15:24607425-24607447 CCTGCTGTTTAATTTGAGAACGG - Intergenic
1126204693 15:46032531-46032553 CGTACTATGTAAAATAGGAATGG + Intergenic
1127020657 15:54744297-54744319 ACTACTATGTTAAATAAGAATGG - Intergenic
1127501110 15:59554958-59554980 GCTGCTATGTGAAATCAGAGAGG - Intergenic
1127705736 15:61545672-61545694 CCTGCTTTCTCAAATGATAAAGG - Intergenic
1128078860 15:64844364-64844386 CCTCCTTTGTAAAAGGAAAAGGG + Intronic
1128650169 15:69405954-69405976 CTTCCTATGCAAAATGAGAAGGG + Exonic
1128708144 15:69852227-69852249 CCTGCAAGGAACAATGAGAAGGG + Intergenic
1128736731 15:70057845-70057867 CCTGCTCTGTAAAAAGAGGTGGG - Intronic
1129858129 15:78839661-78839683 CCTGGTATGGAGAAAGAGAATGG + Intronic
1130759229 15:86800547-86800569 CCAGTTATGCAAAGTGAGAAAGG - Intronic
1131023622 15:89121223-89121245 CCTTCTATGTAAAATGAAATAGG + Intronic
1131464936 15:92647335-92647357 AATGCTAGGTAAACTGAGAAAGG - Intronic
1131503841 15:92998295-92998317 CCCATTTTGTAAAATGAGAACGG + Intronic
1133980724 16:10631417-10631439 GCTGCTGTGTAAGATGAGATTGG + Intronic
1135381643 16:22000935-22000957 CCTCCTCTGTAAAATGGCAACGG - Intronic
1136500524 16:30667779-30667801 CCTCATCTGTAAAATGAGTAGGG + Intronic
1136556103 16:31008698-31008720 CCTGCTCTGCAAACTGAGGAGGG + Intronic
1138601020 16:58054310-58054332 CATGCTATATTAAATGAAAAAGG - Intergenic
1140526399 16:75626526-75626548 CCTGCTCTGTGAAAGGAGACTGG + Intergenic
1141199719 16:81888100-81888122 CCTTTTCTGTAAAATGACAATGG + Intronic
1141258425 16:82426684-82426706 TTTTCTATGAAAAATGAGAAAGG + Intergenic
1141983763 16:87566208-87566230 CCTCCTCTGTAAAATGAGGGTGG + Intergenic
1143011826 17:3870208-3870230 CCTCCTCTGTCAAATGAGAGAGG - Intronic
1143077469 17:4356562-4356584 ACTGCTATTTAAAATTAGGATGG + Intronic
1143392374 17:6567297-6567319 CCTTATCTGTAAAATGGGAATGG - Intergenic
1144042073 17:11420872-11420894 CCTGCTATGGAAGCTGGGAAGGG - Intronic
1144117514 17:12112891-12112913 TCTTCTATTGAAAATGAGAAAGG - Intronic
1146091893 17:29887557-29887579 CCTCATCTGTAAAATGAGGATGG + Intronic
1146227589 17:31080162-31080184 TCTGATAGGCAAAATGAGAAAGG - Intergenic
1147159725 17:38562959-38562981 CCAGCTGTGCACAATGAGAAGGG + Intronic
1147938191 17:44025658-44025680 CCTGCTCTGTATCATCAGAATGG + Intergenic
1148162961 17:45462079-45462101 CCTGCTTTGTAAACAGGGAAGGG + Intronic
1148867083 17:50634439-50634461 CCTCATCTGTAAAATGGGAAGGG - Intergenic
1148935242 17:51159878-51159900 CCTGCTATGTAAAACATGAGCGG - Intronic
1150394191 17:64808734-64808756 CCTGCTTTGTAAACAGGGAAGGG + Intergenic
1152053851 17:78005773-78005795 TCTCATATTTAAAATGAGAAAGG + Intronic
1155579489 18:27287013-27287035 CCTCATTTATAAAATGAGAATGG - Intergenic
1155751887 18:29434259-29434281 CCTGCTGAATAAAATGTGAATGG - Intergenic
1157231221 18:45917816-45917838 AATGCTATGGAAAAAGAGAAAGG + Exonic
1158183611 18:54746005-54746027 GATGCTATGAAAACTGAGAAGGG + Intronic
1158479088 18:57804459-57804481 CCTCATTTGTAAAATGAGATTGG + Intergenic
1159095155 18:63893861-63893883 CCTCATCTGTAAAATGAGTACGG - Intronic
1160906561 19:1454170-1454192 CCTGCCCTGTAAAATCGGAATGG + Intronic
1164270294 19:23666737-23666759 CCCTGTATGTAAAAGGAGAAAGG - Intronic
1164850435 19:31478738-31478760 CCTGCTGTGGAAGATGAAAATGG + Intergenic
1165394542 19:35557263-35557285 CCTCATCTGTAAGATGAGAATGG - Intronic
1166164659 19:40978867-40978889 TCTCATCTGTAAAATGAGAATGG - Intergenic
1166276004 19:41754495-41754517 CCTGATTTGTAAAAGGAGGATGG - Intronic
1166281255 19:41795539-41795561 CCTGATTTGTAAAAGGAGGATGG - Intergenic
1166412214 19:42563141-42563163 CCTGATTTGTAAAAGGAGGATGG + Intergenic
1167251410 19:48400203-48400225 CCTGCTCTGTGGATTGAGAATGG + Intronic
1167809207 19:51813842-51813864 CCTCCTTTATAAAATGAGACAGG + Intronic
925309229 2:2870465-2870487 CCCTCTGTGTAAAATGAGGAGGG - Intergenic
926753251 2:16216370-16216392 CCTTTTCTGTAAAATGATAATGG - Intergenic
926882311 2:17559579-17559601 CATCATATGTAAAATGAGTAGGG + Intronic
928187164 2:29121899-29121921 CCTGGAATGTGAAATGAGATTGG + Intronic
929024821 2:37589961-37589983 CCTCATTTTTAAAATGAGAACGG - Intergenic
931486150 2:62694708-62694730 CCTCATCTGTAAAATGGGAATGG - Intronic
931523498 2:63126419-63126441 CTTCATCTGTAAAATGAGAATGG - Intronic
932516687 2:72358332-72358354 CCTCATTTATAAAATGAGAAAGG - Intronic
933287177 2:80397348-80397370 CCTCATCTGTAAAATGAGCATGG - Intronic
933353754 2:81190047-81190069 CCTGTTCTGTGAAATGACAATGG + Intergenic
935759033 2:106301507-106301529 CCTGCTAATCAATATGAGAATGG - Intergenic
936032529 2:109083814-109083836 GCTGCCAAGGAAAATGAGAAAGG - Intergenic
936745139 2:115566859-115566881 CCTGTAATATTAAATGAGAATGG - Intronic
936824434 2:116563953-116563975 GCAGCTAAGGAAAATGAGAAGGG - Intergenic
937581364 2:123492877-123492899 CATGCTATGTTACATGAGAGTGG + Intergenic
937797351 2:126039530-126039552 ACTGCTTACTAAAATGAGAAAGG - Intergenic
938615362 2:132992120-132992142 CCTTATCTGTAAAATGGGAAAGG - Intronic
939055095 2:137355794-137355816 CCTTCTCTGTAAAGTGGGAATGG + Intronic
941126366 2:161588814-161588836 CTTGCTTTGTAAAATGAGTTTGG + Intronic
941172230 2:162153258-162153280 CCTTATTTGTAAAATGAGAGGGG + Intergenic
941484684 2:166065475-166065497 CAGGCTATGACAAATGAGAAGGG - Intronic
942503306 2:176615026-176615048 TCAGCTGTGAAAAATGAGAATGG - Intergenic
942956353 2:181778732-181778754 TGTGCTATGTAAAAAGACAAAGG + Intergenic
943064854 2:183074809-183074831 CCTTCTTTATAAAAAGAGAATGG + Intergenic
944736496 2:202571661-202571683 CCTGTACTGTAAAATGAGCATGG + Intergenic
944977128 2:205066591-205066613 CTTCATCTGTAAAATGAGAAAGG + Intronic
945384722 2:209183429-209183451 CCTGCTATTTAAAATAACATGGG - Intergenic
945532002 2:210967272-210967294 CCTGGTAAGGAAAAAGAGAAGGG + Intergenic
946770629 2:223085109-223085131 GCTGCTATTTAGAATGAGAAAGG + Intronic
947438873 2:230099575-230099597 CCAGCTTTGTAAAAGGACAAAGG - Intergenic
1171565932 20:26187483-26187505 GCTTCTATGTAAATTGAAAAAGG + Intergenic
1172382211 20:34504400-34504422 CCTGGTAAGTACAATCAGAATGG + Exonic
1173090729 20:39968693-39968715 CCTTCTTTGTGAAATGGGAAGGG - Intergenic
1174911515 20:54612915-54612937 TCTCCTTTGTAAAATGGGAAGGG + Intronic
1178089091 21:29142796-29142818 CCTCCTCTGCAAAATGGGAAGGG - Intronic
1179096094 21:38315608-38315630 CATACTTTGTAAAAAGAGAATGG + Intergenic
1181736435 22:24885350-24885372 CCGTTTATGTAAAAAGAGAAAGG - Intronic
1182247554 22:28971615-28971637 CCTCATCTGTAAAATAAGAATGG - Intronic
1182942703 22:34293038-34293060 ACTGCTGTGTATAATGAGGACGG + Intergenic
1183368809 22:37420863-37420885 CCTCCTCTGGAAAATGAGGATGG + Intronic
1183629077 22:39022310-39022332 CCTCCTCTGTAAGATGGGAATGG + Intronic
1183632562 22:39042100-39042122 CCTCCTCTGTAAGATGGGAATGG + Intronic
1183641955 22:39098122-39098144 CCTCCTCTGTAAGATGAGAATGG + Intronic
1184307661 22:43617534-43617556 CCAAGTATGTAAAATGAGGAAGG - Intronic
1185097622 22:48820240-48820262 CCTGCTATGGAAAATGCGCCAGG - Intronic
951441088 3:22725021-22725043 CTTGCTAAGTGAAATGAAAAAGG + Intergenic
951507188 3:23460418-23460440 CCTCATATGTAAAATGGAAATGG + Intronic
951793122 3:26508484-26508506 CCTCCTGTGTAAAATGAGGTCGG - Intergenic
951817908 3:26775549-26775571 CCTGCTAAGGAAAGAGAGAAGGG - Intergenic
951977246 3:28526073-28526095 CCTCATATGTAAAATGGGGATGG + Intronic
954489672 3:50891402-50891424 CATGTTTTGTAAAAGGAGAAGGG - Intronic
955116341 3:56008330-56008352 CCTGATGTGAAGAATGAGAATGG - Intronic
955341440 3:58128514-58128536 ACTGCTATGAAGAATGAGAATGG + Intronic
955432923 3:58868548-58868570 TCTCCTCTGTAAAATGGGAATGG - Intronic
956206612 3:66761554-66761576 CCTCATATGTAAAATGAGAAGGG + Intergenic
957440104 3:80234604-80234626 AATGCTATGTTAAAGGAGAAGGG - Intergenic
957467749 3:80616731-80616753 ACTGTTATTTAAAAAGAGAAAGG - Intergenic
959421173 3:106130962-106130984 CCTGCTATATCTGATGAGAATGG - Intergenic
960901481 3:122558464-122558486 CCACCTGTGAAAAATGAGAATGG + Exonic
962008511 3:131371316-131371338 CTTGCTAATTACAATGAGAAAGG - Intergenic
962033350 3:131624507-131624529 TCTGCTATGTAAAAAAAAAATGG - Intronic
963341074 3:144034498-144034520 ACTGCTATTAAAAATGAGAGGGG + Intronic
963357408 3:144226807-144226829 CCTTCTATAAAAAATAAGAAAGG - Intergenic
963747227 3:149136615-149136637 CCTGATGTATAAAATGAGGAGGG + Intronic
964277970 3:155028040-155028062 CCTTCTTTTTAAAATGGGAATGG + Intronic
965730404 3:171765663-171765685 CTTGATCTGTAAAATGAGGAAGG + Intronic
967006462 3:185387776-185387798 CATGCTATGTTGAATGAGACTGG - Intronic
967991550 3:195135310-195135332 CCTCCTGTGTAAAATGAGAAAGG - Intronic
970560355 4:17276170-17276192 CCTCGTCTGTAAAATGGGAAGGG + Intergenic
970814075 4:20132765-20132787 CTAACTATGTAAAATGTGAAAGG + Intergenic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971750517 4:30641207-30641229 CCTGGTATGAAAAATGCGAGTGG - Intergenic
972029407 4:34434454-34434476 GCTTCTATGTAAATTGAAAAAGG + Intergenic
972324883 4:38006027-38006049 CCTGCTATGTAAAATGAGAAAGG - Intronic
972399484 4:38687488-38687510 CCTGATATTTAAAGAGAGAAAGG + Intronic
973653544 4:53021976-53021998 CCTGGTGTGAAAAATGAGGAGGG + Intronic
974466030 4:62257816-62257838 CGTGCTATATAAACTCAGAAAGG - Intergenic
975341588 4:73248143-73248165 CCTTCAAGGTAAAATTAGAATGG + Intronic
975833787 4:78399113-78399135 TATGCTATGTCAATTGAGAAAGG + Intronic
976390477 4:84499658-84499680 TGTGCTAAATAAAATGAGAAAGG + Intergenic
977879731 4:102190184-102190206 CCTGCTAAGTACAATAGGAAGGG - Intergenic
978090889 4:104713245-104713267 CCTGCTTTTTAAAATCTGAAGGG - Intergenic
978311800 4:107392541-107392563 CCTGCAGTAGAAAATGAGAATGG - Intergenic
979095316 4:116541632-116541654 CATGCAATATAAAATGAAAATGG + Intergenic
979281045 4:118868506-118868528 CCTTTTATTTAAAAAGAGAAAGG + Intronic
979353218 4:119670423-119670445 CCTTGTCTGTAAAATGAGAATGG + Intergenic
979465250 4:121029940-121029962 TCTCATTTGTAAAATGAGAAGGG - Intergenic
979838394 4:125404170-125404192 CCTGTTCTGGAAAATGAAAATGG - Intronic
980548600 4:134303199-134303221 CCTGCTATGTAGAGAAAGAATGG - Intergenic
980750258 4:137077938-137077960 TCTGCTGTTTAAGATGAGAAAGG - Intergenic
981296074 4:143133222-143133244 TCACCTATGTGAAATGAGAAAGG - Intergenic
982394994 4:154906896-154906918 CCTGCAATGCAAAAGGAGACCGG - Intergenic
986172183 5:5324105-5324127 TCTGCTCTGTAAAATGGGATTGG - Intergenic
989110451 5:37902109-37902131 CCTCCTCTCTAAAATGAGGAAGG + Intergenic
989440688 5:41469368-41469390 CATGCTATCTAAAATGAGTTTGG + Intronic
991050265 5:62265471-62265493 ACTTTTATGTAAAATGAAAAGGG + Intergenic
993582159 5:89676662-89676684 CCAGCTATTTAAAATGATCAGGG + Intergenic
995307263 5:110667689-110667711 CCTCACCTGTAAAATGAGAATGG + Intronic
995435571 5:112131286-112131308 CCTCCTTTGTAAAATGAGTATGG + Intergenic
995598820 5:113774819-113774841 TCTGCTATATACAAGGAGAAGGG + Intergenic
995929958 5:117428844-117428866 CATGCTAAGTAAAAGAAGAAAGG - Intergenic
996864161 5:128100320-128100342 CCTTATATGAAAAATGGGAAAGG + Intronic
997617004 5:135253730-135253752 ACTGCTATGTAACCTGAGAGCGG - Intronic
999456566 5:151721352-151721374 CCTCCTCTGAAAAATGAAAAGGG + Intergenic
999654527 5:153799120-153799142 GCTGCTATGGAATAGGAGAATGG + Intronic
999789529 5:154926135-154926157 CCTGATATGTCAAATGGGATAGG + Intronic
999933664 5:156461623-156461645 CCTGATAAGTAAAAAGGGAAAGG - Intronic
1000453336 5:161418302-161418324 CCAGGAATGTAATATGAGAAAGG - Intronic
1002994064 6:2266018-2266040 CCTGATAACTAAAATGAGAAGGG - Intergenic
1003932143 6:10934763-10934785 TCTGTTAGGTAAAAAGAGAAAGG - Intronic
1004326262 6:14676471-14676493 CCTCACCTGTAAAATGAGAAGGG + Intergenic
1004545954 6:16598621-16598643 CCTGCTGTGTAGAAAGAGAGGGG - Intronic
1004743385 6:18485650-18485672 CCTGCTCTGTAAAATGCATATGG - Intergenic
1004792901 6:19048255-19048277 CCTAATATGCAAAAAGAGAAAGG - Intergenic
1005599928 6:27416221-27416243 CCTTGTCTATAAAATGAGAATGG + Intergenic
1006808926 6:36807345-36807367 CCTCCTCTGTAAAATGGGAATGG + Intronic
1009241514 6:61191897-61191919 CCTGTGATGGCAAATGAGAATGG - Intergenic
1010303458 6:74288367-74288389 CATGCTATATTGAATGAGAAGGG - Intergenic
1010715649 6:79226347-79226369 TCTCATATGTAAAATGAGAACGG + Intronic
1011682085 6:89793032-89793054 ACTGCTATGGAAAAAGAGACTGG + Intronic
1011971642 6:93231876-93231898 TCTCGTTTGTAAAATGAGAATGG - Intergenic
1013692074 6:112657719-112657741 TCTATTTTGTAAAATGAGAATGG - Intergenic
1014003102 6:116386858-116386880 TCTACTATGTTAAATGGGAAAGG - Intronic
1015301257 6:131655355-131655377 CATTCTTTGTAAAATGAGGATGG - Intronic
1017221105 6:151967075-151967097 ACTGCAATGAAAAAGGAGAATGG - Intronic
1017370675 6:153703248-153703270 CCTTCTCTGTAATATGAAAATGG - Intergenic
1017479337 6:154834739-154834761 CCTGCAAGGTAAACTGAGTAGGG + Intronic
1018336755 6:162799777-162799799 CATGATATGTAAGATGTGAATGG + Intronic
1019070172 6:169339054-169339076 CATGCCTTGTAAACTGAGAAAGG + Intergenic
1021659029 7:22899790-22899812 CCTTCTTTTTAAAATGGGAAAGG + Intergenic
1022010192 7:26302148-26302170 CCTGAGATGGAAAATGGGAAGGG - Intronic
1022128600 7:27381235-27381257 TCTTCTATGAAAATTGAGAATGG + Intergenic
1022266182 7:28757193-28757215 CCTCCTCTGTAAAATAAGAATGG - Intronic
1024340159 7:48249688-48249710 AATGCTAAGTAAAGTGAGAAGGG - Intronic
1026401594 7:70019636-70019658 GCTGTTAAGTAAAATGACAAAGG - Intronic
1026953330 7:74361695-74361717 CCTGATGTGTAAAATGAGAATGG - Intronic
1027414836 7:77963879-77963901 CCTCATCTGTAAAATGAGATAGG + Intergenic
1027842653 7:83333084-83333106 ACTGCTATTTACCATGAGAATGG + Intergenic
1028359594 7:89951893-89951915 ACTTCTATGTAAAATGAGGTAGG - Intergenic
1028858660 7:95621935-95621957 CCTGCTATATAAAATCTGAAAGG + Intergenic
1031949066 7:127873168-127873190 CCTGCTCAGAAAAAGGAGAAAGG - Intronic
1034544802 7:151782717-151782739 CCTCATCTGTAAAATGAGGATGG + Intronic
1037744412 8:21631398-21631420 CCTCATTTGTAAAATGGGAATGG + Intergenic
1038652551 8:29418933-29418955 CCTGCTATGTCCACTTAGAATGG - Intergenic
1038652724 8:29420388-29420410 CCAGCTATGTACAAGCAGAAGGG + Intergenic
1039292901 8:36116996-36117018 AGTGCTATGTTAAATAAGAATGG + Intergenic
1039766265 8:40631698-40631720 CCTGTTTTGCAAAATGAGAGTGG - Intronic
1040968944 8:53113246-53113268 CCTGCTATGTAAGATGATACAGG + Intergenic
1041108304 8:54462409-54462431 CCTGTACTTTAAAATGAGAAAGG - Intergenic
1042906642 8:73778559-73778581 ACTGCCATGTAAATTTAGAAAGG - Intronic
1043528484 8:81122947-81122969 CTTTATCTGTAAAATGAGAATGG - Intergenic
1044019573 8:87087833-87087855 CCTCATCTGTAAAATGAGAAAGG - Intronic
1044112851 8:88297774-88297796 CCTCATCTGTAAAATGAGTATGG + Intronic
1044843722 8:96360135-96360157 CCTGATCTGTAAAATGGGGAGGG - Intergenic
1045886564 8:107105610-107105632 CTTCCTATGTAAAATAAAAATGG + Intergenic
1046017439 8:108621789-108621811 CCATCTGTGTAAAATGAGGATGG + Intronic
1046793141 8:118343079-118343101 CCTCATCTGTAAGATGAGAAGGG + Intronic
1047103030 8:121701339-121701361 CCTTTTATGTGAAATGAAAATGG - Intergenic
1047328850 8:123866203-123866225 CGTGCTAAGTAAAATAAGCAAGG - Intronic
1047434350 8:124823585-124823607 CATGCTGTGAAATATGAGAAAGG + Intergenic
1048580391 8:135725655-135725677 CCTTCTCTGTAAAGTGGGAACGG - Intergenic
1048812196 8:138298827-138298849 TCTGAAATGCAAAATGAGAAAGG + Intronic
1048812334 8:138300196-138300218 TCTGAAATGTGAAATGAGAAAGG - Intronic
1050162181 9:2730484-2730506 CCTGCCTTGTAAAATGAGTCTGG + Intronic
1050464451 9:5906863-5906885 CCTGAAATGTAAATTGATAAAGG - Exonic
1053020814 9:34692659-34692681 CCTTATTTGTAAAATGGGAATGG + Intergenic
1055585658 9:77756812-77756834 CCTTATCTGTAAAATGAGAAGGG + Intronic
1055767937 9:79685040-79685062 GCAGCTATGAGAAATGAGAAGGG - Intronic
1055919261 9:81441236-81441258 ACTGCTAGGAAAAATAAGAAAGG - Intergenic
1056409166 9:86308297-86308319 CCTGGTATGGACAATGAGACTGG + Intronic
1058059434 9:100479142-100479164 CCTGTTGTGTAAAATGTGGATGG + Intronic
1059467413 9:114477759-114477781 CCTGCTCTGTAAAATGGCCAGGG + Intronic
1059568461 9:115408287-115408309 TATTCTATGTAAAATGAGAGTGG - Intergenic
1059620411 9:115998478-115998500 CCTTCTGTGTAAAATGAGAATGG + Intergenic
1059788643 9:117615628-117615650 CCTAATCTGTAAAATGGGAATGG - Intergenic
1060167066 9:121426237-121426259 CCTGGTCTGTAAAATGAGTTTGG - Intergenic
1061521251 9:131119598-131119620 GCTCCTTTGTAAAATGAGACAGG - Intronic
1187031630 X:15493713-15493735 CCTCCTCTATAAAATGAGGATGG + Intronic
1187121900 X:16417317-16417339 CCTCACCTGTAAAATGAGAATGG - Intergenic
1189107128 X:38248643-38248665 CCTGCTGAGTAAACTGAGCATGG - Intronic
1190115647 X:47624789-47624811 CCTCATCTGCAAAATGAGAATGG + Intronic
1190227606 X:48558285-48558307 CATCGTCTGTAAAATGAGAATGG + Intronic
1190886283 X:54533077-54533099 CCTCATCTGTAAATTGAGAATGG - Intronic
1191795967 X:65021817-65021839 GCTGCAATATAAAATGATAAAGG + Intronic
1192425574 X:71072941-71072963 CCTGCCATGAAAAATAAAAAGGG - Intronic
1193223021 X:78949411-78949433 CCTCTTTTGTAAAATTAGAATGG - Intronic
1193469110 X:81877530-81877552 TATGCTATGTAAAATGAGCCAGG + Intergenic
1193845283 X:86462662-86462684 CCTGCTCTGAAGAATGAGCAGGG - Intronic
1195710663 X:107771261-107771283 CCTTCTTTATAAAATGAAAATGG + Intronic
1196141651 X:112269294-112269316 GCTGATTTGTAAAATGGGAATGG - Intergenic
1196326525 X:114411804-114411826 CCTGCTATTAACAATGTGAAGGG - Intergenic
1196854914 X:119973731-119973753 CCTGCTAATTAAAAATAGAAAGG - Intergenic
1196857318 X:119996461-119996483 CCTGCTAATTAAAAATAGAAAGG - Intergenic
1198399681 X:136256802-136256824 CCTCATCTGTAAAATGAGGATGG - Intergenic
1198457115 X:136827791-136827813 GCTGCTATATAATATGAGCAGGG + Intergenic
1199079915 X:143565537-143565559 CATGCTATGAAAAATGTCAATGG - Intergenic
1201681423 Y:16647906-16647928 ACTGCTAAGTAAAATAACAAAGG - Intergenic
1201930186 Y:19336230-19336252 CTGGCTTTGTAAAATGAGATAGG + Intergenic