ID: 972333586

View in Genome Browser
Species Human (GRCh38)
Location 4:38085588-38085610
Sequence TGCAGCGGAGGCTGAGCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 195}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972333586_972333590 5 Left 972333586 4:38085588-38085610 CCTTCGGCTCAGCCTCCGCTGCA 0: 1
1: 0
2: 2
3: 13
4: 195
Right 972333590 4:38085616-38085638 CCAAGCCAAGCTTCCTACACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972333586 Original CRISPR TGCAGCGGAGGCTGAGCCGA AGG (reversed) Intronic