ID: 972333818

View in Genome Browser
Species Human (GRCh38)
Location 4:38087687-38087709
Sequence CAGAAATTAGCAGGGCATGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345659
Summary {0: 11, 1: 1365, 2: 36718, 3: 113208, 4: 194357}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972333810_972333818 20 Left 972333810 4:38087644-38087666 CCAGTCTGGCCAACATGGTGAAA 0: 3651
1: 96972
2: 164316
3: 173122
4: 160318
Right 972333818 4:38087687-38087709 CAGAAATTAGCAGGGCATGGTGG 0: 11
1: 1365
2: 36718
3: 113208
4: 194357
972333813_972333818 -4 Left 972333813 4:38087668-38087690 CCCGTCTCAACTGAAAATACAGA 0: 2
1: 179
2: 9450
3: 182980
4: 211969
Right 972333818 4:38087687-38087709 CAGAAATTAGCAGGGCATGGTGG 0: 11
1: 1365
2: 36718
3: 113208
4: 194357
972333814_972333818 -5 Left 972333814 4:38087669-38087691 CCGTCTCAACTGAAAATACAGAA 0: 1
1: 197
2: 10727
3: 210725
4: 136561
Right 972333818 4:38087687-38087709 CAGAAATTAGCAGGGCATGGTGG 0: 11
1: 1365
2: 36718
3: 113208
4: 194357
972333812_972333818 -3 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333818 4:38087687-38087709 CAGAAATTAGCAGGGCATGGTGG 0: 11
1: 1365
2: 36718
3: 113208
4: 194357
972333811_972333818 11 Left 972333811 4:38087653-38087675 CCAACATGGTGAAACCCCGTCTC 0: 34182
1: 124688
2: 145165
3: 98748
4: 47715
Right 972333818 4:38087687-38087709 CAGAAATTAGCAGGGCATGGTGG 0: 11
1: 1365
2: 36718
3: 113208
4: 194357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972333818 Original CRISPR CAGAAATTAGCAGGGCATGG TGG Intronic
Too many off-targets to display for this crispr