ID: 972333820

View in Genome Browser
Species Human (GRCh38)
Location 4:38087718-38087740
Sequence TGTAATTCCAACTACTCACT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972333813_972333820 27 Left 972333813 4:38087668-38087690 CCCGTCTCAACTGAAAATACAGA 0: 2
1: 179
2: 9450
3: 182980
4: 211969
Right 972333820 4:38087718-38087740 TGTAATTCCAACTACTCACTCGG No data
972333812_972333820 28 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333820 4:38087718-38087740 TGTAATTCCAACTACTCACTCGG No data
972333814_972333820 26 Left 972333814 4:38087669-38087691 CCGTCTCAACTGAAAATACAGAA 0: 1
1: 197
2: 10727
3: 210725
4: 136561
Right 972333820 4:38087718-38087740 TGTAATTCCAACTACTCACTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972333820 Original CRISPR TGTAATTCCAACTACTCACT CGG Intronic
No off target data available for this crispr