ID: 972333812 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:38087667-38087689 |
| Sequence | CTGTATTTTCAGTTGAGACG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 347026 | |||
| Summary | {0: 2, 1: 90, 2: 5492, 3: 114690, 4: 226752} |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972333812_972333821 | 29 | Left | 972333812 | 4:38087667-38087689 | CCCCGTCTCAACTGAAAATACAG | 0: 2 1: 90 2: 5492 3: 114690 4: 226752 |
||
| Right | 972333821 | 4:38087719-38087741 | GTAATTCCAACTACTCACTCGGG | 0: 1 1: 2 2: 31 3: 71 4: 338 |
||||
| 972333812_972333820 | 28 | Left | 972333812 | 4:38087667-38087689 | CCCCGTCTCAACTGAAAATACAG | 0: 2 1: 90 2: 5492 3: 114690 4: 226752 |
||
| Right | 972333820 | 4:38087718-38087740 | TGTAATTCCAACTACTCACTCGG | No data | ||||
| 972333812_972333817 | -6 | Left | 972333812 | 4:38087667-38087689 | CCCCGTCTCAACTGAAAATACAG | 0: 2 1: 90 2: 5492 3: 114690 4: 226752 |
||
| Right | 972333817 | 4:38087684-38087706 | ATACAGAAATTAGCAGGGCATGG | 0: 14 1: 1339 2: 35330 3: 84164 4: 117308 |
||||
| 972333812_972333818 | -3 | Left | 972333812 | 4:38087667-38087689 | CCCCGTCTCAACTGAAAATACAG | 0: 2 1: 90 2: 5492 3: 114690 4: 226752 |
||
| Right | 972333818 | 4:38087687-38087709 | CAGAAATTAGCAGGGCATGGTGG | 0: 11 1: 1365 2: 36718 3: 113208 4: 194357 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972333812 | Original CRISPR | CTGTATTTTCAGTTGAGACG GGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||