ID: 972335108

View in Genome Browser
Species Human (GRCh38)
Location 4:38100912-38100934
Sequence CTTGTTTGACATTTCTGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 284
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 258}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972335104_972335108 -5 Left 972335104 4:38100894-38100916 CCCCATTTGAGTAGCAGCCTTGT 0: 1
1: 0
2: 1
3: 7
4: 108
Right 972335108 4:38100912-38100934 CTTGTTTGACATTTCTGACATGG 0: 1
1: 0
2: 3
3: 22
4: 258
972335106_972335108 -7 Left 972335106 4:38100896-38100918 CCATTTGAGTAGCAGCCTTGTTT 0: 1
1: 0
2: 0
3: 13
4: 155
Right 972335108 4:38100912-38100934 CTTGTTTGACATTTCTGACATGG 0: 1
1: 0
2: 3
3: 22
4: 258
972335105_972335108 -6 Left 972335105 4:38100895-38100917 CCCATTTGAGTAGCAGCCTTGTT 0: 1
1: 0
2: 0
3: 6
4: 112
Right 972335108 4:38100912-38100934 CTTGTTTGACATTTCTGACATGG 0: 1
1: 0
2: 3
3: 22
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972335108 Original CRISPR CTTGTTTGACATTTCTGACA TGG Intronic
903994604 1:27297898-27297920 CTTCTTTGACTGTTCTGACTTGG + Intronic
904438597 1:30515308-30515330 CTTGTTTGACCTTTCTGGGCTGG - Intergenic
904592353 1:31622095-31622117 CTTATTTGGCATTTGTGACGTGG - Intronic
909578596 1:77205589-77205611 CTTGTTTCTCATTTGTTACATGG - Intronic
909864425 1:80649449-80649471 CTTGTTTGACATGGCTTATATGG - Intergenic
910406601 1:86897728-86897750 TTTTTTTGAAATTTTTGACAAGG - Intronic
911172119 1:94781109-94781131 CTTGTTTGGCCTCTCAGACATGG - Intergenic
911204941 1:95082570-95082592 TTTTTTTAACATTTCTGTCAAGG + Intergenic
912398041 1:109363893-109363915 CTTGGTTGGCATGTTTGACATGG + Intronic
912691767 1:111810080-111810102 CTTGTCTGCCATTTCTGCCCAGG + Intronic
912811285 1:112796701-112796723 CTTGCTTAACTTTTCAGACATGG + Intergenic
913595582 1:120372906-120372928 CTAGTTTAAAATTTCTGATAGGG + Intergenic
914091695 1:144506069-144506091 CTAGTTTAAAATTTCTGATAGGG - Intergenic
914306850 1:146427795-146427817 CTAGTTTAAAATTTCTGATAGGG + Intergenic
914595200 1:149145007-149145029 CTAGTTTAAAATTTCTGATAGGG - Intergenic
915686867 1:157642739-157642761 CTTGTGTGTCCTTGCTGACAAGG + Intergenic
916097560 1:161364794-161364816 CCTGTTTCACAGTTCTGACTGGG + Exonic
916153205 1:161817192-161817214 CTTGTTTGAAATTTATTAAATGG + Intronic
919531200 1:198723490-198723512 CTTTTTTGACATTTAACACAGGG - Intronic
919911541 1:202113955-202113977 CTTGAGTCACATTTCTGATAAGG + Intergenic
923838146 1:237637867-237637889 CTTGGTTGCCCTGTCTGACAAGG + Intronic
924571824 1:245243944-245243966 CTTTTTTGACTTTTGAGACAGGG + Intronic
1065064578 10:21947955-21947977 CTTCTTTGTCATTTCTGCAAAGG - Intronic
1067364485 10:45612410-45612432 CTTGTTTCTCCTTTCTGAGATGG + Intergenic
1067941806 10:50662817-50662839 CTTGTTGAACTTCTCTGACATGG - Intergenic
1068177589 10:53481924-53481946 TTCATTTGACATTCCTGACATGG + Intergenic
1068813304 10:61281016-61281038 CTAGTTAGACATTTCTGATAAGG + Intergenic
1070863053 10:79687775-79687797 CTTGTTGAACTTCTCTGACATGG - Intergenic
1071365056 10:84891003-84891025 CTTCTTTGACATTTTTGGCCTGG + Intergenic
1072499972 10:96004911-96004933 CTTGTTCAACTTCTCTGACATGG - Intronic
1072895271 10:99360893-99360915 CTTGTTTAAGCTTTCGGACACGG + Exonic
1073252245 10:102127987-102128009 CTGGTTTAAGATTTCTCACAAGG + Intergenic
1075214531 10:120520571-120520593 CTTGTTTGACAGGTGTGAAAAGG - Intronic
1075956482 10:126527546-126527568 CATTTCTGTCATTTCTGACAAGG + Intronic
1076005678 10:126946811-126946833 CTTGATGGACACTTGTGACATGG + Intronic
1077867008 11:6230724-6230746 CCTTTTTGACATCTCTGTCAAGG - Intronic
1078467503 11:11560958-11560980 CTTGGTTCACACTTCTGCCATGG + Intronic
1078834372 11:15012985-15013007 TTTGTTTCACTTTTCTGACTTGG - Intronic
1081013001 11:37839585-37839607 CTTATTTGACCTTTCTGACAAGG - Intergenic
1083750462 11:64758168-64758190 CTTGTTTATCATCTCTGGCAAGG - Intronic
1087509172 11:99068352-99068374 CTTTCTTGACACTTCTCACAGGG - Intronic
1088090935 11:106038618-106038640 TTTGATTTACATTTCTAACATGG + Intergenic
1088150994 11:106744907-106744929 CTACTTTGACATTTCTGAAAAGG + Intronic
1088987809 11:114925591-114925613 CTTGTCTGACTTGTCTGACTAGG + Intergenic
1090641351 11:128731502-128731524 TTTGTTTGTTTTTTCTGACACGG - Intronic
1090878394 11:130811936-130811958 TTGGTTTTACAATTCTGACACGG - Intergenic
1091039205 11:132261218-132261240 CTTGTTTGGAAGTTCTGGCAGGG - Intronic
1091041722 11:132287133-132287155 CTGGTTAGACAGATCTGACAAGG - Intronic
1091380386 12:54414-54436 ATTGTTTAACATGTCTGTCATGG + Intergenic
1092348511 12:7736446-7736468 ATTGGTTGACATTTCTTAGATGG + Intronic
1093835860 12:23827428-23827450 GTTGTTTGACAGTTCTGCAAAGG - Intronic
1094345937 12:29469320-29469342 TTTGTCTGACATTTTTGTCAAGG - Intronic
1094389125 12:29929861-29929883 CTTGTTGTAGATTGCTGACAAGG + Intergenic
1094810359 12:34131086-34131108 CTTTTTTGCCATTTATGACCAGG - Intergenic
1096922532 12:55102697-55102719 CTTGTTTGATAATCCTGACAAGG - Intergenic
1098091009 12:66900985-66901007 CTAATTTGACATTTCTCCCATGG + Intergenic
1098607206 12:72405702-72405724 CTTTTTTGATATTTCCGAAAGGG + Intronic
1098838584 12:75451627-75451649 CTTTTTTAACATTTCTTGCAAGG + Intergenic
1099318181 12:81110974-81110996 CTTTCTTGAAATTTCTTACAAGG - Intronic
1099410409 12:82319441-82319463 TTGGTTTAACATTTCTGAAAAGG + Intronic
1099701035 12:86082120-86082142 ATTTTGTGACATTTCTGAAAGGG - Intronic
1099810229 12:87571620-87571642 CTTATTTTACATTTGTTACAGGG + Intergenic
1100490933 12:95077247-95077269 CTCATTTGAGATTTCTGGCAGGG - Exonic
1101430922 12:104626541-104626563 CTTAATTGCCATTTCTGACTTGG + Intronic
1105815265 13:24030440-24030462 CTTATTTGACATTTCTCTGAGGG + Intronic
1106119841 13:26851119-26851141 CTTGTTGGACACATCTGACATGG + Intergenic
1106686274 13:32063360-32063382 CTGGTTTGTCGTTTCTGGCAGGG + Intronic
1106708393 13:32305525-32305547 CTTGTTAGAATTTTCTTACAAGG - Intronic
1107539307 13:41371281-41371303 GTTTTTTGACTTTTATGACATGG + Intronic
1108066265 13:46580719-46580741 CTTGCAAGACATTTCTGGCACGG + Intronic
1108132573 13:47318725-47318747 CTTGTTTGATTTTTCAGAAAAGG + Intergenic
1110871284 13:80455225-80455247 TTTGTTTGCCATTTCTAAGAGGG - Intergenic
1113809156 13:113127260-113127282 CTTGTTTTAAATTTTGGACATGG + Intronic
1115669082 14:35588364-35588386 CTTATTTGACATTTCTACAAAGG + Intronic
1116267153 14:42707273-42707295 TTTATTTGGTATTTCTGACATGG - Intergenic
1116819325 14:49612657-49612679 CTTTTCAGACTTTTCTGACAGGG + Intronic
1118025756 14:61767059-61767081 CTTGTTTTACATTTCTGCTAAGG - Intronic
1118691041 14:68340234-68340256 CTTCTTTGACATATTTGAGATGG + Intronic
1119800563 14:77441305-77441327 CTTTGTTAACAGTTCTGACAGGG + Intronic
1120097860 14:80409149-80409171 CTTGTATGACATTTGTAATAGGG + Intergenic
1120491917 14:85189102-85189124 CTTGTTTGAAAGTTCTAGCAGGG - Intergenic
1121859282 14:97301334-97301356 CTTTTATGACATTTCTGATTTGG - Intergenic
1123989562 15:25673304-25673326 CTTGTTTGAAATTTCTGCCAAGG - Intergenic
1124214215 15:27793046-27793068 CATGTTTGTAATTGCTGACAAGG + Intronic
1125102414 15:35929818-35929840 CTAATTTGAAATTTCTGAAAGGG + Intergenic
1126462311 15:48927124-48927146 CTTTCTTGACAATTCTGAGATGG - Intronic
1127765069 15:62177721-62177743 GTTGTTTGACTATTCTGATAGGG - Intergenic
1128257878 15:66211858-66211880 CTTCTGTGACTTCTCTGACAGGG - Intronic
1130123091 15:81069199-81069221 CTTGATAGGCATTTCTGGCAAGG + Intronic
1131798025 15:96040138-96040160 CTTGTCTGAATTTGCTGACAAGG - Intergenic
1133605021 16:7378485-7378507 CTTGTGTAACATTTCTGTCTTGG + Intronic
1135066435 16:19314202-19314224 CTTCTTTGGCCTTTCAGACATGG - Intronic
1137415460 16:48273881-48273903 CTTGTTTGAAAGTTGAGACAAGG - Intronic
1138883922 16:61051503-61051525 TTTATTTCACATTTCTCACAGGG + Intergenic
1139121955 16:64031035-64031057 CTTCTTTAACATTTCTTGCAAGG + Intergenic
1147555855 17:41478710-41478732 CTGTTTTGACCTTGCTGACAAGG - Intronic
1148510672 17:48166811-48166833 CATGTTAGACCTTTCTGACCTGG - Intronic
1151909688 17:77073856-77073878 CTTGTTTGACTTGGCTGAGAGGG + Intergenic
1155452805 18:25980569-25980591 CTTCTTTGACTTTGATGACATGG + Intergenic
1155468135 18:26161873-26161895 TTTGTTGGACTTTTCTGCCATGG - Intronic
1155992532 18:32293970-32293992 TTTCTTTGTCATTTCTGGCATGG - Intronic
1156950390 18:42889498-42889520 ATTTCTTGACATTTCTGTCATGG + Intronic
1158095039 18:53760937-53760959 GTTGTTTTACCTTTCTGATATGG + Intergenic
1158905688 18:62009405-62009427 CTGGTTTGACATTTTTGGCAAGG + Intergenic
1159466936 18:68795858-68795880 CTTATTTCACATTTCTGTCTAGG - Intronic
1159532721 18:69675709-69675731 AATGTTTGAAATTTCTGTCAAGG - Intronic
1159577891 18:70201970-70201992 GTTTTTTGACAATTCTGAAAAGG + Exonic
1159958154 18:74534306-74534328 CTTGTGTGTCATCTCTGAGAGGG - Intergenic
1160045159 18:75379631-75379653 CTTGTTTGGGATTTCTGGAAGGG + Intergenic
1160593357 18:79957361-79957383 CTTCTCTAACATTTCTCACAGGG - Intergenic
1163807856 19:19410842-19410864 CCTGTTTCCCATTTCTGTCAAGG + Intronic
1168395738 19:56046543-56046565 CTTGTTTTTTTTTTCTGACACGG + Intronic
1168493000 19:56826191-56826213 TTGGTGTGACATTTCAGACATGG + Intronic
925604270 2:5642261-5642283 CTAGTTTAAAATTTCTGATAGGG + Intergenic
926496968 2:13602067-13602089 ATTGTTAGAGATTTCTGACATGG + Intergenic
926886372 2:17602440-17602462 CTGCTTTGACATTTTAGACAGGG - Intronic
928027731 2:27753573-27753595 CTTGCTTGACTTCTCAGACAGGG + Intergenic
928050229 2:27985625-27985647 CTTATTTAATGTTTCTGACAGGG - Intronic
929103322 2:38338859-38338881 TTTGTCTTACATTTCTGTCATGG - Intronic
929986965 2:46743917-46743939 CTTCTTTGACTTTACTGCCAAGG - Intronic
930331367 2:49989292-49989314 CTTCTTTGATATTTTTGACATGG - Intronic
930509588 2:52327314-52327336 ATTGGTAGACATCTCTGACATGG + Intergenic
931761585 2:65422187-65422209 CTTGTTTGAAGATTCTGGCAAGG + Intronic
933155818 2:78973042-78973064 TTTGCTTTACATCTCTGACAAGG + Intergenic
934590180 2:95542631-95542653 CTTGTTTGTCCTCTTTGACAAGG + Intergenic
935087628 2:99863883-99863905 CTTCTTTGTCATTTCCAACATGG - Intronic
936342069 2:111642588-111642610 CTCATTTGATATTTCTCACAGGG + Intergenic
937313635 2:120917368-120917390 CTTGTTTGACAACTCAGACCTGG + Intronic
940026076 2:149209812-149209834 GTTCTTTTACATTTCTGTCAAGG + Intronic
940057544 2:149528749-149528771 CTGGTCTTACATTTCTAACAGGG + Intergenic
940239360 2:151546374-151546396 CCTGTATGACACTCCTGACATGG - Exonic
941524623 2:166591897-166591919 CATATTAGACATATCTGACAAGG - Intergenic
943680964 2:190767311-190767333 ATTGTTGGACATTTATGTCATGG - Intergenic
945795054 2:214352053-214352075 CTTGTTTGCCCCTTCTGCCATGG - Intronic
945862911 2:215144301-215144323 GTGATTTGACATTTCTCACATGG - Intergenic
945917458 2:215719088-215719110 CTTGGTTGACATTTGGGAAATGG - Intergenic
947050183 2:226032911-226032933 CTTGTTTTACATTTATGGCTAGG + Intergenic
947066574 2:226233177-226233199 CTGAATTGACATTTCTGATACGG + Intergenic
947858065 2:233337951-233337973 CTGGAATGACATTTCTGTCAAGG + Intronic
948150222 2:235739046-235739068 CTTATTTGAAATTTCTGCCAAGG - Intronic
1170731872 20:18983092-18983114 CAAGTTTGACATTTGTGAAAAGG - Intergenic
1171047483 20:21824288-21824310 CTTGTATGACATCACTGACAGGG + Intergenic
1171235700 20:23522726-23522748 CTTCTTTCACATTTTTGAGATGG - Intergenic
1171888010 20:30675041-30675063 CTTTTTAGACATTTGTGTCATGG - Intergenic
1173138611 20:40462038-40462060 CTTTTTTGATCTTTCAGACAAGG - Intergenic
1173338593 20:42134329-42134351 CTTGTTTGATATTCAAGACAAGG + Intronic
1174068558 20:47883520-47883542 CTTCCTTGTCATTTCTGAGATGG + Intergenic
1174561423 20:51433145-51433167 CATCTATGACATTTCTGACGGGG - Intronic
1174739877 20:53002188-53002210 CCTCTTTGTCATTTCTAACATGG - Intronic
1178282936 21:31299338-31299360 CTTCCATGACATTTCTGAGAAGG + Intronic
1179834390 21:44019997-44020019 CTTTTTGGACATTTGTTACATGG + Intronic
1182225432 22:28794250-28794272 CTTGTTTAACATTTATAAGATGG + Intergenic
1183886120 22:40883926-40883948 TTTGTTTGATTTTTCTTACATGG + Intronic
951079256 3:18431779-18431801 CTTGTTTCAAATTTCTAAAAAGG + Intronic
951967475 3:28403039-28403061 CTTGTCTGACTGTTCTGACTAGG - Intronic
955760139 3:62271362-62271384 CTTTTTTCACTTTTCTCACAGGG + Exonic
956561336 3:70579172-70579194 CTTTTTTTAAATTTCTGAGACGG + Intergenic
958191199 3:90187097-90187119 CTTGTTTGAAATTTATCACATGG - Intergenic
958413394 3:93846217-93846239 CTTGTTTGAAATTTATCACATGG - Intergenic
958829447 3:99069402-99069424 CTTATTTGGCATTTCTGGCAGGG + Intergenic
959001387 3:100968223-100968245 CATATTTGAAATTTCTGAAATGG - Intronic
960867404 3:122215825-122215847 CTTGTTGGTCACTTCTGACATGG - Intronic
963371805 3:144410888-144410910 CTTGCTTAACTTCTCTGACAAGG + Intergenic
964610246 3:158606255-158606277 GTTGTTTAATATTTCTGTCAAGG + Exonic
964735648 3:159914375-159914397 CCTGATTGACAGTTCTGGCAAGG - Intergenic
965055651 3:163710714-163710736 CTTGTTGGAGATTTGTGAAAAGG - Intergenic
970613741 4:17748389-17748411 CTTGATTCCCACTTCTGACAGGG - Intronic
971459856 4:26883148-26883170 CTTGTGTGTCTTTTCTGCCATGG + Intronic
972335108 4:38100912-38100934 CTTGTTTGACATTTCTGACATGG + Intronic
974614285 4:64262051-64262073 CTTGTTTGAAATTTCTTCTATGG - Intergenic
975490853 4:74986775-74986797 CTTGTCTGAACTTTCTGCCATGG - Intronic
975618589 4:76272918-76272940 CTCTTTTGACATTTCTTCCAGGG + Intronic
977812172 4:101368968-101368990 CTTCTTTGACATTTCTTGAAAGG - Intergenic
978847853 4:113295482-113295504 CTTGTATCTGATTTCTGACAAGG - Intronic
979114204 4:116800396-116800418 CATTTTTGTCATTTCAGACAGGG + Intergenic
981378767 4:144046972-144046994 TTTGTTATACACTTCTGACACGG + Intergenic
981599886 4:146475072-146475094 ATTTTTTGACATTTCTGCCAAGG + Intronic
981864254 4:149395970-149395992 CTTGTTTTAAATTTGTGGCATGG - Intergenic
982103935 4:151995145-151995167 CTGGTTTGAAATTTCTAACCAGG + Intergenic
982382921 4:154769206-154769228 ATTTTGTGACATTCCTGACAGGG + Intergenic
984194596 4:176643191-176643213 CATGTTTGAATTCTCTGACAAGG + Intergenic
984982342 4:185294531-185294553 CTTGTTTGGCATTTCTAAGCTGG + Intronic
986660018 5:10051393-10051415 CTTGTTTGATTTTTGTGAAAAGG - Intergenic
991042225 5:62188111-62188133 ATGGAGTGACATTTCTGACAGGG - Intergenic
992856250 5:80864373-80864395 CTTTTTTGTCTTTTATGACATGG - Intronic
993160056 5:84278818-84278840 TCTCTTTGATATTTCTGACATGG + Intronic
994610471 5:102031619-102031641 TATTTTTGAGATTTCTGACAAGG + Intergenic
994747615 5:103698204-103698226 TTTCTTTGTCATATCTGACATGG - Intergenic
994886833 5:105574746-105574768 TTTGTTTGAATTTTCTGTCAGGG + Intergenic
994985237 5:106924941-106924963 TTTTTTAGACATTTCTGTCAGGG - Intergenic
995045491 5:107641966-107641988 CTTTTTTGACAGTTTTGACTGGG - Intronic
996199997 5:120660577-120660599 CTTGTTTGACATATTTGCCTAGG + Intronic
996356964 5:122605845-122605867 CTTGTTTAACAGTTCTGGCTGGG - Intergenic
997482500 5:134198068-134198090 TTTGTTTGAAATTTCAGTCAAGG - Intronic
1000562121 5:162802443-162802465 CTTTTTTGAGATTTCTGCTATGG - Intergenic
1001270149 5:170304966-170304988 TGTGTCTGACATATCTGACATGG + Intergenic
1002082297 5:176744262-176744284 TTTCTTGCACATTTCTGACACGG - Intergenic
1002609482 5:180405423-180405445 CTTCTTTAACATTTCTTGCAAGG - Intergenic
1003728052 6:8789264-8789286 CATCTTTGACGTTTCTAACAAGG + Intergenic
1003765446 6:9231318-9231340 CTTGTTTAACATTTCACAAATGG - Intergenic
1008020332 6:46569849-46569871 CTTGTCTGACTTTTGTGTCAGGG + Intronic
1008459339 6:51750066-51750088 CTAGTTTCTCATTTCTGAAAAGG - Intronic
1008489024 6:52065988-52066010 CTTTTTTGACAATTCTGCCCAGG - Exonic
1008973908 6:57402014-57402036 CTGGTTTGATATATCTGGCAGGG + Intronic
1009352019 6:62691974-62691996 CACGTGTGTCATTTCTGACATGG - Intergenic
1009537303 6:64904836-64904858 TAAGTTTGACATTTCTGAGATGG + Intronic
1009775397 6:68199103-68199125 CTTCTTTGACATTTCTGACTGGG - Intergenic
1010886297 6:81246339-81246361 CTTCTTTGACATTTCTTGTAGGG + Intergenic
1011695410 6:89908049-89908071 CTTTTTTAACATTTCTTACAAGG + Intergenic
1012658425 6:101855520-101855542 ATTGATTGATTTTTCTGACAGGG - Intronic
1016429838 6:143971662-143971684 TTTGTTTGCCTTTTCTGATAAGG + Intronic
1017379090 6:153806640-153806662 CTTCTCTGAAATTTCTAACATGG - Intergenic
1017736145 6:157366470-157366492 CTTTTTGGACATTCCTGACTTGG - Intergenic
1018115184 6:160576751-160576773 TTTGTTTGCCATTTTTGTCATGG - Intronic
1019019855 6:168909526-168909548 CATGTCTGAAATGTCTGACATGG + Intergenic
1020435363 7:8156768-8156790 CTTGTTTGACATTGCTAAAGGGG - Intronic
1021083903 7:16396979-16397001 CATGTGTGACATGACTGACATGG + Intronic
1021320356 7:19202540-19202562 CTTGTTTTAAATTTCTCAAAAGG + Intergenic
1021733299 7:23618319-23618341 CATGGTTGTCCTTTCTGACATGG + Intronic
1022439473 7:30421539-30421561 CCTTTATGACATTACTGACAAGG + Intergenic
1022642597 7:32202434-32202456 CTTGTATGACATCCCTGTCATGG - Intronic
1023432912 7:40113290-40113312 CTTCTATAACATTTCTGACCAGG + Intergenic
1023754616 7:43404970-43404992 TTTGTTTGATTTTTTTGACATGG - Intronic
1024446510 7:49485543-49485565 TTTGTTTGCCATTTGTTACATGG + Intergenic
1024722093 7:52148772-52148794 ATTTTTTGACATTTTTGAAATGG + Intergenic
1027338920 7:77184706-77184728 CTTGTTTGCCCTTTCTGTCATGG + Intronic
1027688064 7:81302997-81303019 TTTGTTTCACATTTTTGAAATGG + Intergenic
1027887068 7:83922124-83922146 CATCTTTGAAATTTCTGGCAAGG - Intergenic
1027986134 7:85293021-85293043 CTTGTTTTTCATTTGTGAAAAGG - Intergenic
1028295110 7:89119772-89119794 CTTGTTTGATAATCCTGGCATGG + Intronic
1029130613 7:98327719-98327741 CTTGTTTAGCATTTCTGATGTGG + Intronic
1030436864 7:109532963-109532985 CTTGTCTAACAATTCTGACTAGG - Intergenic
1032532575 7:132634374-132634396 CTTCTTTGGCCTCTCTGACATGG + Intronic
1037419899 8:18690833-18690855 CTTATTGGACCTTTCTGAGAAGG - Intronic
1040501541 8:48009183-48009205 CGTTTTTAACATTTCTGAAATGG - Intronic
1040640663 8:49330419-49330441 CTTGTTTGGCGTTTCTATCAGGG - Intergenic
1042381153 8:68115455-68115477 TTTGTTTGACACTTGTGAAATGG - Intronic
1042459434 8:69046089-69046111 CTGCTTTGAGATTTCTGATAAGG - Intergenic
1042817399 8:72892438-72892460 CTTTTTTCCCATTTTTGACATGG + Intronic
1043046925 8:75337991-75338013 TTCTTTTGACATTTCTTACAAGG + Intergenic
1044700110 8:94957999-94958021 CTTCTTCGGCCTTTCTGACATGG + Intronic
1045401454 8:101822909-101822931 TTTGTTTGACATACCTAACATGG + Intronic
1046681625 8:117177057-117177079 CTTGATTGACACTTCTGAAAGGG - Intergenic
1047365516 8:124207810-124207832 CTTGATTTACTTTTCTGGCAGGG + Intergenic
1048610338 8:136015318-136015340 CTTTTTGGACATTTCTCAGAAGG + Intergenic
1049979464 9:891036-891058 CTTGTTTCACTTTTCTAAAAAGG - Intronic
1050819675 9:9862524-9862546 CCTGTTTTAATTTTCTGACATGG + Intronic
1053398060 9:37792839-37792861 TAAGTTTGACATTTCTGACCGGG - Intronic
1054812944 9:69449174-69449196 CATTTCTGACATTTTTGACAGGG + Intronic
1056087380 9:83164121-83164143 CTTCTTTTACATTTCTTAAAAGG - Intergenic
1056689598 9:88795972-88795994 CTTCTTTAACTTTTCTTACAGGG - Intergenic
1056700703 9:88904196-88904218 CTTCTTTAACATTTCTTGCAAGG + Intergenic
1056720922 9:89071147-89071169 CTTGTTGGGAATTTCTGAGAAGG - Intronic
1058388569 9:104467756-104467778 ATTGTCTTCCATTTCTGACATGG + Intergenic
1058425727 9:104874233-104874255 CCTGTTTGGCCTTTCTGATATGG - Intronic
1059802944 9:117769268-117769290 CCTGTTTGGCAATTCTAACAAGG + Intergenic
1059870075 9:118563123-118563145 CTTGTTTCTCATTTTTGAAAGGG - Intergenic
1188805290 X:34580639-34580661 CTTATTTCACATTTGTGACTAGG - Intergenic
1189219450 X:39358650-39358672 CGTGTTTGACATTTGTTTCAAGG + Intergenic
1190054237 X:47172652-47172674 CCAGTTTGACATTTATGTCATGG + Intronic
1191195436 X:57716562-57716584 CTTGTCTTACTTTTCTGACCAGG + Intergenic
1191634901 X:63364882-63364904 CTTCCTTTACATTTCTGACTGGG - Intergenic
1192344110 X:70287239-70287261 CTTTTTTCACTTTCCTGACAGGG - Intronic
1192715194 X:73633173-73633195 CTCGTTTAGCATTTCTTACAAGG + Intronic
1193046677 X:77061371-77061393 GTTGTCTCAGATTTCTGACAGGG - Intergenic
1193379560 X:80802803-80802825 CCTGCTTGACATTTCTTACATGG - Intronic
1193834974 X:86331361-86331383 CTTGGATAACATTTCAGACAAGG + Intronic
1194010586 X:88555776-88555798 CTTGTTTAACACTAGTGACATGG - Intergenic
1194249257 X:91553420-91553442 CTTGTTTGACATAGCTAACAAGG + Intergenic
1194284851 X:91997215-91997237 CTTGTTTAATTTTTCTGGCAGGG + Intronic
1194403269 X:93463364-93463386 CTCCTTGGACATTTTTGACAGGG + Intergenic
1196429392 X:115606595-115606617 CATGTTTTAGATTTCTGAGATGG + Intronic
1199238876 X:145523850-145523872 CTGGAGTGACATTTCTAACATGG - Intergenic
1199254764 X:145706561-145706583 CTTGTGTGCAATTTCTGGCACGG - Intergenic
1199379637 X:147155197-147155219 CTGGTTTCTCATTTCTCACAAGG - Intergenic
1199391825 X:147289069-147289091 CATCTTTGACTTTTCTGAAATGG + Intergenic
1200568213 Y:4794650-4794672 CTTGTTTGACATAGCTAACAAGG + Intergenic
1200602417 Y:5221781-5221803 CTTGTTTAATTTTTCTGGCAGGG + Intronic
1200864728 Y:8031170-8031192 CTTATGTGACATTTTTGACAGGG + Intergenic
1201756278 Y:17489289-17489311 CTTTTTTGCCATTTTTGACCAGG - Intergenic
1201845274 Y:18416696-18416718 CTTTTTTGCCATTTTTGACCAGG + Intergenic
1202240127 Y:22758555-22758577 TATATTTGACATTTCAGACAAGG - Intergenic
1202393113 Y:24392313-24392335 TATATTTGACATTTCAGACAAGG - Intergenic
1202477672 Y:25277803-25277825 TATATTTGACATTTCAGACAAGG + Intergenic