ID: 972333586 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:38085588-38085610 |
Sequence | TGCAGCGGAGGCTGAGCCGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 211 | |||
Summary | {0: 1, 1: 0, 2: 2, 3: 13, 4: 195} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
972333586_972333590 | 5 | Left | 972333586 | 4:38085588-38085610 | CCTTCGGCTCAGCCTCCGCTGCA | 0: 1 1: 0 2: 2 3: 13 4: 195 |
||
Right | 972333590 | 4:38085616-38085638 | CCAAGCCAAGCTTCCTACACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
972333586 | Original CRISPR | TGCAGCGGAGGCTGAGCCGA AGG (reversed) | Intronic | ||