ID: 972333812

View in Genome Browser
Species Human (GRCh38)
Location 4:38087667-38087689
Sequence CTGTATTTTCAGTTGAGACG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347026
Summary {0: 2, 1: 90, 2: 5492, 3: 114690, 4: 226752}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972333812_972333821 29 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333821 4:38087719-38087741 GTAATTCCAACTACTCACTCGGG 0: 1
1: 2
2: 31
3: 71
4: 338
972333812_972333820 28 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333820 4:38087718-38087740 TGTAATTCCAACTACTCACTCGG No data
972333812_972333817 -6 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333817 4:38087684-38087706 ATACAGAAATTAGCAGGGCATGG 0: 14
1: 1339
2: 35330
3: 84164
4: 117308
972333812_972333818 -3 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333818 4:38087687-38087709 CAGAAATTAGCAGGGCATGGTGG 0: 11
1: 1365
2: 36718
3: 113208
4: 194357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972333812 Original CRISPR CTGTATTTTCAGTTGAGACG GGG (reversed) Intronic
Too many off-targets to display for this crispr