ID: 972331472

View in Genome Browser
Species Human (GRCh38)
Location 4:38068116-38068138
Sequence TGTTCTGCTTGGAACTGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 178}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972331472_972331479 -2 Left 972331472 4:38068116-38068138 CCCCTCCAGTTCCAAGCAGAACA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 972331479 4:38068137-38068159 CAAAACAGGAGATATCAAGGAGG No data
972331472_972331480 3 Left 972331472 4:38068116-38068138 CCCCTCCAGTTCCAAGCAGAACA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 972331480 4:38068142-38068164 CAGGAGATATCAAGGAGGAAAGG 0: 1
1: 0
2: 1
3: 28
4: 338
972331472_972331481 4 Left 972331472 4:38068116-38068138 CCCCTCCAGTTCCAAGCAGAACA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 972331481 4:38068143-38068165 AGGAGATATCAAGGAGGAAAGGG 0: 1
1: 0
2: 3
3: 42
4: 556
972331472_972331478 -5 Left 972331472 4:38068116-38068138 CCCCTCCAGTTCCAAGCAGAACA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 972331478 4:38068134-38068156 GAACAAAACAGGAGATATCAAGG 0: 1
1: 0
2: 6
3: 41
4: 384
972331472_972331482 22 Left 972331472 4:38068116-38068138 CCCCTCCAGTTCCAAGCAGAACA 0: 1
1: 0
2: 2
3: 14
4: 178
Right 972331482 4:38068161-38068183 AAGGGTGACCCCTCTATATCTGG 0: 1
1: 0
2: 0
3: 5
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972331472 Original CRISPR TGTTCTGCTTGGAACTGGAG GGG (reversed) Intronic
900290688 1:1922381-1922403 TGGTCTGGCTGGAACAGGAGGGG + Exonic
900805538 1:4765229-4765251 TGTTGACCTTGGAAGTGGAGAGG + Intronic
902362211 1:15948093-15948115 TGTTTTGATTGGTAGTGGAGTGG - Intronic
902427216 1:16333442-16333464 TTTTCTTCTTGGAAATGGGGGGG - Intronic
903114986 1:21171654-21171676 TGTTATTCTTGCAAGTGGAGAGG - Intronic
904083080 1:27884287-27884309 TGGTCTGCTGAGAACGGGAGGGG + Intronic
904879625 1:33685715-33685737 AGTTCTGCCTGGGACTGTAGAGG - Intronic
913131507 1:115842165-115842187 TGTTCCCCTAGGAACTGGCGGGG - Exonic
917647586 1:177044442-177044464 TGTTCTGCTGGGAACAGAGGGGG - Intronic
918386875 1:184017595-184017617 TGTTTTGGGTGGCACTGGAGTGG - Intronic
920294529 1:204947639-204947661 TGTTCTCCTTGGGGCTGGATAGG - Intronic
921968368 1:221117740-221117762 TGCTCTCTTTGGCACTGGAGTGG + Intergenic
923094229 1:230761839-230761861 TGGTCTGCTGGGAACAGGAAGGG - Intronic
924069228 1:240258621-240258643 TTTTCTGTTTGGAATTAGAGTGG + Intronic
924434284 1:244025031-244025053 ATTTCTGCTTGGAAGTGGGGAGG - Intergenic
1062777812 10:169004-169026 TGTGCTTCTTGGAGCGGGAGGGG + Intronic
1062919391 10:1267819-1267841 GGTTCTGCTTGGCTCTGTAGTGG + Intronic
1066548921 10:36533441-36533463 TGTTCTGCTTGGCCGTGGTGGGG + Intergenic
1071117707 10:82242592-82242614 TGTTTTGCTGAGACCTGGAGAGG + Intronic
1071921188 10:90352339-90352361 TGCTCTGCTTGGAACTCTTGAGG + Intergenic
1072559967 10:96563034-96563056 TGTTTTGCTTGGGATTGTAGGGG + Intronic
1072935783 10:99711877-99711899 TGTTCTGCATAGAACTGTATAGG + Intronic
1073139975 10:101240791-101240813 TGGTCAGCATGGAACAGGAGAGG - Intergenic
1074196903 10:111197058-111197080 CCTTCTTCTTGGAACTGGAATGG - Intergenic
1074470717 10:113724167-113724189 TACTCTGCCTGGAACTGGTGAGG + Intronic
1074868557 10:117559534-117559556 TGCTCTACATAGAACTGGAGGGG - Intergenic
1075474708 10:122724143-122724165 TGACCTGCATGGAACTGCAGTGG - Intergenic
1075741028 10:124696658-124696680 TGTTCTCCCTGGATCTGGAAGGG - Intronic
1075930900 10:126294522-126294544 TGTTCTGCTAGGAAGAGGAAAGG + Intronic
1080445014 11:32330744-32330766 TCTCCTGCTTGTAAGTGGAGTGG + Intergenic
1083303063 11:61748780-61748802 AGAGCTGATTGGAACTGGAGAGG + Intergenic
1084662549 11:70554725-70554747 TCTTCTGTATGGCACTGGAGTGG - Intronic
1089644651 11:119870716-119870738 TGTTATGCTTGGAACCTAAGAGG - Intergenic
1090603428 11:128396079-128396101 TGTTCTACTTGGACCTTCAGTGG - Intergenic
1092035469 12:5330848-5330870 TGTCCTGCTTGGGAGTTGAGTGG + Intergenic
1092551424 12:9505786-9505808 TGTTCTCCTGGGAACTGGGTGGG - Intergenic
1096811735 12:54174843-54174865 TGTTCTGTTTTGTACTTGAGAGG + Intronic
1097011628 12:55957373-55957395 TGTGGTGCCTGGAACTGGGGAGG + Exonic
1097247740 12:57615838-57615860 TGAGCTGCCTGGGACTGGAGGGG + Exonic
1097557087 12:61151973-61151995 TGTTATGCTTCAAACTGGATTGG + Intergenic
1097690128 12:62727235-62727257 TGCTATGCTGGGCACTGGAGTGG - Intronic
1097900987 12:64873706-64873728 TGTTTAGGATGGAACTGGAGAGG + Intronic
1100371799 12:93975473-93975495 TGTTCTGCCTGGACCTAGACAGG + Intergenic
1101371571 12:104136638-104136660 TATTTTGCTTGGAATGGGAGAGG + Intronic
1102455317 12:113067211-113067233 TGCTCTGCTTGCAGTTGGAGGGG - Intronic
1106621600 13:31376076-31376098 TGTTCTGCTAGTAATTGGTGAGG - Intergenic
1106871995 13:34031512-34031534 TGTTCTGAGAGGAACTGGTGAGG - Intergenic
1107020751 13:35748282-35748304 TGATCTGGTTTGAACTGGACAGG + Intergenic
1109655926 13:65389734-65389756 CAGTCTGCTTGGAAGTGGAGGGG + Intergenic
1111721835 13:91956040-91956062 TGTTCTGGTTGGAGCAGCAGTGG - Intronic
1111875070 13:93882655-93882677 TGTTCTATTTGAAACTGGGGTGG - Intronic
1112143028 13:96667516-96667538 TATTCAGCTTGTCACTGGAGGGG - Intronic
1113305956 13:109078965-109078987 TGTTCTGCTTATGACTTGAGAGG + Intronic
1113608760 13:111628642-111628664 TGTGCTGCTGGGGAATGGAGAGG + Intronic
1114140916 14:19909570-19909592 TATTCTGTGTGGAACTGCAGTGG - Intergenic
1114725316 14:24930597-24930619 TGTTCTGCTGGGATCTAAAGAGG + Intronic
1117293851 14:54360948-54360970 GGTCCTGCTTGGGACTGGGGTGG + Intergenic
1117844526 14:59897042-59897064 TGGTTTGCTTGGAACTGAGGGGG - Intergenic
1121712871 14:96052414-96052436 TGAGCTGCTTGGAGCTGCAGGGG - Intronic
1125251062 15:37705020-37705042 TGTTCTGCTTGAAACTGTGGTGG + Intergenic
1126107227 15:45154622-45154644 TGATCTGCTTTGAACTTCAGAGG + Intronic
1130163278 15:81424316-81424338 TGTTTTGCATTGCACTGGAGTGG + Intergenic
1130348212 15:83067656-83067678 TGTTTTGCCTGGAAGTGGAGGGG + Intergenic
1130867263 15:87943545-87943567 TGTTCTGAGTGGAGCTGGTGAGG - Intronic
1130996380 15:88906826-88906848 GGGTCTGCTTGGATCTTGAGTGG - Intronic
1133545008 16:6797641-6797663 TGTTCTCCTTGGTTCTGGAAAGG + Intronic
1133652907 16:7829781-7829803 TGTTGTGGTTGAAACTGGATTGG + Intergenic
1134972244 16:18540582-18540604 TGTTCTGCTGTACACTGGAGGGG - Intronic
1137010693 16:35317054-35317076 GGTTCTACCTGGAATTGGAGGGG + Intergenic
1139206739 16:65036352-65036374 TATTCTGCTTGGGACTCTAGAGG + Intronic
1139701673 16:68711581-68711603 TGTTCTGCTTCCCACTGGAGAGG + Intronic
1141874479 16:86813197-86813219 TGAGCTGTTTGGAACTGAAGGGG + Intergenic
1145775167 17:27522628-27522650 TTTTCTGGTTGGTATTGGAGAGG + Intronic
1146443163 17:32914712-32914734 TTTTCTGGTTGGGACAGGAGGGG + Intergenic
1146961030 17:36979194-36979216 TGTGCTGCTTGGAATTCAAGAGG - Intronic
1147454832 17:40530709-40530731 TGTGCTGAGTGGAACTGGAGAGG + Intergenic
1148150569 17:45394523-45394545 TGTTCTGTCTGGACCTGGGGAGG - Exonic
1148968240 17:51456074-51456096 TTTTCTGCTTGGAACTGTCAAGG + Intergenic
1149553361 17:57556056-57556078 TGATAAGCTTGGAACTGGATTGG + Intronic
1151625198 17:75271674-75271696 TGTCCTCCTTGGAGCGGGAGAGG - Intergenic
1151963961 17:77421646-77421668 CTTTCTCTTTGGAACTGGAGTGG + Intronic
1152669400 17:81593252-81593274 TCTTCTGCTTGGAACTGGGTGGG + Intronic
1153624495 18:7011301-7011323 TGGTCTCCTTGGAACTGCTGCGG + Exonic
1154472621 18:14719857-14719879 TGTTCAGGTTGGAAGTGCAGTGG + Intergenic
1157335563 18:46734637-46734659 TGCTCTGCTTGAAACAGGATGGG - Intronic
1158165791 18:54538717-54538739 TGTTGTGGTTGTAACTGCAGTGG - Intergenic
1158176535 18:54663356-54663378 GCTTCTGCTTGAAATTGGAGGGG - Intergenic
1159138571 18:64365744-64365766 TGTTGTGCGTGGATCTGGAATGG - Intergenic
1159865710 18:73702527-73702549 TGTTCTTCCTGTAACTGGAGGGG + Intergenic
1162819296 19:13212874-13212896 AGTTCTGCGTGGAATTGGAAGGG - Intronic
1162994573 19:14325992-14326014 TGCTCAGCTTGGACTTGGAGAGG - Intergenic
1163378239 19:16947370-16947392 TGTTCTGATCGGAAATGGAAAGG - Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1166958275 19:46480614-46480636 TGTTCTCCTTTGAGCTGGGGCGG + Intergenic
1167224748 19:48230352-48230374 TGTTCCACGAGGAACTGGAGGGG + Intronic
1168155278 19:54470915-54470937 TGTTCTGGTCTGGACTGGAGAGG - Intronic
925320797 2:2966137-2966159 TCTTCTGCTTCTAACTGTAGTGG + Intergenic
926032368 2:9603228-9603250 TGTTTTGCTTGTAACTTGACTGG - Intronic
926172013 2:10558522-10558544 TGTCCAGCTTGGACGTGGAGTGG - Intergenic
928946237 2:36774590-36774612 TGTTTTGCTTGCTACTGGATAGG + Intronic
929762173 2:44815531-44815553 TGCTGTGAGTGGAACTGGAGAGG + Intergenic
933929830 2:87138258-87138280 TGTTCTGCTTGCAACTTCTGGGG - Intergenic
934001162 2:87714050-87714072 TGTTCTGCTTGCAACTTCTGGGG - Intergenic
934159071 2:89230905-89230927 TATTCTGCTTGGAGCTGGCAAGG + Intergenic
936047256 2:109197310-109197332 TGTTCTGCCTGACACAGGAGGGG + Intronic
940180472 2:150926585-150926607 TTTGCTGCATGGAAATGGAGTGG - Intergenic
944955191 2:204799639-204799661 TGAGCTGCCTGGAGCTGGAGAGG - Intronic
1170722490 20:18895994-18896016 TGTTCTGCATGATACTGTAGTGG + Intergenic
1173342376 20:42163955-42163977 TGGTGTGATTGGAAATGGAGAGG + Intronic
1175141527 20:56864349-56864371 TGTTCTACATGGGACTGGAGAGG + Intergenic
1176728513 21:10465677-10465699 GGTTCTCCCTGGAGCTGGAGAGG + Intergenic
1176801868 21:13438034-13438056 TGTTCAGGTTGGAAGTGCAGTGG - Intergenic
1179162666 21:38910816-38910838 GGTTCTGCCTGGAATTGAAGAGG - Intergenic
1180059508 21:45377383-45377405 TCCTCTGCCTGGTACTGGAGAGG - Intergenic
1182138368 22:27929297-27929319 TGTTCTGCTTGAAACTATACTGG - Intergenic
1183989641 22:41589489-41589511 TGTTCTGCTTGGGAGTGCTGGGG - Intronic
949188003 3:1217396-1217418 TGTTGTGCATTGCACTGGAGGGG + Intronic
952312192 3:32200176-32200198 TGTTCTCCTTAGGTCTGGAGAGG - Intergenic
952645268 3:35649716-35649738 TGTTCTGCTTAAAGCAGGAGGGG - Intronic
953157319 3:40386946-40386968 TGTTTGGCTTCGACCTGGAGGGG + Intergenic
954148644 3:48646775-48646797 CGTTCTGCCTGGAACTGGGCAGG + Exonic
954914165 3:54134863-54134885 TGCTCAGCTTGGTACTGCAGAGG - Intronic
961519807 3:127460516-127460538 TGTCCAGCTTGGCACTTGAGTGG + Intergenic
961709125 3:128813493-128813515 TGTTTTGTTTGGAAGAGGAGAGG - Exonic
963347102 3:144108112-144108134 TGATCTGCTTGAAACTGGAGAGG + Intergenic
968981359 4:3851490-3851512 TGGGCTGCTGGGAACAGGAGAGG + Intergenic
970895186 4:21094189-21094211 AGTTCTGTTTTGAACTAGAGGGG - Intronic
972118478 4:35669037-35669059 TGTGTTGCTTGCAGCTGGAGTGG + Intergenic
972249594 4:37286032-37286054 TGTTCTCCTTGGATCTGCATTGG - Intronic
972331472 4:38068116-38068138 TGTTCTGCTTGGAACTGGAGGGG - Intronic
973702366 4:53550009-53550031 TGAACAGCTTGGAACTGGAGTGG + Intronic
974267057 4:59598822-59598844 TGTGCTGCCTGGAGCTGGGGAGG - Intergenic
975227343 4:71889931-71889953 TCTTCTGGTTGAATCTGGAGTGG + Intergenic
975693027 4:76984297-76984319 TGACTTGCTTGGAACTGGATTGG + Intronic
976574913 4:86657898-86657920 TGCACTGCCTGGAACTGGGGAGG + Intronic
976831297 4:89317761-89317783 TATTCTTGTTGGAACTGGACAGG - Intergenic
979913756 4:126404618-126404640 AGATCTGCTTGGACATGGAGTGG - Intergenic
984208700 4:176818658-176818680 TCAACTGCTGGGAACTGGAGGGG + Intergenic
990409011 5:55521921-55521943 TTTGCTGCTTGGTGCTGGAGAGG - Intronic
991568265 5:68027803-68027825 TGTTCTGCTTGGAGCTTGGCAGG + Intergenic
992832459 5:80607338-80607360 TGTTCTGGTGGGAACTTAAGAGG + Intergenic
993854772 5:93060369-93060391 TATGCTGCTTAGAAATGGAGAGG - Intergenic
993955041 5:94221952-94221974 TGTTTTGCCTGGAACTAGACGGG - Intronic
998503701 5:142654990-142655012 TGTTTTCCTTGGAGCTGGGGTGG - Intronic
998608666 5:143664014-143664036 TGTTCAGCCTGGCAGTGGAGAGG - Intergenic
998801311 5:145872516-145872538 AGTTCTGGTTGGTACCGGAGGGG + Intronic
999530574 5:152458784-152458806 TGATCTACATGGTACTGGAGTGG - Intergenic
999917503 5:156279151-156279173 TGTTCTGCATGTAGCTGGAGAGG + Intronic
1000130814 5:158296387-158296409 TGTATTGCTTATAACTGGAGTGG + Intergenic
1000682806 5:164207439-164207461 TGTCCAACTTGGCACTGGAGAGG - Intergenic
1002295712 5:178230063-178230085 TGTGCTGCTTGGACCACGAGAGG + Exonic
1005420411 6:25642667-25642689 TTTTCTGCTTGGAACTGAAGGGG - Intergenic
1006236876 6:32641397-32641419 AGTTCTACGTGGACCTGGAGAGG + Exonic
1006319913 6:33314204-33314226 TGTCCTGGTGAGAACTGGAGAGG - Exonic
1011059931 6:83253119-83253141 GGCTCTGCATGGATCTGGAGAGG + Intronic
1011548125 6:88502634-88502656 TGTTCTTCTTGGAACCAGACAGG - Intergenic
1013220870 6:108075778-108075800 AGGTTTGCTTGGAACTGAAGGGG + Intronic
1015219212 6:130784914-130784936 TGTTGGTCTTGGAACTAGAGGGG + Intergenic
1016254652 6:142089167-142089189 TGTATTGTGTGGAACTGGAGGGG + Intergenic
1017040763 6:150307030-150307052 TGATAAGCTTGGAACTGGAAGGG - Intergenic
1018459411 6:163983646-163983668 TGTTCTGCAAGGAACCTGAGGGG - Intergenic
1019921298 7:4164821-4164843 TGTTCTGTTGGGCTCTGGAGGGG - Intronic
1020882825 7:13783661-13783683 TCTTCTGCTTGGTACTAAAGAGG + Intergenic
1022071550 7:26920745-26920767 TGTACTGCTTGGCATTGGAAGGG + Intronic
1025726150 7:64063499-64063521 TGAGCTGCCTGGAGCTGGAGTGG + Intronic
1030011741 7:105175797-105175819 TTTTCTGTTTGGACCTTGAGTGG - Intronic
1032433356 7:131880666-131880688 AGTTCTGCTGGGAACTGGGCTGG + Intergenic
1034990250 7:155543385-155543407 TGCTCTGCTTGGACTTGGATGGG - Intergenic
1040526074 8:48226348-48226370 TGTTCTGCCTCCAATTGGAGTGG + Intergenic
1044333086 8:90944245-90944267 TGTTGTAATTGGAACAGGAGTGG - Intronic
1046072998 8:109281716-109281738 AGGTCTGCTTAGAAATGGAGTGG - Intronic
1048278332 8:133084703-133084725 ACTTCTGCTGGGAAATGGAGAGG - Intronic
1048461060 8:134622497-134622519 TGTTCTGATGCAAACTGGAGGGG + Intronic
1048691957 8:136975935-136975957 TGTTCTGATTGAAACTGAGGTGG - Intergenic
1055641901 9:78325389-78325411 TGCCCTGCTGGGAACTGGACTGG - Intronic
1056230463 9:84538304-84538326 TGAGCTGCCTGGAGCTGGAGGGG + Intergenic
1057329630 9:94101396-94101418 TGTCCAGCCTGGAAGTGGAGAGG + Intronic
1057905364 9:98978447-98978469 TTTCCTGCTGGGAACAGGAGGGG - Intronic
1059598818 9:115753496-115753518 TGTTCTGCTTAGAAATGCAGAGG + Intergenic
1059664788 9:116436376-116436398 TGTTCTGGTAGAAACTGGAGTGG - Intronic
1059899229 9:118904309-118904331 TGCTCTGGTTGAGACTGGAGTGG + Intergenic
1060789280 9:126474921-126474943 TGGTCTACTTGGAGCTTGAGTGG - Intronic
1061251124 9:129427120-129427142 TGTTCTGGTGGGAGATGGAGGGG + Intergenic
1061952995 9:133946613-133946635 TGCTCTGCTTCCAGCTGGAGTGG + Intronic
1186087339 X:6004667-6004689 TTTTCTTCTTGGAACTGCATGGG + Intronic
1186532659 X:10313112-10313134 AATTCTGCTTGGAATTGGACTGG + Intergenic
1186924710 X:14320574-14320596 TGCTCTGCTTGGAATAGCAGTGG - Intergenic
1187547371 X:20266962-20266984 TGTTCTGCTGGGAGCGGGCGCGG - Intronic
1190485283 X:50917624-50917646 TGTTCAGTTTGGATCTGGACCGG + Intergenic
1194666035 X:96678581-96678603 TGTGAGGATTGGAACTGGAGTGG - Intergenic
1194776491 X:97971678-97971700 TATTCTGGTTGGCCCTGGAGAGG + Intergenic
1195753377 X:108178508-108178530 TGTTCTGCTTGGTACTGCAAGGG + Intronic
1195921688 X:109990127-109990149 TCTACTGCTTGGAACTGGGGAGG - Intergenic
1198682834 X:139201117-139201139 TGTTCTGTTTGGAAAGGGGGCGG - Intronic
1198791300 X:140349744-140349766 TGTGCTGCTTCGGGCTGGAGGGG - Intergenic