ID: 972333821

View in Genome Browser
Species Human (GRCh38)
Location 4:38087719-38087741
Sequence GTAATTCCAACTACTCACTC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 2, 2: 31, 3: 71, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972333813_972333821 28 Left 972333813 4:38087668-38087690 CCCGTCTCAACTGAAAATACAGA 0: 2
1: 179
2: 9450
3: 182980
4: 211969
Right 972333821 4:38087719-38087741 GTAATTCCAACTACTCACTCGGG 0: 1
1: 2
2: 31
3: 71
4: 338
972333814_972333821 27 Left 972333814 4:38087669-38087691 CCGTCTCAACTGAAAATACAGAA 0: 1
1: 197
2: 10727
3: 210725
4: 136561
Right 972333821 4:38087719-38087741 GTAATTCCAACTACTCACTCGGG 0: 1
1: 2
2: 31
3: 71
4: 338
972333812_972333821 29 Left 972333812 4:38087667-38087689 CCCCGTCTCAACTGAAAATACAG 0: 2
1: 90
2: 5492
3: 114690
4: 226752
Right 972333821 4:38087719-38087741 GTAATTCCAACTACTCACTCGGG 0: 1
1: 2
2: 31
3: 71
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972333821 Original CRISPR GTAATTCCAACTACTCACTC GGG Intronic
901119053 1:6875401-6875423 GTAATCCCAGCTACTCAGGCAGG - Intronic
901826340 1:11864210-11864232 CTAATTCCCACCACTCAGTCTGG + Intergenic
902106505 1:14040639-14040661 GTAATCCCAGCTACTCAGGCTGG + Intergenic
902589422 1:17462895-17462917 GTGATTCCAACTACTGAGCCAGG - Intergenic
902845023 1:19103441-19103463 GTAATCCCAGCTACTCAGTAAGG + Intronic
903489451 1:23717100-23717122 GTAATCCCAGCTACTCAGTCAGG + Intergenic
904118833 1:28182213-28182235 GTAATTCCAACTACTCAGGAGGG + Intronic
904743634 1:32697318-32697340 GTAATCCCAGATACTCACTGAGG + Intronic
905130318 1:35750511-35750533 GTAATCCCAGCTACTCAGGCAGG - Intronic
905416048 1:37805133-37805155 GTAATCCCAGCTACTCACTCGGG + Intronic
905578155 1:39062578-39062600 GTAATCCCAGCTACTCAGGCTGG + Intergenic
906313982 1:44774478-44774500 GTAATTCCAGCAACTCCGTCTGG - Intergenic
906561317 1:46759486-46759508 GTAGTTCCAACTACTCAGGAAGG + Intronic
907012008 1:50971040-50971062 GTAATACCATCCACTCATTCAGG + Intronic
907631358 1:56085486-56085508 GTAATCCCAACTACTCAGGAAGG + Intergenic
908100574 1:60786771-60786793 GGAAGTCAAACTACTAACTCTGG - Intergenic
908112967 1:60915340-60915362 TTTATTCCCACTATTCACTCAGG - Intronic
908470419 1:64438580-64438602 GTAATCCCAGCTACTCAGGCAGG + Intergenic
908854389 1:68408015-68408037 GTAATCCCAGCTACTCACGAAGG + Intergenic
911369271 1:96976951-96976973 GTAATTCCAGCTACTCAGGAAGG + Intergenic
912481164 1:109983235-109983257 ATAGTCCCAGCTACTCACTCAGG + Intergenic
912997305 1:114543871-114543893 GTATTTTCAGCTTCTCACTCTGG - Intergenic
913576182 1:120177256-120177278 GTGGTCCCAGCTACTCACTCGGG + Intergenic
916649914 1:166825165-166825187 GTAGTTCCAGCTACTCACTCGGG - Intergenic
917428854 1:174944150-174944172 GTAATCCTAGCTACTTACTCGGG + Intronic
917714329 1:177719145-177719167 GTAATCCCAGCTACTCACTCAGG - Intergenic
917952908 1:180059454-180059476 ATAATTCTTACTACTCAATCAGG - Intronic
918063235 1:181080390-181080412 GTAATCCCAGCTACTCACTCGGG - Intergenic
918281645 1:183011799-183011821 GTAATCGCAGCTACTCACTCAGG - Intergenic
918291434 1:183111912-183111934 GTAATCACAGCTACTCACTTGGG + Intronic
919541480 1:198851120-198851142 GTAATCCCAACTACTCACTCAGG + Intergenic
919700985 1:200630858-200630880 GTAATCACAGCTACTCAGTCAGG - Intronic
920299670 1:204980912-204980934 GTCATTCCAAAGACTCCCTCTGG + Intronic
922634854 1:227158080-227158102 GTAATCCCAGCTACTCACTCAGG - Intronic
922710858 1:227830610-227830632 GTAATCCCAGCTACTCAGGCAGG - Intronic
922798822 1:228354640-228354662 GTAGTCGCAAATACTCACTCTGG + Intronic
922897464 1:229111559-229111581 TTAATTCCAACAACTCAGTGTGG + Intergenic
923566542 1:235080681-235080703 GTAATTCCAGCTACTCAGGAAGG + Intergenic
923613121 1:235512761-235512783 GTAATCCCAACTACTCAGGAGGG - Intergenic
923802410 1:237222942-237222964 GTAATCCCAGCTACGCACGCAGG + Intronic
923853149 1:237818937-237818959 GTAGTTCCTAATCCTCACTCTGG - Intronic
924056606 1:240130421-240130443 GTAATCCCAGCTACTCAGTAGGG - Intronic
1064392147 10:14951258-14951280 GTAATCCCAACTACTCAGGTGGG + Intronic
1065545792 10:26818867-26818889 ATAATCCCAGCTACTCACTCGGG + Intronic
1065545924 10:26820706-26820728 GTAATCCCAGCTACTCACTCAGG - Intronic
1065561843 10:26971552-26971574 GTAATCCCAGCTACTCAGGCAGG + Intergenic
1065574121 10:27101239-27101261 GTAGTCTCAGCTACTCACTCAGG - Intergenic
1067302508 10:45025050-45025072 GTAATTCCAGCTACTCAAGGAGG + Intergenic
1068294538 10:55052589-55052611 GTAGTCCCAGCTACTCACTAGGG + Intronic
1068599472 10:58940732-58940754 GTAGTTCCAACTACTCTACCTGG + Intergenic
1068820672 10:61374668-61374690 ATAATACCAACCACTCTCTCAGG - Intergenic
1069937782 10:71930452-71930474 GTAATCCCAGCTACTCAGTGGGG + Intergenic
1072776607 10:98202729-98202751 GTAGTCCCAGCTACTCACTTGGG + Intronic
1073118913 10:101109305-101109327 GTAATCCCAGCTACTCACTCAGG - Intronic
1073369702 10:102976564-102976586 GTAATTCCAGCTACTCATGAGGG - Intronic
1074089602 10:110236579-110236601 GTAGTCCCAGCTCCTCACTCAGG - Intronic
1074325200 10:112444316-112444338 GAAATTCCCACTCCTCCCTCAGG + Intronic
1076131281 10:128015710-128015732 GTAGTCCCAGCTACTCACTTGGG + Intronic
1079531203 11:21456010-21456032 GTAGTCCCAGCTACTCACTCGGG - Intronic
1080980578 11:37399534-37399556 GTAATCCCAGCTACTCAATGGGG + Intergenic
1081492219 11:43577715-43577737 CTAATTCCACCAACTCACTTGGG - Intronic
1082243659 11:49895059-49895081 TTCATTCCAACTCCTCAGTCTGG + Intergenic
1084702935 11:70799275-70799297 GTAATCTCAGCTACTCGCTCAGG + Intronic
1085086673 11:73672551-73672573 GTAATTCCAGCTACTCTCATTGG - Intergenic
1086221688 11:84452803-84452825 GTAATTCCAGCTACTCAGGTTGG + Intronic
1087092956 11:94293802-94293824 GTAGTCCCAGCTACTCACTCGGG + Intergenic
1087167046 11:95015282-95015304 GTAATCCCAGCTACTCACTCGGG - Intergenic
1087259364 11:95993444-95993466 GTAATCCCAATTACTTACTCAGG + Intronic
1087354915 11:97080569-97080591 CTATTTCCAGCTACTCTCTCTGG - Intergenic
1087656120 11:100924950-100924972 GTAATTTCAGCTACTCGCTCAGG - Intronic
1089505135 11:118957546-118957568 GTAAGTCCCAATACTCACTGAGG + Intronic
1089575065 11:119436263-119436285 GTACTGCCTACTACTCACCCGGG - Intergenic
1090380644 11:126325060-126325082 GTAATCCCAGCTACTCACTCGGG + Intronic
1091836087 12:3586793-3586815 GCTATTCCATCTCCTCACTCAGG + Intronic
1092526255 12:9311997-9312019 TAAAATCCAACTACTCTCTCAGG - Intergenic
1094619086 12:32062886-32062908 GTAGTCCCAGCTACTCACTCAGG - Intergenic
1095709600 12:45274386-45274408 GTGATACCACCTAGTCACTCAGG + Intronic
1095906840 12:47387290-47387312 GTAATCCCAGCTACTCAGTTAGG + Intergenic
1096062060 12:48710010-48710032 GTAGTCCCAGCTACTCACTTGGG - Intronic
1096083006 12:48845328-48845350 GTAGTCCCAGCTACGCACTCAGG + Intronic
1096297660 12:50397509-50397531 GTAATTCCAGCTACTCAGGGAGG - Intronic
1096455188 12:51779092-51779114 GTAATCCAAGCTACTCACCCAGG + Intronic
1096700777 12:53381071-53381093 GTAATTCCAGCTACTCCCGGAGG - Intronic
1097464768 12:59908543-59908565 GTAATCCCAGCTACTCAGGCAGG + Intergenic
1098271755 12:68776386-68776408 GTAATCCCAGCTACTCACTCAGG + Exonic
1100737168 12:97549067-97549089 GTATTTCCTACTACGCACCCTGG + Intergenic
1100976232 12:100125209-100125231 GTAATTCCAGCTACTCAGGGAGG + Intronic
1101109608 12:101472937-101472959 GTAATCCCAGCTACTCAGGCTGG - Intergenic
1101413840 12:104491823-104491845 GAAATTCCCACCACTCACTGGGG + Intronic
1102334090 12:112062603-112062625 GTAATCCCAACTACTCAGGAGGG + Intronic
1102791996 12:115654451-115654473 GTGGTCCCAGCTACTCACTCGGG + Intergenic
1102872964 12:116428173-116428195 GTAATCCCAGCTACTCAGGCAGG + Intergenic
1103431241 12:120888932-120888954 GTAATCCCAGCTATTTACTCGGG - Intronic
1103962720 12:124619068-124619090 GTAATCCCAGCTACTCAGTGAGG + Intergenic
1104029485 12:125054054-125054076 GTGATTCCAACTGCAGACTCAGG - Intergenic
1105345712 13:19570495-19570517 GTAGTGACAGCTACTCACTCGGG + Intergenic
1105471227 13:20696605-20696627 GTAATCCCAACTACTGAGGCAGG + Intergenic
1105901565 13:24758953-24758975 GTAGTCCCAGCTACTTACTCGGG + Intergenic
1106648804 13:31666532-31666554 GTAGTCCCAGCTACTCTCTCTGG - Intergenic
1108694582 13:52891847-52891869 GCAATTCAAACTACGCATTCAGG + Intergenic
1109728317 13:66375187-66375209 GTAATTCCATATAATTACTCAGG + Intronic
1110177779 13:72578101-72578123 GTAATCCCAGCTAATCAGTCAGG + Intergenic
1110215272 13:73018217-73018239 CCAATCCCAGCTACTCACTCTGG - Intergenic
1112556070 13:100469653-100469675 GTAGTCTCAGCTACTCACTCGGG + Intronic
1114283344 14:21215775-21215797 GTAATTCCAGCTACTCAGGAGGG + Intronic
1114295931 14:21329192-21329214 GTAATCCCAGCTACTCAGTCGGG + Intronic
1114636658 14:24190984-24191006 GTAGTCCTAGCTACTCACTCGGG - Intronic
1115431832 14:33328576-33328598 GTAATCCCAACTACTGAGGCAGG - Intronic
1115654211 14:35427755-35427777 ATAATCCCACCTACTCACTCAGG - Intergenic
1115970010 14:38934321-38934343 GTAATCCCAACTACTCAGGAGGG + Intergenic
1116750913 14:48882261-48882283 GTAATCCCAGCTACTCACTCGGG + Intergenic
1117272440 14:54158694-54158716 TTATTTCAAACTCCTCACTCTGG + Intergenic
1119437469 14:74606716-74606738 GTAGTCCCAGCTACTCACTCGGG + Intronic
1119764078 14:77177433-77177455 GTAATCCCAACTACTCAGGAGGG - Intronic
1120279589 14:82422022-82422044 GTAATTCCAGCTACTCAGGAGGG + Intergenic
1120871213 14:89339091-89339113 GTAATCCCAGCAACTCACCCAGG - Intronic
1121176446 14:91894276-91894298 GAAACGCCAGCTACTCACTCAGG + Intronic
1121999381 14:98634335-98634357 ATCATTCAAACGACTCACTCAGG + Intergenic
1122249986 14:100430998-100431020 GTCCTTCCATCGACTCACTCAGG - Intronic
1122647139 14:103202399-103202421 GTAGTCCCAACTACTCACTTGGG - Intergenic
1123686920 15:22804959-22804981 GTAGTCCCAGCTACTCACTCGGG - Intronic
1124627300 15:31315615-31315637 AGAAGTCCAACTACTCAATCTGG - Intergenic
1124913725 15:33948215-33948237 GTAATTCCAGCTACTCAGGAGGG - Intronic
1125428382 15:39572521-39572543 GTAATCCCAGCTACTCAGGCAGG + Intergenic
1125652193 15:41326546-41326568 GTAATCCCAGCTACTCACTTGGG - Intronic
1125684451 15:41555526-41555548 GTAATCCCAGCTACTTACTGAGG - Intergenic
1127137215 15:55936911-55936933 GTAATCCCAACTACTCAAGAGGG - Intronic
1127145751 15:56021710-56021732 GTAATCCCAGCTACTCAGTAGGG - Intergenic
1129285210 15:74519039-74519061 GTAGTTACAGCTACTCACTCAGG - Intergenic
1129465097 15:75720108-75720130 GTAATCCCATCTACTCAAGCAGG - Intergenic
1130544740 15:84846887-84846909 GTAATCCCAGCTACTCCCTCAGG - Intronic
1131086617 15:89580909-89580931 GTACTCCCAGCTACTTACTCAGG + Intronic
1131476735 15:92746384-92746406 GTAATCCCAGCTACTCACTCAGG - Intronic
1132124255 15:99207634-99207656 GTAATCCCAACTACTCAGGAGGG + Intronic
1134155590 16:11840443-11840465 GTAGTTCCAACTACTCAGGAGGG + Intronic
1134274294 16:12761888-12761910 GTAATTCCAGCTACTCACTCGGG + Intronic
1134337907 16:13318445-13318467 GTACTTCCAGCTACTCAGTCAGG - Intergenic
1136606159 16:31335275-31335297 GAAATTGGAACTACTCACTCTGG - Intergenic
1136635104 16:31516139-31516161 GTAATCCCAGCTACTCAGGCGGG + Intergenic
1137455670 16:48616038-48616060 GTAATCCCAGCTACTTACTTGGG - Intronic
1138729255 16:59176759-59176781 CTTTCTCCAACTACTCACTCTGG + Intergenic
1139809228 16:69598891-69598913 GTAATTCCAGCTACTCAGGAGGG + Intronic
1140207239 16:72943410-72943432 GTAATTCCAGCTACTCAGGAGGG + Intronic
1140251048 16:73294688-73294710 GTAATTCCAGCTACTCAGGGTGG + Intergenic
1141966747 16:87450693-87450715 ATAATCCCAGCTACTCACTCAGG - Intronic
1143127740 17:4655054-4655076 GTAATTCCAGCTACTCATGAAGG + Intergenic
1143557320 17:7670023-7670045 GTAATCCCAGCTACCTACTCGGG - Intronic
1143703350 17:8678622-8678644 GCAATTCCAACTCCTAACTACGG - Intergenic
1144184416 17:12783222-12783244 GTAATTCCAGCTACTCAGGGAGG + Intergenic
1144360248 17:14485270-14485292 GTAATTTCTACTTCTCAATCTGG + Intergenic
1145212668 17:21026442-21026464 GTGGTCCCAGCTACTCACTCAGG - Intronic
1145943228 17:28754893-28754915 GTAATTCCAGCTACTCAGGAGGG - Intergenic
1146228907 17:31091703-31091725 GTAATCCCAACTACTTACTAGGG - Intergenic
1147171532 17:38622497-38622519 GTAATCCCAACTACTCAGGAGGG + Intergenic
1147297892 17:39499327-39499349 GTAATTCCAGCTACTCAGGGAGG - Intronic
1147616840 17:41834625-41834647 GTAGTTCCAGCTACTCAGTAGGG + Intronic
1148032444 17:44630676-44630698 GCAGTCCCAGCTACTCACTCAGG - Intergenic
1148380752 17:47195181-47195203 GTAATCCCAGCTACTTACTTAGG - Intergenic
1150126544 17:62639213-62639235 GTAATCCCAGCTACTCAGTTGGG + Intronic
1150347518 17:64415550-64415572 GTAATTCCAGCTACTCGCGGAGG - Intergenic
1151051375 17:70982916-70982938 GTAATCCCAGCTACTCAGTGAGG + Intergenic
1151515361 17:74590948-74590970 GTAGTCCCAGCTACTCACTCAGG + Intronic
1152102564 17:78311077-78311099 ATAATCCTACCTACTCACTCAGG - Intergenic
1153150134 18:2083251-2083273 GTAAGTCCAAATACACATTCGGG - Intergenic
1154239115 18:12636011-12636033 GTAGTCCCAGCTACTCACTCAGG - Intronic
1154250832 18:12743291-12743313 GTAATCCCAGCTACTTACTTGGG - Intergenic
1155480938 18:26286802-26286824 GTAATTCCAGCTACTCAGGAGGG - Intronic
1155504022 18:26515628-26515650 GTAATCCTAGCTACTCACTCAGG - Intronic
1157874001 18:51254876-51254898 GTAATCCCAGCTACTGAGTCAGG - Intergenic
1160454474 18:78990826-78990848 GTAATTCCCAATAATTACTCAGG - Intronic
1161223538 19:3131010-3131032 GTAATCCCAGCTACTCACTCGGG + Intergenic
1161675164 19:5642784-5642806 ATAATCCCAGCTACTCACTTGGG - Intronic
1161935598 19:7370074-7370096 GTAATCCCAACTACTCAGGAGGG + Intronic
1162083911 19:8236879-8236901 ATAATTCCAGCTACTCAGTGTGG + Intronic
1162173844 19:8814548-8814570 GTAATTCCAAGCACATACTCAGG + Intronic
1162298026 19:9827012-9827034 GTAATCCCAGCTACTTACTCGGG + Intronic
1162801673 19:13114535-13114557 GTAGTCCCAGCTACTCAGTCGGG + Intronic
1163542774 19:17921174-17921196 GTAATCCCAGCTACTCACTCGGG + Intergenic
1163703156 19:18796849-18796871 GTAATCCCAGCTACTTACTTAGG + Intergenic
1163840347 19:19604349-19604371 GTAATCCCAACTACTTGCTGAGG + Intronic
1165054653 19:33166789-33166811 GTAGTTCCAGCTACTCACTCAGG + Intronic
1165307384 19:35010975-35010997 GTAGTCCCAGCTACTCACTCAGG + Intronic
1165769771 19:38372690-38372712 GCAATCCCAGTTACTCACTCGGG - Intergenic
1166063119 19:40339848-40339870 GTAATCCCAGCTACTCAATCTGG + Intronic
1167005178 19:46771510-46771532 GTAATTCCAGCTACTCAGGAGGG + Intronic
1167372119 19:49089275-49089297 GTAATCCCAGGTACTCACTCAGG + Intronic
1167627187 19:50599317-50599339 GTAGTCCCAGCTACTCACTTAGG - Intergenic
1167894815 19:52572173-52572195 GTAATTCCAGCTACTCAGGAAGG - Intronic
1167966501 19:53151970-53151992 GTAATTCCAGCTACTCAGGAGGG + Intronic
1168425906 19:56238509-56238531 GTAATTCCAGATACTCACTCAGG + Intronic
1168528192 19:57105587-57105609 GTAGTCCCAGCTACTTACTCAGG - Intergenic
1168617061 19:57846864-57846886 GTAATCCCAGCTACTCACTCAGG + Intronic
1168653267 19:58107434-58107456 GTAATCCCAGCTACTTGCTCAGG + Intronic
925367259 2:3319313-3319335 GTCATTGCAACAACTCCCTCAGG + Intronic
926038718 2:9655712-9655734 GTAATTCCAACTCCCCAGGCCGG + Intergenic
926474553 2:13306332-13306354 GTAATTCCAGCTACTCAGAAGGG + Intergenic
927539521 2:23896198-23896220 GTAATTCCAGCTACTTGCTTGGG + Intronic
927661759 2:24999360-24999382 GTAATTCCAGCTACTCAGGAGGG - Intergenic
928014621 2:27644057-27644079 GTAATTCCAGCTACTCGCTGAGG + Intronic
929650129 2:43671105-43671127 GTAATCCCAGCTACTCAGTGGGG - Intronic
930184784 2:48402513-48402535 GTAGTCCCAGCTACTCACTCGGG + Intergenic
930660606 2:54049138-54049160 GTAATTCCAGCTACTCAGGAGGG + Intronic
930707925 2:54522508-54522530 GTAATTCCAGCTACTCAGGAGGG + Intronic
930806404 2:55494979-55495001 GTGATCCCAGCTACTCACTTGGG + Intergenic
930822682 2:55663003-55663025 GTAGTCCCAGCTACTTACTCAGG - Intronic
931567819 2:63633939-63633961 GTAATCCCAGCTACTCACGAGGG + Intronic
932558451 2:72846108-72846130 GTAATTCCAGCTACTCAGGAAGG + Intergenic
933033457 2:77361962-77361984 GTAGTCCCAACTATTCAGTCAGG + Intronic
933118061 2:78498929-78498951 GTAATTCCAGCTACTCAGGAGGG - Intergenic
933467443 2:82672550-82672572 CTAATTCTAACTAATCACTGAGG - Intergenic
935412570 2:102781102-102781124 GTAAGTACAACTAATAACTCTGG - Intronic
935666533 2:105517614-105517636 GTAGTCCCAGCTACTCACTAGGG - Intergenic
935792742 2:106608895-106608917 GCAGTCCCAACTACTCACTGGGG - Intergenic
935947363 2:108298496-108298518 GTAGTCCCAGCTACTTACTCGGG - Intronic
937036145 2:118784168-118784190 GTAAAACCAACGACTCACCCTGG - Intergenic
939804808 2:146761668-146761690 GTAATCCCAGCTACTCATTCAGG + Intergenic
939816675 2:146905118-146905140 GTAATCCCAGCTACTCAGTCAGG - Intergenic
939832740 2:147092210-147092232 GTAGTCCCAGCTACTCACTTGGG + Intergenic
940657382 2:156505158-156505180 GTAATTAGAAATTCTCACTCAGG + Intronic
940746681 2:157575251-157575273 GTAATCCCAGCTACTCACTCAGG - Intronic
940936113 2:159496659-159496681 GTAATCCCAACTACTCAGGAAGG + Intronic
941062172 2:160859633-160859655 GTAATTACAACTACTTACTCTGG + Intergenic
941756780 2:169194830-169194852 GTAATCCCAGCTACTCAGGCAGG - Intronic
942358242 2:175142969-175142991 GTAATCCCAGCTACTTACTTAGG - Intronic
943047273 2:182873688-182873710 GTAATCCCAGCTACTCAGTAGGG + Intergenic
943833860 2:192493908-192493930 GTAATTCCAGCTACTCAGGAGGG + Intergenic
944132589 2:196362820-196362842 GTAATTGCAACCACTGACACAGG - Intronic
944232692 2:197411987-197412009 GTAATTCCAGCTACTCAGGAGGG + Intronic
944408168 2:199409289-199409311 GTAATTCCAGCTACTCAGGAAGG - Intronic
944774831 2:202952601-202952623 GTAATTCCACCTACCCAGACAGG + Exonic
944865510 2:203856594-203856616 CTAATTCCAATTAATCACACTGG - Intergenic
945009069 2:205442421-205442443 GTAATCCCAGCTACTCACTCGGG - Intronic
945084719 2:206119532-206119554 GTAATCCCAGCTACTCACTCAGG - Intronic
946286856 2:218710625-218710647 CTAATTCCACCTACTCCCTATGG - Intergenic
946531790 2:220578252-220578274 GTGATTCCAACCCCTCATTCTGG - Intergenic
947703987 2:232259737-232259759 GTAATCCCAACTACTCAGAAAGG - Intronic
1169173462 20:3486526-3486548 GTAATTTCAACTACTCAGGAAGG - Intronic
1169452244 20:5721899-5721921 GTAATCCCAACTCCTAACTAGGG + Intergenic
1172257659 20:33533852-33533874 GTAATTCCAGCTACTCAGGAGGG + Intronic
1172306769 20:33886127-33886149 GTAATTCCAGCTACTCAGGAGGG + Intergenic
1172682133 20:36724805-36724827 GTAATTCCAGCTACTCCAGCAGG + Intronic
1173821356 20:46022251-46022273 CTAGTTCCACCTCCTCACTCTGG - Intronic
1174808049 20:53621761-53621783 GAAAAGCCAACTACTCACTGGGG + Intergenic
1174900102 20:54490708-54490730 GTAGTCCCAGCTACTTACTCGGG - Intronic
1176676417 21:9782649-9782671 GTGATTTCAACTACTCACTTAGG - Intergenic
1178299156 21:31437379-31437401 GTAATCCCAGCTACTCAGTGGGG + Intronic
1178528393 21:33352480-33352502 GTAATCCCAACTACTCAGGAGGG + Intronic
1178588026 21:33886085-33886107 GTAATACCAGCTATTCATTCAGG + Intronic
1180223061 21:46371575-46371597 GGGATTCCGACTACTCAGTCTGG - Intronic
1182244904 22:28949098-28949120 GTAATTCCAGCTACTCATGAGGG - Intronic
1183217839 22:36492635-36492657 GTAATCCCAGCTACCTACTCGGG - Intronic
1183443265 22:37835953-37835975 GTAGTTCCAGCTACTCGCTGAGG - Intronic
1183890513 22:40924086-40924108 GTAATTCCAACTAATGACTGTGG - Intronic
1184042926 22:41954884-41954906 GTAATCCCAGCTACTCACAAGGG + Intergenic
1184428345 22:44426251-44426273 GTAGTCCAAGCTACTCACTCAGG - Intergenic
950129485 3:10532141-10532163 GTAATTCAAACTCCTCACAGGGG + Intronic
950367057 3:12494519-12494541 GTAATCCCAGCTACTCACCCAGG - Intronic
950518797 3:13484080-13484102 GTAATCCTAGCTACTCACTCAGG - Intronic
951845031 3:27076350-27076372 GTAATCCCAGCTACTCAGTAGGG - Intergenic
952264791 3:31775044-31775066 GTAATCCCAGCTACTCAGTGGGG + Intronic
952315938 3:32232244-32232266 GTAGTCCCAGCTACTCACTTGGG - Intergenic
953064154 3:39454177-39454199 GTAATTCCAGCTACTCAGGAGGG - Intergenic
956758931 3:72420175-72420197 GTAGTCCCAGCTACTCACTGAGG + Intronic
957839738 3:85652896-85652918 GTAATTCCAGCTACTCAGGAGGG - Intronic
958932289 3:100220288-100220310 GTGGTCCCACCTACTCACTCAGG + Intergenic
961445207 3:126977304-126977326 CCAGTTCCACCTACTCACTCTGG + Intergenic
962579603 3:136785882-136785904 GTAATCCCAGCTACTAACTAGGG - Intergenic
962992388 3:140590072-140590094 GTAATTCCAGCTACTCAGGAGGG + Intergenic
963817331 3:149846421-149846443 GTAATTCCAGCTACTCAGGAGGG - Intronic
965808233 3:172565294-172565316 GTAATCCCAGCTACTCAGGCAGG - Intergenic
966990492 3:185225308-185225330 ATCCTTCCAGCTACTCACTCTGG + Intronic
967165966 3:186779774-186779796 GTAATCCCAGCTACTCAGGCAGG - Intergenic
967745964 3:193055382-193055404 GTAATCCCAGCTACTCACTCGGG + Intergenic
968062635 3:195737871-195737893 GTAATCCCAACTACTCAAAAGGG + Intronic
968400852 4:295987-296009 ATAATTCCTAATACTCCCTCAGG - Intronic
969955188 4:10882166-10882188 TTAATTCAAACTACTCTCCCGGG - Intergenic
970322143 4:14885528-14885550 GTAATCCCAGCTACTCAGTACGG + Intergenic
970802567 4:19991424-19991446 GTAATTCCACCTACTCAGTGAGG + Intergenic
971079350 4:23191927-23191949 ATAGTCCCAGCTACTCACTCAGG - Intergenic
971136407 4:23873071-23873093 GTAGTCCCAGCTACTCACTCAGG + Intronic
971176116 4:24284182-24284204 GTAATCCCAGCTATTTACTCAGG + Intergenic
971207015 4:24580631-24580653 GTAATCCCAGCTACTTACTCCGG - Intronic
972019217 4:34288432-34288454 GTAATCCCAACTACTCACGGAGG - Intergenic
972319836 4:37963530-37963552 GTAACCCCAGCTACTCACTGAGG + Intronic
972333821 4:38087719-38087741 GTAATTCCAACTACTCACTCGGG + Intronic
973178306 4:47235426-47235448 GTAATTCCAGCTACTCAGGAGGG + Intronic
973302242 4:48599984-48600006 GTAATCCCAGCTACTCAGTAGGG + Intronic
974042551 4:56869980-56870002 GTAGTCCCAGCTACTCACTCGGG - Intergenic
976251774 4:83059819-83059841 GCAGTCCCAGCTACTCACTCGGG - Intronic
976345543 4:83995786-83995808 TTCTTTCCAACTACTCACTTTGG - Intergenic
976386851 4:84469913-84469935 GTAATCCCAACTACTGAGGCAGG + Intergenic
976577857 4:86696774-86696796 GTAATTACAATTAGTCACTCAGG + Intronic
977214079 4:94258273-94258295 GTAATCCCAACTACTCAGGAGGG - Intronic
977484746 4:97628367-97628389 GTAGTTCAAATTATTCACTCTGG - Intronic
979727432 4:123980253-123980275 GTAATCCCAACTACTCAGGAGGG + Intergenic
980299901 4:130975946-130975968 CTAACTCCAACTCCTCACTTGGG + Intergenic
982274617 4:153626641-153626663 GTATTTCCAGCTACTCGCTGAGG + Intronic
982726334 4:158910393-158910415 GTAATCCCAACTACTCAGGAAGG - Intronic
982946558 4:161631494-161631516 GTAATTCCAGCTACTCAGGAGGG + Intronic
982980472 4:162127909-162127931 GTAATTCAAATTATTCACTAAGG + Intronic
983233415 4:165152313-165152335 CTAATCCCAGCTACTTACTCGGG - Intronic
985000257 4:185475473-185475495 CTAATCCCAGCTACTCACTCGGG + Intergenic
985110643 4:186543446-186543468 GTAGTTCCAAATACCCACTGTGG + Intronic
985399115 4:189576104-189576126 GTGATTTCAACTACTCACTTAGG + Intergenic
986318017 5:6604120-6604142 GCATTTCCAACTACTCACCCAGG + Exonic
987316776 5:16731466-16731488 GTAGTCCTAACTACTCACTCAGG - Intronic
987859462 5:23465991-23466013 GTAATCCCAACTACTCAGGAGGG + Intergenic
989521223 5:42403002-42403024 GTAATCCCAACTACTCGGGCGGG + Intergenic
989603276 5:43219845-43219867 GTAGTCCCAGCTACTCACTCGGG - Intronic
991353230 5:65740996-65741018 GTAATCCCAGTTACTTACTCAGG - Intronic
991775165 5:70077855-70077877 GTAATCCCAACTACTCACGTGGG - Intronic
992844787 5:80735564-80735586 GTAGTCCCAGCCACTCACTCTGG + Intronic
993295269 5:86130639-86130661 GTAATTCCAGCTACTCAGGAAGG - Intergenic
993991696 5:94665626-94665648 GTAGTCCCAGCTACTTACTCAGG + Intronic
995235510 5:109825435-109825457 AAAATTCCAACTTCTCAATCAGG + Intronic
996951473 5:129131319-129131341 GTAATTCCAGCTACTCAGGAGGG - Intergenic
997143954 5:131412041-131412063 GTAATTCCAGCTACTCAGGGAGG + Intergenic
997344496 5:133176896-133176918 GTAGTCCCAGCTACTCACTCAGG - Intergenic
998006760 5:138662248-138662270 ATAATTCCAACCCCTCACGCTGG - Intronic
998050552 5:139029617-139029639 GTAGTCCTAACTACTCACGCTGG - Intronic
998273809 5:140732511-140732533 GTAATCCCAGCTACTCACTCAGG - Intergenic
998600611 5:143581301-143581323 GGAACTCCAATGACTCACTCAGG - Intergenic
999187368 5:149722093-149722115 ATAGTTCCAGCTACTCACTTGGG + Intergenic
999536317 5:152521548-152521570 GTAATCCCAGCTACTCAGTGGGG - Intergenic
999709631 5:154305895-154305917 GTAATCCCAACTACTCAGGAAGG + Intronic
1001000952 5:168006533-168006555 ATAATTCCAAATACTAACTGGGG + Intronic
1002367564 5:178725101-178725123 GGAATTTCAAATAATCACTCTGG - Intronic
1003392423 6:5725338-5725360 GCAGTTCCAACTTCTTACTCTGG - Intronic
1003718912 6:8678429-8678451 GTAATCCCAGCTACTTACTCGGG + Intergenic
1004201930 6:13556494-13556516 GCAGTCCCAGCTACTCACTCGGG + Intergenic
1004389053 6:15194698-15194720 GTAATCCTAACCACTCACTCAGG - Intergenic
1004462745 6:15853740-15853762 GTAATTCCAGCTACTCAGGAGGG - Intergenic
1004637271 6:17480897-17480919 GTAATCCCAGCTACTCAGGCAGG - Intronic
1004856946 6:19760777-19760799 GTAGTCACAACTACTCACTCGGG + Intergenic
1005820864 6:29598105-29598127 GTAATTCCAGCTACTCGGTAGGG - Intronic
1005885276 6:30092665-30092687 GTAATCCCAGCTACTCAGTGAGG + Intergenic
1006275564 6:33002499-33002521 GTAATTCCAGCTACTCAGGAGGG + Intergenic
1006323384 6:33334458-33334480 GTAATCCCAGCTACTCAATCGGG + Intergenic
1006326057 6:33354916-33354938 GTAATCCCAGCTACTCACTCAGG - Intergenic
1007330509 6:41103358-41103380 ATAATTCCAACTCTTCACTATGG - Intergenic
1007341914 6:41196042-41196064 CTTATTCCAACTACAAACTCTGG - Intronic
1008388841 6:50925342-50925364 GTAATCCCAGCTACTCATTTAGG + Intergenic
1008679291 6:53855551-53855573 GAAATTCCAAAGACTCCCTCAGG - Intronic
1010014239 6:71085957-71085979 GTAAATCCTACTCATCACTCAGG + Intergenic
1010210288 6:73357578-73357600 GTAATCCCAGCTACTCAGGCAGG - Intergenic
1010294209 6:74177162-74177184 GTTATTCCAACAACTCCCTGAGG + Intergenic
1011666029 6:89634901-89634923 GTAATTCCAGCTACTCAGGAGGG - Exonic
1011753151 6:90473325-90473347 GTAATCCCAGCTACTTACTCGGG - Intergenic
1012936960 6:105378336-105378358 GTAATTCCAGCTACTCAGGGTGG + Intronic
1013104980 6:107019512-107019534 GTAATTCCATCTACTGAGGCAGG - Intergenic
1014673735 6:124339218-124339240 GTAGTCCCAGCTACTCACCCGGG + Intronic
1015812345 6:137173249-137173271 GTAATCCCAGCTACTCAGTGGGG + Intronic
1017127319 6:151078315-151078337 GTAGTCCTAGCTACTCACTCAGG + Intronic
1017291191 6:152740169-152740191 GTAATCCCAGCTACTCACTCAGG - Intergenic
1017578103 6:155828927-155828949 GTAATCCCAACTACTCACGGGGG + Intergenic
1018170017 6:161137233-161137255 GCAATTTCAACTACACCCTCTGG + Intronic
1020226525 7:6284753-6284775 GTATTCCCAGCTACTCACTCGGG - Intergenic
1020272228 7:6603877-6603899 GTAATCCCAGCTATTCATTCGGG + Intronic
1020385251 7:7593765-7593787 GTAATCCCAGCTACTCAAGCAGG + Intronic
1021159195 7:17250831-17250853 GTAGTCCCAGCTACTCACTTGGG - Intergenic
1023440478 7:40180237-40180259 GTAATTCTAGCTACTCGCTGAGG - Intronic
1023444396 7:40216729-40216751 GTAATCCCAGCTACTCACTTTGG + Intronic
1023579941 7:41670923-41670945 GTAATCCTAGCTACTCACTGGGG + Intergenic
1023625672 7:42113050-42113072 GTAATCCCAGCTACTCACTCGGG + Intronic
1024866350 7:53908189-53908211 GGAATTACAACAACTCAATCCGG + Intergenic
1026032640 7:66807698-66807720 GTGATTCTAACTCCTCACTTAGG - Intronic
1026827216 7:73591936-73591958 GTAATCCCAGCTACTCAGGCTGG - Intergenic
1026956545 7:74379820-74379842 GTAATCCCAGCTACTCGCTCGGG + Intronic
1027147288 7:75704692-75704714 GTAATTCCAGCTACTGAGACGGG - Intronic
1027191068 7:75995681-75995703 GCATTCCCAGCTACTCACTCAGG + Intergenic
1027280976 7:76609190-76609212 GTAGTCCCAGCAACTCACTCAGG + Intergenic
1027387745 7:77675550-77675572 GTAGTCACAGCTACTCACTCTGG - Intergenic
1027705335 7:81526015-81526037 GTAGTTCCACCTACACCCTCAGG + Intergenic
1028546566 7:92008564-92008586 GTAATTCCAGCTACTCATGGGGG + Intronic
1028575882 7:92349913-92349935 GTAATCCCAGCTACTCACTCAGG + Intronic
1028599496 7:92586960-92586982 CTAATGCAAACTACTGACTCTGG + Intronic
1028825130 7:95263542-95263564 GTAATCCCAGCTACTCAGGCAGG - Intronic
1028996903 7:97110828-97110850 GTAATTCCAACTACTCAGGAGGG - Intergenic
1031904410 7:127445309-127445331 GTAATCCCAACTACTCAGCGGGG - Intergenic
1032039220 7:128544889-128544911 GTAATCCCAGCTACTCACTCGGG - Intergenic
1032059304 7:128710772-128710794 GTAATCCCAACTACTCAGGGAGG - Intronic
1032462322 7:132121319-132121341 GTAATTCCAGCTACTCAGGCAGG - Intergenic
1033326205 7:140380660-140380682 GTAATCCCAGCTACTCAGGCTGG - Intronic
1033426384 7:141248288-141248310 GTAATCCCAGCTACTCAGTAGGG + Intronic
1035149669 7:156859130-156859152 GTAATCCCAGCTACTCACTAAGG + Intronic
1035576099 8:706656-706678 GTAATCCCAGCTACTCAGGCTGG + Intronic
1036092128 8:5678219-5678241 GTAATTCCAGCTACTCAGGAGGG - Intergenic
1036447883 8:8838690-8838712 GTAATTCCAGCTACTCAGGAGGG + Intronic
1036582007 8:10083901-10083923 GAAATTCAAAGTACTCACTTAGG - Intronic
1037483036 8:19322793-19322815 ATAATCCCAGCTAGTCACTCAGG - Intronic
1037828235 8:22172735-22172757 GTAGTTCCAGCTACTCACTCAGG - Intronic
1038012285 8:23484741-23484763 GTAATTCCAGCTACTCAGGAAGG - Intergenic
1038648323 8:29379864-29379886 GTAATTCCAGCTACTCAGGAGGG - Intergenic
1039085327 8:33774171-33774193 GTAATTCCAGCTACTCAGGGAGG + Intergenic
1039415636 8:37391638-37391660 GTAATTCCAGCTACTCAGAAAGG + Intergenic
1039959247 8:42233116-42233138 GTAATCCCCGCTACTCACTTAGG - Intergenic
1040767119 8:50925697-50925719 GTAATTCCAGCTACTCAGGAGGG - Intergenic
1041004277 8:53483993-53484015 CTAATTCCCACAACTCACTGGGG - Intergenic
1041114504 8:54521906-54521928 GTAGTTCCAGCTACTCAGTGGGG + Intergenic
1041757764 8:61332760-61332782 GTAATCCCAGTTACTCACTCGGG - Intronic
1041798222 8:61769758-61769780 GTAATCCCATCTACTCACTCGGG + Intergenic
1041829353 8:62135646-62135668 GCAGCTCCAACTACTGACTCTGG + Intergenic
1042131978 8:65596163-65596185 GTAATTCCAGCTACTCAGGAGGG + Intergenic
1042319319 8:67458316-67458338 GTAATTCCAGCTACTCAGGGAGG - Intronic
1044575612 8:93766237-93766259 GTAATCCCAGCTACTCGCTGAGG - Intronic
1045774503 8:105786096-105786118 GTAGTCCCAACTACTCACTGGGG + Intronic
1045999357 8:108400874-108400896 GTAATCCCAACTACTCAGGGAGG - Intronic
1046072651 8:109276778-109276800 GTAATCCCAGCTACTTACTTGGG - Intronic
1047225718 8:122954029-122954051 GTAATTCCACCTGCTCACCCAGG + Intronic
1047410634 8:124621667-124621689 GTAATCCCAGCTACTTACTCGGG - Intronic
1047952380 8:129945691-129945713 GTAATCTCAGCTACTCACTCAGG - Intronic
1048613748 8:136052011-136052033 GTATTTCCAACTGCTGACCCAGG - Intergenic
1049240826 8:141536652-141536674 ATTATCCCAACTACTCACTAAGG - Intergenic
1050076332 9:1869415-1869437 GTAACCCCAGCTACTCACTCAGG + Intergenic
1050251843 9:3753117-3753139 TTCTTTCCAACTACTCAATCTGG + Intergenic
1051622671 9:19067811-19067833 ATAATCCCAACTACTTACTTGGG - Intronic
1051688941 9:19688461-19688483 GTGATTCCAAGTAGTCACTGGGG + Intronic
1052530195 9:29673374-29673396 ATAAATCAAACTGCTCACTCTGG - Intergenic
1052949985 9:34201032-34201054 GTAATCCCAGCTACTCACTCGGG - Intronic
1054850776 9:69844621-69844643 GTAATAGCAACTACTTACTGGGG - Exonic
1055932243 9:81571536-81571558 GTAATTCCAGCTACTCGGGCAGG - Intergenic
1055976570 9:81961021-81961043 GTAATCCCAGCTACTCACTGGGG + Intergenic
1056373773 9:85986703-85986725 GTAATTCCAGCTACTCAGGAGGG - Intronic
1056503545 9:87234537-87234559 GTAATCCCAACTACTCAGGAAGG + Intergenic
1057598745 9:96438871-96438893 CTAGTGCCAACTACACACTCTGG + Intergenic
1057955547 9:99404525-99404547 GTAATTCCAGCTACTCAGGGAGG - Intergenic
1058440188 9:104999582-104999604 GTAATCCCAGCTACTCGCTCGGG - Intergenic
1058711043 9:107679437-107679459 GTAATTCCAGCTACTCAGGAGGG - Intergenic
1060117913 9:120959377-120959399 GTAATTCCAGCTACTCAGCAGGG - Intronic
1060344618 9:122805285-122805307 GTGATCTCAGCTACTCACTCGGG + Intronic
1061049138 9:128183885-128183907 GTAATTCCAGCTACTCAGGAAGG - Intronic
1061078122 9:128354062-128354084 GTAATTCCAGCTACTCAGGAGGG - Intronic
1185447043 X:263916-263938 GTAATCCCAGGTACTCACTTGGG + Intergenic
1190568419 X:51755500-51755522 GTAATCCCAGCTTATCACTCAGG - Intergenic
1192330847 X:70174133-70174155 GTAGTCCCAGCTACTCACTTTGG - Intergenic
1192424689 X:71065235-71065257 GTAATCCCAACTACTCAGGAAGG + Intronic
1193472850 X:81927782-81927804 GTAATTCCAGCTACTCAGGGAGG + Intergenic
1194486833 X:94495928-94495950 GTAGTCCCAGCTACTCACTCGGG - Intergenic
1196369938 X:114966237-114966259 GTAAGCCCAGCTACTCACTCGGG + Intergenic
1197014453 X:121606902-121606924 GTAATCCCAACTACTCAGGGAGG - Intergenic
1197104506 X:122698331-122698353 GTAATTCCAGCTACTCAGAGAGG - Intergenic
1198090158 X:133320915-133320937 GTGGTCCCAGCTACTCACTCGGG + Intronic
1201977381 Y:19866846-19866868 GTAATTCCAGCTACTCAGGAGGG + Intergenic