ID: 972330382

View in Genome Browser
Species Human (GRCh38)
Location 4:38058602-38058624
Sequence CCAGAATATAAATGTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 362}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972330382_972330384 -4 Left 972330382 4:38058602-38058624 CCTGTTTTACATTTATATTCTGG 0: 1
1: 1
2: 3
3: 30
4: 362
Right 972330384 4:38058621-38058643 CTGGCAGTGCAAACTTCAATTGG 0: 1
1: 0
2: 0
3: 7
4: 77
972330382_972330385 1 Left 972330382 4:38058602-38058624 CCTGTTTTACATTTATATTCTGG 0: 1
1: 1
2: 3
3: 30
4: 362
Right 972330385 4:38058626-38058648 AGTGCAAACTTCAATTGGACAGG 0: 1
1: 0
2: 0
3: 7
4: 68
972330382_972330386 25 Left 972330382 4:38058602-38058624 CCTGTTTTACATTTATATTCTGG 0: 1
1: 1
2: 3
3: 30
4: 362
Right 972330386 4:38058650-38058672 AATCTTACAACCTCTCTTCCAGG 0: 1
1: 0
2: 2
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972330382 Original CRISPR CCAGAATATAAATGTAAAAC AGG (reversed) Intronic
901586869 1:10303102-10303124 CCAAAATTAAAATGTAAAAAAGG - Intronic
902842476 1:19084017-19084039 CCAGTTCATAAATGGAAAACTGG - Intronic
902952470 1:19897104-19897126 CAAAATTATAAATATAAAACTGG - Intronic
906859580 1:49344758-49344780 GCAGTATATTAATGTAAATCTGG + Intronic
906950638 1:50332633-50332655 CCAGAAAATACAGGTAAAAGTGG + Intergenic
907736118 1:57114092-57114114 CCAAAATATGAATGTAGAACTGG + Intronic
908552590 1:65224261-65224283 CCAGAATAGAATTGGAAAGCTGG + Intronic
909334455 1:74455413-74455435 ACAGACTATAAATGTAAAACTGG + Intronic
910486077 1:87715764-87715786 CCAGTATACAAATGGAAAATGGG + Intergenic
910891045 1:92020686-92020708 GCAGGATATATTTGTAAAACTGG - Intergenic
911290183 1:96047720-96047742 ACAGAATATAGATATAAAAAAGG - Intergenic
911955901 1:104234627-104234649 CCAAAATATAAATATAAATATGG + Intergenic
912064226 1:105716282-105716304 CCAAAATAAAAATATAAAAAAGG + Intergenic
912084179 1:105978090-105978112 ACAGAATATAATTATAGAACTGG + Intergenic
912647524 1:111408350-111408372 CCAGTTAATAAATGTAAAAGTGG - Intergenic
912726170 1:112060551-112060573 ACAGAATATGAATCTAAAATAGG - Intergenic
915660066 1:157397617-157397639 CCAGTATATAAAACTATAACAGG + Intergenic
915978147 1:160403879-160403901 CCAGAATTTAAAAGCAAACCAGG - Intronic
916100382 1:161389173-161389195 ACAGAAAGTAAATGTAAAGCAGG + Intergenic
916309593 1:163381455-163381477 CCAGAATATGAATATATTACAGG + Intergenic
916712165 1:167421270-167421292 CCACAATACAAATGTAAACTTGG + Exonic
917035917 1:170746710-170746732 CCTGAACAGAAATGTAAAAATGG - Intergenic
918253306 1:182724152-182724174 CCAGAATATAAATAGAAAGCAGG + Intergenic
918406932 1:184220630-184220652 CCAGTTTATAAATTTAAAATAGG - Intergenic
918562224 1:185882461-185882483 ACAGAAAAGAAATGTAAAACAGG - Intronic
919183040 1:194109959-194109981 CAAAAATAAAAAAGTAAAACAGG - Intergenic
919375474 1:196788296-196788318 ATACAATATAAATGTAAACCAGG + Exonic
919384646 1:196905188-196905210 ACACAATATAATTGTAAACCAGG + Exonic
919385151 1:196912820-196912842 ATACAATATAAATGTAAACCAGG + Exonic
921751464 1:218799214-218799236 CAAAAATAAAAATGTATAACTGG - Intergenic
922149591 1:222986869-222986891 CCACAATATAACTGTAAATGTGG - Intronic
923845410 1:237725488-237725510 ACAAAATATACATCTAAAACAGG - Intronic
923884223 1:238137419-238137441 CCATTATATAGATGTGAAACAGG + Intergenic
923904848 1:238372413-238372435 TCACAATATAAAAGTCAAACTGG - Intergenic
924225520 1:241918681-241918703 GCAGAATATAACTGTCAAACTGG - Intergenic
924264119 1:242263782-242263804 TCACAATAGAAATGTAAACCAGG + Intronic
924435126 1:244032779-244032801 TTAGAAAATAAATTTAAAACAGG + Intergenic
1063038210 10:2309999-2310021 GCAGAAAATAAATATAAAATAGG + Intergenic
1064569191 10:16674742-16674764 ACTGAATATAAGTGTAAAGCCGG + Intronic
1064894020 10:20213345-20213367 CCAGAAAATATACATAAAACAGG - Intronic
1066720677 10:38334681-38334703 TCACAATAGAAATGTAAACCAGG - Intergenic
1066782263 10:38965207-38965229 TCAAAATATAAATGAAAGACTGG - Intergenic
1066951144 10:42117883-42117905 TCAAAATATAAATGAAAGACTGG + Intergenic
1067515088 10:46932775-46932797 CCTGATTATAAATGTAATATAGG + Intronic
1067647168 10:48119035-48119057 CCTGATTATAAATGTAATATAGG - Intergenic
1069223577 10:65913248-65913270 CCATAATCAAAATGGAAAACAGG + Exonic
1069991394 10:72318784-72318806 CCAGAATATTAATGTTCAAGAGG + Intergenic
1072843291 10:98798842-98798864 CCAGAAAACAAATCTAAAAATGG + Intronic
1074816303 10:117143342-117143364 CCAGAATAGAACTGTAGCACTGG + Intergenic
1074932621 10:118144384-118144406 CCAGAAAATGAATATAAAAACGG + Intergenic
1075366792 10:121897526-121897548 CCAGAATCTACATCTTAAACTGG - Intronic
1075542258 10:123324835-123324857 CCAGGATATAGATGTAAGGCTGG + Intergenic
1076065187 10:127442870-127442892 CCTGAATATAGATGCAAAAGTGG - Intronic
1077277324 11:1719306-1719328 CCTCAATTTCAATGTAAAACAGG - Intergenic
1077705227 11:4478707-4478729 CCAAAATATAATGGTAGAACAGG - Intergenic
1078559674 11:12359978-12360000 CCAGAAATTAGATGTATAACTGG + Intergenic
1079802892 11:24894046-24894068 TGAGAATACAAATATAAAACAGG - Intronic
1080015163 11:27497857-27497879 TCAAATTATAAATGCAAAACAGG - Exonic
1080062196 11:27968947-27968969 ACAGGATACAAATGCAAAACAGG - Intergenic
1080638517 11:34144132-34144154 CCATATTAGAAATGAAAAACTGG + Intronic
1080815548 11:35752936-35752958 CTAGAACATAAATGTAATAAGGG + Intronic
1081016036 11:37882126-37882148 CCCAAAAATAAGTGTAAAACAGG - Intergenic
1083072165 11:59995968-59995990 CCAGTATATTAATGGAAAAAAGG + Intergenic
1083373815 11:62203548-62203570 CCAGGATAACAATGTAAACCAGG - Intergenic
1083514155 11:63241200-63241222 CCATAATATAGTTGCAAAACAGG + Intronic
1084142228 11:67240225-67240247 CCAGAATATTCAAGTAAATCCGG + Intronic
1084997923 11:73000927-73000949 GCAGATTATAAATGTAGCACTGG + Intronic
1085562573 11:77485951-77485973 CCAGAATAATACTGCAAAACTGG - Intergenic
1085670750 11:78462661-78462683 CCATTTTATAAATGAAAAACTGG - Intronic
1085788579 11:79476179-79476201 GCAGAATATAAAGGGAAAGCAGG - Intergenic
1087325263 11:96714145-96714167 CCAGAATATAAAATTAAAAATGG + Intergenic
1087334398 11:96825125-96825147 CAAGAATATAAATATAAAGCTGG + Intergenic
1087445487 11:98246195-98246217 TCACAATATAAAAGAAAAACAGG - Intergenic
1088422349 11:109662546-109662568 CAAGAACATAAATGCAAGACTGG + Intergenic
1089374925 11:117987415-117987437 CCAAAAAATAAATAAAAAACAGG + Intronic
1091476500 12:779029-779051 CTAAAATGTAAAAGTAAAACAGG + Intronic
1091682683 12:2538263-2538285 TCAGAAAGTAAATATAAAACAGG - Intronic
1092398768 12:8153597-8153619 CCAGAATATAAATGACTAAATGG - Intronic
1092719263 12:11424792-11424814 CCAGCAAATAAATAAAAAACAGG + Intronic
1093296847 12:17401798-17401820 CCAGAATATCAAAGTAAAATGGG + Intergenic
1093442712 12:19217529-19217551 TCAGAATAAAAATGTTCAACAGG + Intronic
1093734235 12:22601838-22601860 CCAGAAAATAAATTAAAAAATGG + Intergenic
1093774562 12:23057556-23057578 CCAGAATAGATATGCAAAAAGGG - Intergenic
1093815722 12:23544001-23544023 CCCCAAAATATATGTAAAACTGG + Intronic
1094349412 12:29507075-29507097 TGAGAACATTAATGTAAAACTGG - Intronic
1094631702 12:32182101-32182123 AAAGAATATCAATGTAAAACAGG + Intronic
1095745582 12:45654708-45654730 GCAGATTAAAAAAGTAAAACAGG + Intergenic
1095769973 12:45942836-45942858 CGCAAATATAAATATAAAACAGG - Intronic
1096006474 12:48177238-48177260 CCAGAATAAGAATATAAATCAGG + Intronic
1097830613 12:64221140-64221162 AGAGAATAGAAATGTAAAATTGG - Intronic
1097924109 12:65108823-65108845 TCAGAATATAAATGTAAGGTAGG - Intronic
1097966955 12:65591419-65591441 AAATAAAATAAATGTAAAACAGG + Intergenic
1098669367 12:73206375-73206397 CCAGAATATAACTGTGATGCTGG - Intergenic
1099089230 12:78283592-78283614 CTAAAAGATAAATGTAAAATGGG - Intergenic
1099612831 12:84896730-84896752 ACAGAATATAAATATACACCAGG + Intronic
1100121509 12:91374086-91374108 TCAGAAAATAAACGTAAAACAGG - Intergenic
1100165904 12:91917214-91917236 CCAAAATCTAACAGTAAAACAGG - Intergenic
1103074980 12:117974721-117974743 CTGGAGTATAAATGGAAAACTGG - Intergenic
1103897536 12:124283262-124283284 ACAGAAAATAAATCTGAAACGGG + Intronic
1104696820 12:130870684-130870706 GCAGAATCTAACAGTAAAACGGG - Intergenic
1106054451 13:26225484-26225506 CCACAATCTAATTGTAAAACAGG + Intergenic
1106370019 13:29123114-29123136 AGAGAATATTAATGCAAAACAGG - Intronic
1107561587 13:41561812-41561834 CAAAAATACAAATGGAAAACTGG + Intergenic
1108169720 13:47728583-47728605 CCACAATAAAAATGGGAAACAGG - Intergenic
1109035049 13:57246978-57247000 TCAAAATATAATTGTAAAAATGG - Intergenic
1109099694 13:58165974-58165996 TCTGAATCTAAATGTCAAACTGG - Intergenic
1109428228 13:62197014-62197036 ACAGTATATAAATGCAAAACAGG - Intergenic
1110142268 13:72145049-72145071 CCAGAAAAAAAAAGAAAAACTGG + Intergenic
1110153289 13:72281915-72281937 CCAAAGCATAAATGTAAAAGTGG + Intergenic
1111379212 13:87424471-87424493 CCAAAAAATGTATGTAAAACAGG - Intergenic
1111596485 13:90418590-90418612 CTATAATATAAATATAAATCAGG + Intergenic
1112311461 13:98320899-98320921 CGGAAATCTAAATGTAAAACTGG + Intronic
1112317175 13:98373301-98373323 TCAGAATGTAATTTTAAAACAGG + Intronic
1113013384 13:105796712-105796734 CTAGAAAATAAATTTAAAATGGG - Intergenic
1113030715 13:105990824-105990846 CCAGAATCTAAAAGATAAACAGG - Intergenic
1113233651 13:108243298-108243320 CTAGAATATGACTGTAAAACTGG - Intergenic
1113308863 13:109109668-109109690 CCAAAATATTAATGTAGATCAGG + Intronic
1115010937 14:28543883-28543905 GCACAAAATAAATGTAAAAGTGG - Intergenic
1116370150 14:44120521-44120543 CAAGAAAATTAATGTAGAACTGG - Intergenic
1116414116 14:44659979-44660001 TCAGAATATAAATGAAAGACAGG + Intergenic
1116516263 14:45810245-45810267 TCACAGGATAAATGTAAAACTGG + Intergenic
1117200107 14:53381471-53381493 CCAAAATATAAATGTAAAACAGG + Intergenic
1117847511 14:59927020-59927042 CCAGAATACAAATGTAAAGCTGG - Intronic
1119827971 14:77673835-77673857 CCAGAATAGCGAAGTAAAACGGG - Exonic
1125844600 15:42840032-42840054 TTAGAATACAAATGGAAAACTGG + Intronic
1126286123 15:47013099-47013121 CAACAATAAAAATGTAATACAGG + Intergenic
1126311865 15:47326540-47326562 CAAAAATGTAAATGTAAACCAGG - Intronic
1127620591 15:60730006-60730028 ACAGGAGATAAATGTAAAAAGGG - Intronic
1130725524 15:86435230-86435252 CAAGAACATAAATGGAAAAAGGG - Intronic
1131246006 15:90793532-90793554 CAAGAAAATCAATGTGAAACAGG - Intronic
1131408824 15:92188873-92188895 CTGGAACATAAATGTAAATCTGG + Intergenic
1133102409 16:3487385-3487407 CCAGAAAAAGAATGTGAAACTGG + Intergenic
1135051181 16:19194310-19194332 CCAGTATCTACATGTAAAAGGGG - Intronic
1135654290 16:24234158-24234180 CCAAAAAATAACTGTAAAAACGG - Intergenic
1136939303 16:34505975-34505997 TCAAAATATAAATGAAAGACTGG + Intergenic
1136960516 16:34842586-34842608 TCAAAATATAAATGAAAGACTGG - Intergenic
1137219525 16:46433483-46433505 TCAAAATATAAATGAAAGACTGG + Intergenic
1138690879 16:58767480-58767502 CCAGATTCTAAATGGAAAAGAGG + Intergenic
1138827456 16:60337628-60337650 GGGCAATATAAATGTAAAACTGG + Intergenic
1139000254 16:62501194-62501216 TCAGAACATAAATGAGAAACAGG - Intergenic
1139064409 16:63294258-63294280 CCAAAATAAAAATGTATAATTGG + Intergenic
1140073717 16:71676706-71676728 CCAGAATAAAAATAAAAAATAGG + Intronic
1144501394 17:15788872-15788894 CAAGAATATAAAAGATAAACAGG - Intergenic
1145163569 17:20591544-20591566 CAAGAATATAAAAGATAAACAGG - Intergenic
1147136469 17:38436754-38436776 CAAAAATATTAATGTAAAAACGG + Intronic
1148009445 17:44464196-44464218 CCAAAAAAAAAATTTAAAACAGG + Intronic
1151016851 17:70564493-70564515 CCAGAATATAAATGGAAGCAAGG + Intergenic
1153396717 18:4630367-4630389 CCATAATATAAAAGTAAAATAGG - Intergenic
1154256341 18:12783842-12783864 CCACAAAATAAATGGAATACAGG + Intergenic
1154516317 18:15169837-15169859 TCAAAATATAAATGAAAGACTGG + Intergenic
1156127947 18:33930802-33930824 AAAGAATATAAATGTATATCAGG + Intronic
1156603719 18:38640726-38640748 CAAAAATGTAAATGTAAAAGAGG - Intergenic
1156732273 18:40208303-40208325 ACAGAAAATAGATATAAAACAGG + Intergenic
1157100538 18:44725109-44725131 CCATCAGATAAATGTAAAAGGGG + Intronic
1157581996 18:48779042-48779064 CCAGTTTATAAATGGAAAACTGG - Intronic
1158314411 18:56194727-56194749 CTACAAAATAAATGCAAAACAGG - Intergenic
1158523692 18:58193845-58193867 CCAGGAAATAAATTTAAAAAGGG - Intronic
1158843885 18:61420035-61420057 CCAAAATATAAATGTGATATGGG - Intronic
1159176621 18:64844357-64844379 ACACAATACAAATGTAATACAGG + Intergenic
1159494652 18:69186461-69186483 CCAGAAAATAAATTTAGAAATGG - Intergenic
1159561418 18:69999285-69999307 ACAGAATATAACTTTAAACCAGG + Intergenic
1160134381 18:76260148-76260170 CCAGAATTCAAATGAAAAACAGG - Intergenic
1162840280 19:13351288-13351310 ACACAAGATAAATGAAAAACAGG - Intronic
1163871175 19:19822523-19822545 ACAAAATATATATGTAAATCTGG - Intergenic
1163896295 19:20063423-20063445 ACAAAATATATATGTAAATCTGG - Intergenic
1163906483 19:20153064-20153086 ACAAAATATACATGTAAAACCGG - Intergenic
1163948926 19:20566216-20566238 ACAAAATATATATGTAAATCTGG - Intronic
1163969167 19:20775843-20775865 ACAAAATATATATGTAAATCTGG + Intronic
1164138852 19:22439539-22439561 CCAGAAGAAAAATATAAACCTGG - Intronic
1164182150 19:22828811-22828833 CCAGAAGAAAAATATAAACCTGG - Intergenic
1164791247 19:30984155-30984177 CCAGTATATAAATTTAAATTTGG + Intergenic
927696565 2:25243696-25243718 CAAAAATAAAAAAGTAAAACAGG - Intronic
928543938 2:32311434-32311456 CCAATATAAAAATGTAAAGCAGG - Exonic
928562194 2:32501069-32501091 ACAGCATATAAATTTAACACTGG - Intronic
928637512 2:33262858-33262880 TCTGAATAAAAATGTAAGACGGG + Intronic
928702216 2:33910579-33910601 CCAGAAAATAAACCTAGAACAGG - Intergenic
928814080 2:35268658-35268680 CCAGAAAACAAATTGAAAACAGG - Intergenic
929369091 2:41199873-41199895 CCTGAATAAACATCTAAAACAGG + Intergenic
929658765 2:43761193-43761215 CAAGACTATAGATATAAAACTGG - Intronic
929862027 2:45686785-45686807 ACAGAATAGAAATGGAAAATTGG + Intronic
929945933 2:46371778-46371800 CCTGACTTTAGATGTAAAACTGG + Intronic
930545728 2:52765397-52765419 CCAGGACATATATATAAAACTGG + Intergenic
931217821 2:60262925-60262947 CCTGAACATACATGTAAAATAGG - Intergenic
931251126 2:60531305-60531327 CCAGAAAATAAATTAAATACTGG + Intronic
931263775 2:60642408-60642430 CCAGGAAATAAAAGGAAAACTGG - Intergenic
932147937 2:69340676-69340698 CAACAACAAAAATGTAAAACAGG + Intronic
933183403 2:79252168-79252190 CAAGAATATAGAGGTAAAAATGG + Intronic
933211386 2:79573629-79573651 CTAAAATAAAAGTGTAAAACAGG - Intronic
933583423 2:84152970-84152992 CCAGCAAATAAATGTGAAAGTGG - Intergenic
934330910 2:92068043-92068065 TCAAAATATAAATGAAAGACTGG - Intergenic
935250276 2:101254552-101254574 CCAGAAAGTGAATGTAACACAGG + Intronic
935966777 2:108485514-108485536 CCATAATAAAAAGCTAAAACAGG + Intronic
936854331 2:116938304-116938326 CCAGAACTTAAAAGTAAAAGAGG - Intergenic
938516647 2:132014842-132014864 TCAAAATATAAATGAAAGACTGG + Intergenic
939268111 2:139902173-139902195 CCAGAGTAGAAATGTAAAACTGG + Intergenic
940524894 2:154800851-154800873 ACAGTATATAAAAGTATAACTGG + Intronic
941185097 2:162312549-162312571 CCAGAAAATGAATTTAAAATTGG - Intronic
942964780 2:181878771-181878793 CCAGAAGATGACTGTAAAAAAGG - Intergenic
943616518 2:190098857-190098879 CCAAAATATAAAAGTACAAGGGG - Intronic
943805413 2:192119204-192119226 CCAAAATATAATAGTAAAAATGG + Intronic
943876537 2:193073435-193073457 CCAGAAGCTAAGTTTAAAACTGG + Intergenic
944315649 2:198283018-198283040 CCAGCATATAAATGTGCAAAGGG - Intronic
945202011 2:207291356-207291378 CCAGAATCTAAATTTTTAACAGG + Intergenic
946483622 2:220079679-220079701 CCAGGATATGAATTTAAAATTGG - Intergenic
947420695 2:229939303-229939325 CCACGATAAAAATGTAAAATAGG - Intronic
948036880 2:234864867-234864889 ACTCAATATAAATGCAAAACTGG - Intergenic
1168973666 20:1948030-1948052 CAAGACAATAAATGTAAAAGTGG + Intergenic
1169339488 20:4785586-4785608 CCAGAAGATAAATGTTACAAAGG + Intronic
1169616308 20:7449902-7449924 CCATAACATAAAAGTAAAAAGGG + Intergenic
1170028975 20:11924253-11924275 TCAGAATATCAATGTAAAATTGG + Exonic
1171038780 20:21740392-21740414 CCACAATATAAATGGAAATTAGG - Intergenic
1172838097 20:37885977-37885999 CCAAAATATAAAAGTAAACAAGG + Intergenic
1173267827 20:41502238-41502260 CCACATTAAAAAAGTAAAACAGG + Intronic
1173595350 20:44255599-44255621 CCAGCAAATAAGTGTAAAGCTGG + Intronic
1176974012 21:15298076-15298098 CCAGAATAGCAAAGTAAGACAGG - Intergenic
1177093884 21:16806980-16807002 CCAAAATGTGAATGTAAAAGTGG + Intergenic
1177636383 21:23792415-23792437 AAAGAAAATAAATGTAAAAATGG + Intergenic
1177827961 21:26105262-26105284 TCAAAATATTAATGTAATACAGG + Intronic
1178797366 21:35757353-35757375 CCACAATATAGATGTAAACATGG - Intronic
1178981003 21:37265481-37265503 CCAAAATATAAATATTACACTGG + Intronic
1182407329 22:30146891-30146913 CTATATTATAAATGAAAAACTGG + Intronic
1183002448 22:34872653-34872675 CCAGAGTAAATAAGTAAAACTGG - Intergenic
1183045734 22:35218185-35218207 CCAGAATAGACATGTGCAACAGG + Intergenic
1184323391 22:43761555-43761577 TCAAAATATGAATGCAAAACAGG - Intronic
949248486 3:1954031-1954053 ATAGAATATACATGTATAACAGG + Intergenic
949602750 3:5618585-5618607 CCAGAATACATATATGAAACTGG - Intergenic
951008369 3:17646581-17646603 CCAGATTATTGATGTAAAAATGG - Intronic
954076080 3:48181952-48181974 CCAAAATATTGAAGTAAAACAGG + Intronic
956543310 3:70369501-70369523 AAAGAATATAAAAGTAATACAGG - Intergenic
957683076 3:83463939-83463961 GCATAATATAAATATATAACAGG + Intergenic
957823144 3:85404942-85404964 CATGAATATAACTGTAAAATAGG - Intronic
958459679 3:94379105-94379127 CCAGACAAAATATGTAAAACAGG + Intergenic
958529241 3:95304269-95304291 CCAGAAGAGAAGTGTGAAACAGG + Intergenic
958858606 3:99417981-99418003 CTACATTTTAAATGTAAAACTGG + Intergenic
959155505 3:102662204-102662226 TCAGAATATGAAGGTCAAACTGG - Intergenic
959589995 3:108068537-108068559 CCTCAAAATAAATGCAAAACGGG + Intronic
960395954 3:117137917-117137939 CCAGAATATTAATCTGAAAAGGG + Intronic
960980433 3:123219286-123219308 CCAGAAGATAACTGTAATACAGG + Intronic
961096861 3:124164723-124164745 ATAAAATATAAATATAAAACAGG - Intronic
962465761 3:135657132-135657154 CCAGAAAATAAATTTAAAAATGG + Intergenic
962632807 3:137296834-137296856 CAAAAATATTAATGTATAACAGG + Intergenic
962680060 3:137789793-137789815 CCAGAATAAAAATGGATAATTGG - Intergenic
963634311 3:147775286-147775308 CCAGAATATAAATTTCATAGAGG + Intergenic
963856957 3:150264357-150264379 CCAAAATATCATGGTAAAACAGG - Intergenic
964314342 3:155427380-155427402 CAAGAATAAAAAGGTAACACTGG + Intronic
964348419 3:155778613-155778635 GCAGAATATAAATGAAAGAGAGG + Intronic
964665697 3:159169631-159169653 CCAGAATAAAAATGAAAAAGAGG + Intronic
964693781 3:159483995-159484017 CTACAATATAAATTTAAAAGAGG + Intronic
967119982 3:186374171-186374193 CCAGGAAAAAAATGTCAAACTGG + Intergenic
967401672 3:189069804-189069826 CCACAATACAAAGGAAAAACAGG + Intronic
967665371 3:192165397-192165419 CTAGAATTTACATGTAAAACTGG - Intronic
967719945 3:192805355-192805377 TCAGAATATTATTGAAAAACTGG - Intronic
967897013 3:194404647-194404669 CAAGAATTTAAATGTTAATCAGG + Exonic
970056859 4:11983612-11983634 CCAGACAATGTATGTAAAACAGG + Intergenic
970232729 4:13927549-13927571 GGAGAATAAAAATGGAAAACTGG + Intergenic
970280979 4:14455185-14455207 CCAAAAGACAAAAGTAAAACAGG + Intergenic
971195319 4:24467843-24467865 CCAGACTAGAAATATAAAAATGG - Intergenic
971495025 4:27255057-27255079 CCAAAATAGAAAAATAAAACTGG - Intergenic
972330382 4:38058602-38058624 CCAGAATATAAATGTAAAACAGG - Intronic
972674435 4:41245870-41245892 CCCGAAAATAATTATAAAACTGG + Intergenic
973056380 4:45664459-45664481 CCAGAATTTAAATGTACATGTGG + Intergenic
973870513 4:55161326-55161348 CCATAATATCAATGTCAAAGAGG + Intergenic
974368023 4:60977320-60977342 TCAGAATCAAAATGTACAACAGG - Intergenic
974791599 4:66697355-66697377 CTAGATTTTCAATGTAAAACAGG + Intergenic
975875721 4:78834652-78834674 AGAGAATGTAAATGTAAACCAGG - Intronic
978211117 4:106136398-106136420 CCAGAAAAGAAGTGGAAAACTGG + Intronic
979456844 4:120935546-120935568 CCATGAAAAAAATGTAAAACTGG - Intergenic
980110879 4:128635593-128635615 CGGGAATATCAATGTAAAAGAGG - Intergenic
980587880 4:134841630-134841652 CAAGAATAAAAATGTCAAAGAGG + Intergenic
981054139 4:140342476-140342498 GCAGAATATAATTGAAAAATTGG + Intronic
981220617 4:142229282-142229304 TCAGAATATACATGATAAACGGG + Intronic
982331707 4:154188047-154188069 ACATATTATAAATGGAAAACTGG - Intergenic
982412150 4:155090598-155090620 CCAGAAAATAAATGGATAAATGG - Intergenic
983317198 4:166147437-166147459 CCAGGAAATAAATGTATAAATGG - Intergenic
983989037 4:174096362-174096384 AAAGAATATAAAAGTTAAACTGG - Intergenic
984749329 4:183256749-183256771 CCCAAATATAAGTGGAAAACAGG - Intronic
985126046 4:186695668-186695690 CCAGAATATAAGGCTGAAACTGG - Intronic
985973859 5:3399369-3399391 CCAGAATCTGAATGTATAGCAGG - Intergenic
987439250 5:17935770-17935792 CCAAAATATAAATGATAAGCAGG + Intergenic
987445829 5:18018863-18018885 CCAGAATATCTATGTTCAACTGG - Intergenic
987516749 5:18919896-18919918 CCAGAATATTCATGCAAATCTGG - Intergenic
987972147 5:24960623-24960645 AGAGAGAATAAATGTAAAACTGG + Intergenic
988040604 5:25884488-25884510 TCAGAAAATAAATATAAAACTGG - Intergenic
988071585 5:26296170-26296192 CAAGAATAGAAAGGTAAGACAGG - Intergenic
989987476 5:50718214-50718236 CCAGAATATGAATTTTCAACTGG - Intronic
990147810 5:52782350-52782372 CCAGAATAAAGCTGTAAAAGTGG - Intergenic
990451765 5:55939417-55939439 CAAGAATATAAAAGATAAACAGG + Exonic
991227211 5:64286882-64286904 GCAGAATATAAAGGGCAAACTGG + Intronic
991968805 5:72118497-72118519 CAAGAATATAAGTGTAATAAAGG - Intronic
993627932 5:90248298-90248320 GCAGAATAGAAATATAAAAGTGG - Intergenic
993649185 5:90497685-90497707 CCAAGAAATAAATGTAAAAAAGG + Exonic
994541328 5:101101737-101101759 CCAGTATATTAATTTCAAACTGG + Intergenic
994969854 5:106721729-106721751 CCACAGTATACGTGTAAAACAGG - Intergenic
995873205 5:116763897-116763919 CCAAAAAAAAAATTTAAAACTGG - Intergenic
995922251 5:117328389-117328411 CCAGATAATAAATGAAAACCTGG + Intergenic
995937586 5:117535416-117535438 ACAGATTAAAAATGTCAAACCGG + Intergenic
999034516 5:148332615-148332637 ACAAAATATCAATGTTAAACAGG + Intronic
999816107 5:155177947-155177969 CCAGAAAATGAATGTAATAATGG + Intergenic
1000766489 5:165297496-165297518 GCAAAATGTAAATATAAAACAGG - Intergenic
1002982367 6:2151693-2151715 CCTTAATATTAATCTAAAACTGG + Intronic
1005129391 6:22487465-22487487 CCAAAATATAAAAGTCAGACAGG + Intergenic
1005378872 6:25213792-25213814 ACAGAAAATAAATTTAAAAAAGG + Intergenic
1005636930 6:27761762-27761784 CCAAAATGAAAATGTCAAACAGG + Intergenic
1007533966 6:42567733-42567755 CCTGAATATAAAAGAAATACAGG + Intronic
1007564840 6:42841955-42841977 CTAGAATATAACAGAAAAACAGG + Intronic
1008857451 6:56107111-56107133 TCAGAATAAAAATGTATAAAAGG + Intronic
1009893895 6:69722798-69722820 CCAGAATATAAATAACAAAATGG + Intronic
1010070205 6:71735381-71735403 CCAGATTATGATTTTAAAACTGG + Intergenic
1010332180 6:74636051-74636073 CCCGAATAGAAATGTGAAAAGGG + Intergenic
1010404707 6:75491128-75491150 CCAGAATATCATTGTGAAAGTGG + Intronic
1010564712 6:77396137-77396159 CCAGAAAATAATAGAAAAACTGG - Intergenic
1012070889 6:94614323-94614345 CAAGATTATAAATGAAAAAGAGG + Intergenic
1012109651 6:95213388-95213410 CCAGAATTTATAGGTAAAAATGG - Intergenic
1012149298 6:95725986-95726008 CCAGGAACTAAATGTAAAATTGG - Intergenic
1012560508 6:100574697-100574719 AAAGAATAAAAATTTAAAACAGG + Intronic
1012631550 6:101475762-101475784 TCAGAATTTAAATCTAAAAAAGG + Intronic
1012681226 6:102183707-102183729 CCAGAATATAAAAAGAAAATGGG - Intergenic
1012763840 6:103338630-103338652 CCAGAATATGAGTCTAAAACAGG + Intergenic
1012899115 6:104986794-104986816 TCAGAACCTAAAGGTAAAACTGG - Intronic
1014196395 6:118564699-118564721 CTAGAGTAAAAATGTAAAATTGG - Intronic
1014454187 6:121617978-121618000 CCAAAATAAATACGTAAAACAGG + Intergenic
1018446821 6:163866078-163866100 CCAGAATTTAAGGCTAAAACAGG - Intergenic
1019584667 7:1792221-1792243 ACTGAATATAAATTTAAAACCGG + Intergenic
1020625167 7:10569100-10569122 CTAGAATGTAAATGTCAAAAGGG - Intergenic
1020946902 7:14622583-14622605 CTAGAAAATAAATCTCAAACTGG + Intronic
1021209932 7:17836850-17836872 GCAAAATATACATGCAAAACAGG + Intronic
1021828316 7:24575785-24575807 CCAGAAAATAAAATTAAAAGAGG + Intronic
1022899390 7:34788406-34788428 CCAGAATATAATTATTAAAATGG + Intronic
1023816622 7:43955503-43955525 CCAGAATGCAAATGTCCAACAGG + Exonic
1024889866 7:54187336-54187358 CCAGAAAATAAAAAAAAAACAGG + Intergenic
1024898605 7:54291381-54291403 CCAGAAAATAAATATGGAACTGG + Intergenic
1026542732 7:71294812-71294834 CCAGTTTAAAGATGTAAAACTGG + Intronic
1027629172 7:80580939-80580961 CCATAATAAAAATGGAAAATGGG - Intronic
1027794998 7:82681373-82681395 TGAGAAAATAAATGTACAACTGG + Intergenic
1027844429 7:83354320-83354342 ACAGAATATAGATGTAGGACAGG + Intergenic
1031167148 7:118242955-118242977 CAAGAAGAAAAATGTAAAACTGG - Intergenic
1031259300 7:119497047-119497069 CCAAAATACAATTGAAAAACTGG + Intergenic
1031490518 7:122382052-122382074 GCAGAATATATATGTAAAATGGG - Intronic
1031544118 7:123031547-123031569 AAAGACTATACATGTAAAACAGG + Intergenic
1031977412 7:128102887-128102909 CCAGAGGATATCTGTAAAACCGG - Intergenic
1032817913 7:135496057-135496079 CAAGAAAATAACTGTAAAAATGG - Intronic
1032900156 7:136297921-136297943 CAAACATATAAATGTAAAAGTGG - Intergenic
1033385370 7:140869145-140869167 CCAGAGTGGAGATGTAAAACAGG + Intronic
1033444959 7:141412558-141412580 GCAGAATCTAAATGTATAAGTGG - Intronic
1033627259 7:143122689-143122711 CCCCGATAAAAATGTAAAACAGG - Intergenic
1033774336 7:144590591-144590613 CCAGGAAAAAAATGCAAAACTGG + Intronic
1035440315 7:158891801-158891823 TCAGAATATATATGCAAAACTGG + Intronic
1036045759 8:5138154-5138176 GGAGAATATAATTGCAAAACAGG + Intergenic
1036437847 8:8751718-8751740 ACAGAAAATAAATTTAAATCAGG - Intergenic
1036508007 8:9373462-9373484 CATGGATTTAAATGTAAAACTGG + Intergenic
1037173957 8:15925357-15925379 CAAGAATTTAAATGAAAAAGGGG - Intergenic
1037600022 8:20385971-20385993 ACAGAATAAGAATGTAAACCTGG - Intergenic
1038128270 8:24698803-24698825 CAAGATTACAAATGTAAAAATGG - Intergenic
1038615568 8:29090676-29090698 AAAGTATATAAATCTAAAACTGG - Intronic
1040068491 8:43169324-43169346 CCTCAATATAAACATAAAACTGG - Intronic
1040644315 8:49380509-49380531 ACAGAATATAAATGCAGACCAGG + Intergenic
1041249922 8:55924099-55924121 GCAGCATATATTTGTAAAACTGG - Intronic
1041432057 8:57793662-57793684 GAAGAATATAAATTTAGAACAGG - Intergenic
1042043319 8:64619477-64619499 CTAAAATATAAATGTCAAAGTGG + Intronic
1043619565 8:82172447-82172469 GCAGAAAAAAAATTTAAAACAGG + Intergenic
1043804355 8:84652641-84652663 CCACATTATGAATCTAAAACAGG + Intronic
1044484973 8:92741726-92741748 CCAGAATATGGCAGTAAAACAGG - Intergenic
1045180203 8:99772689-99772711 CCAGTATACACATATAAAACAGG - Intronic
1046368392 8:113269031-113269053 GCAAAATATAAATGTCAAAATGG + Intronic
1046528697 8:115415460-115415482 CCAGCATATAAGAGTAACACAGG + Intronic
1050228968 9:3496661-3496683 CCAGATTTTTAATGTAAAAATGG - Intronic
1051926585 9:22334825-22334847 CCAGAATATACAAGAGAAACTGG + Intergenic
1051948875 9:22606498-22606520 CCAGAATTTGAATTTAAATCAGG - Intergenic
1053945525 9:43306112-43306134 TCAAAATATAAATGAAAGACTGG - Intergenic
1055584802 9:77747588-77747610 CCTTAATTTAAATGAAAAACAGG + Intronic
1056184139 9:84116299-84116321 CCAGAATATAAATAACAAAATGG - Intergenic
1056734211 9:89191612-89191634 TGAGAAGATAAATGTAGAACAGG + Intergenic
1056893309 9:90516480-90516502 CCAAAATATAAAGGTAGTACAGG + Intergenic
1058201151 9:102042510-102042532 CAAAAATATAACTGCAAAACAGG + Intergenic
1058208741 9:102140557-102140579 CCAGAATATAAAGATAAAAAAGG - Intergenic
1203588660 Un_KI270747v1:34690-34712 TCAAAATATAAATGAAAGACTGG - Intergenic
1186864522 X:13706245-13706267 CCAGACTATTAATGTTAAAGAGG - Intronic
1186975845 X:14903968-14903990 TCAGAATAGAAATATAAAAAAGG + Intronic
1187583896 X:20638900-20638922 AGAGAATATAAGTGCAAAACTGG - Intergenic
1188141890 X:26560649-26560671 CCAGGATAGAAAAGTAAGACTGG - Intergenic
1188314540 X:28657062-28657084 CCAGACTATAAATGTAATGGGGG + Intronic
1188444630 X:30243314-30243336 TCAGAATATAAATTTAGAAATGG + Exonic
1189176301 X:38960679-38960701 GGAGAATGTAAATGTAAAATGGG - Intergenic
1190054236 X:47172652-47172674 CCATGACATAAATGTCAAACTGG - Intronic
1190576571 X:51845513-51845535 CCAAAATACAAAGGTGAAACAGG - Intronic
1192751180 X:73993252-73993274 CTAGAAGATAAATGGAAAAGAGG - Intergenic
1193488116 X:82113039-82113061 CCAGAAAACAAATTTAAAAGTGG - Intergenic
1193650650 X:84127086-84127108 CCAGACTATCAAAGAAAAACAGG + Intronic
1193777537 X:85662126-85662148 CCAGGTTATAAAGGTAAAGCAGG - Intergenic
1194127004 X:90031099-90031121 CCAGAATATAAAAGCAAGTCAGG - Intergenic
1194603435 X:95952187-95952209 GCAGAATATGAATGACAAACTGG + Intergenic
1197960258 X:131996763-131996785 CTAAAATAGAAATGTAAAACAGG - Intergenic
1199903584 X:152202236-152202258 CTAGAATATGAATGGAAATCTGG - Intronic
1200944038 Y:8814402-8814424 CCAGAAAAAAACTGAAAAACTGG + Intergenic
1201534685 Y:15032873-15032895 CCAGAATATATATGTACTATTGG - Intergenic
1201644602 Y:16216165-16216187 ACACAATATAAAGGTAAAAATGG + Intergenic
1201658213 Y:16369156-16369178 ACACAATATAAAGGTAAAAATGG - Intergenic