ID: 972333820 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:38087718-38087740 |
| Sequence | TGTAATTCCAACTACTCACT CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 972333813_972333820 | 27 | Left | 972333813 | 4:38087668-38087690 | CCCGTCTCAACTGAAAATACAGA | 0: 2 1: 179 2: 9450 3: 182980 4: 211969 |
||
| Right | 972333820 | 4:38087718-38087740 | TGTAATTCCAACTACTCACTCGG | No data | ||||
| 972333812_972333820 | 28 | Left | 972333812 | 4:38087667-38087689 | CCCCGTCTCAACTGAAAATACAG | 0: 2 1: 90 2: 5492 3: 114690 4: 226752 |
||
| Right | 972333820 | 4:38087718-38087740 | TGTAATTCCAACTACTCACTCGG | No data | ||||
| 972333814_972333820 | 26 | Left | 972333814 | 4:38087669-38087691 | CCGTCTCAACTGAAAATACAGAA | 0: 1 1: 197 2: 10727 3: 210725 4: 136561 |
||
| Right | 972333820 | 4:38087718-38087740 | TGTAATTCCAACTACTCACTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 972333820 | Original CRISPR | TGTAATTCCAACTACTCACT CGG | Intronic | ||
| No off target data available for this crispr | |||||