ID: 972336363

View in Genome Browser
Species Human (GRCh38)
Location 4:38110294-38110316
Sequence GGTCAAGAATGGTGACCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 130}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972336363_972336369 15 Left 972336363 4:38110294-38110316 CCCTGAGGTCACCATTCTTGACC 0: 1
1: 0
2: 1
3: 12
4: 130
Right 972336369 4:38110332-38110354 TTCTGATGCCTGGGATGTGCAGG 0: 1
1: 0
2: 0
3: 24
4: 255
972336363_972336368 6 Left 972336363 4:38110294-38110316 CCCTGAGGTCACCATTCTTGACC 0: 1
1: 0
2: 1
3: 12
4: 130
Right 972336368 4:38110323-38110345 TTATTGAGTTTCTGATGCCTGGG 0: 1
1: 0
2: 0
3: 19
4: 217
972336363_972336367 5 Left 972336363 4:38110294-38110316 CCCTGAGGTCACCATTCTTGACC 0: 1
1: 0
2: 1
3: 12
4: 130
Right 972336367 4:38110322-38110344 CTTATTGAGTTTCTGATGCCTGG 0: 1
1: 1
2: 2
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972336363 Original CRISPR GGTCAAGAATGGTGACCTCA GGG (reversed) Intronic
901301170 1:8200913-8200935 GGTCAGGAGTGCTGACTTCATGG + Intergenic
902429324 1:16351105-16351127 GCTTAAGAATGATGACATCATGG - Intronic
904657508 1:32060335-32060357 GGCCCAGAATGGAGTCCTCAGGG + Intronic
905805518 1:40874237-40874259 GGTCATGCAGGGTGACCTCCTGG - Intergenic
906434230 1:45781354-45781376 GGTGAAAAAGGGTAACCTCAAGG + Intergenic
907381592 1:54095371-54095393 GGTCAAGAGTGGAGTGCTCAGGG + Intronic
911132101 1:94399489-94399511 GGTCAATACTGGTTACCTCTGGG - Intergenic
914693529 1:150053941-150053963 GGTGAAAAAGGGTAACCTCAAGG + Intergenic
918879786 1:190102486-190102508 GGCTAAGAATTGTGACCACATGG + Intronic
920827313 1:209434060-209434082 GGCCAACAATGGTGACCAGAGGG + Intergenic
922867107 1:228869445-228869467 GGACAAGAATGGAGACATCCTGG - Intergenic
923687780 1:236165459-236165481 GGGCTAGAATGGTGAACTCCAGG + Intronic
1063113508 10:3056503-3056525 GAAATAGAATGGTGACCTCAGGG + Intergenic
1063189880 10:3683499-3683521 GGCCAAGGATGGTGACTTGATGG + Intergenic
1064237770 10:13592224-13592246 GGTGAAAAAGGGTCACCTCAAGG - Intronic
1069616796 10:69811416-69811438 GGTCAGAAAGGGTGACCTCTCGG + Intronic
1069651216 10:70051235-70051257 GGTGAAGAATGGACACCTGAAGG + Intergenic
1070760476 10:79021314-79021336 GGTCAAGAGTGGAGGTCTCAGGG - Intergenic
1073519199 10:104110535-104110557 GGTCAAGCATGGGGACGTCATGG + Intergenic
1073896668 10:108168406-108168428 GTTCAAGACTGCTGGCCTCATGG - Intergenic
1076013160 10:127006612-127006634 GGTGATGACTGGTGACGTCAAGG + Intronic
1079374477 11:19879870-19879892 GATCAGGAATGGAAACCTCAAGG + Exonic
1079392943 11:20037996-20038018 AGTCAAAAATGGAAACCTCATGG - Intronic
1081938309 11:46919334-46919356 GGTCAGGAAAGGAGTCCTCATGG + Intergenic
1085478862 11:76805575-76805597 TCTAAAGAAGGGTGACCTCAAGG + Intergenic
1085817338 11:79753520-79753542 GCTAAAAAATGCTGACCTCATGG + Intergenic
1088112374 11:106277409-106277431 GGTCAAGAATGGGGATCTCCAGG + Intergenic
1088316938 11:108517107-108517129 TGTTAAGAATGGTTACCTCTAGG - Intronic
1089966816 11:122660111-122660133 GCTCAAGCAGGGTGACCTCAGGG + Intronic
1090727905 11:129544105-129544127 GGGCAAAAATGTTGCCCTCAAGG - Intergenic
1091573987 12:1715300-1715322 GGTCAAAAATGGCCACCTGAGGG - Intronic
1097060848 12:56282539-56282561 TGTCCAGCATGGTGACCACATGG + Exonic
1097773869 12:63623041-63623063 GGTGAAGAATGGGGTCCTCTGGG + Intronic
1097918810 12:65049268-65049290 GGCCAATAATTGTGACTTCACGG - Intergenic
1099541211 12:83910173-83910195 AGTCAGTAGTGGTGACCTCAAGG - Intergenic
1102234931 12:111288461-111288483 GATCAAGAGTGTGGACCTCAAGG - Intronic
1112710213 13:102119088-102119110 TATCAATAATAGTGACCTCATGG + Intronic
1114928915 14:27442729-27442751 GCTCATGAATGGTGATCACATGG - Intergenic
1116501060 14:45622588-45622610 GGTCAAGAAAGGTGTCATAAAGG + Intergenic
1117734774 14:58757330-58757352 GGTTAAGAATGGTGGCCTCAGGG + Intergenic
1119272980 14:73326058-73326080 GGTCAAGAAAGGGGAGCTCCAGG + Intronic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1121701813 14:95960581-95960603 GGTGGAGAATGGAGAGCTCAGGG + Intergenic
1125040584 15:35181414-35181436 GGGCAAGAATAGTGAACACAGGG - Intergenic
1127960287 15:63885472-63885494 GCTCTAGAATGATAACCTCAAGG - Intergenic
1134287471 16:12874627-12874649 GGACATGAATGTTGAGCTCATGG - Intergenic
1135287483 16:21206639-21206661 GGACAATAATGCTTACCTCAGGG - Intronic
1135524999 16:23207413-23207435 GGCAAGGAATTGTGACCTCAAGG + Intronic
1135878764 16:26231446-26231468 CATCAAGGAGGGTGACCTCAGGG + Intergenic
1137264262 16:46855880-46855902 CTCCAAGAATGGTGAACTCAAGG + Intergenic
1142041515 16:87897383-87897405 ATTCCAGAATGGAGACCTCAAGG - Intronic
1143411250 17:6710608-6710630 GGTCAAGCCTGTTGACTTCAGGG - Intronic
1147647632 17:42043362-42043384 GAGCAAGAATGGTGCCCCCAGGG - Intronic
1151397372 17:73832611-73832633 GGTCAAGAGTGGAGGCTTCATGG - Intergenic
1152413412 17:80143114-80143136 GGGAAAGAATGCTGACCTCATGG + Intronic
1155677276 18:28444806-28444828 GGTCAATAATTGTGACACCATGG - Intergenic
1155858338 18:30864078-30864100 GGTCAAGAATGGTCTTCTCTAGG - Intergenic
1162652637 19:12102317-12102339 GGTTTAGAATGGGGCCCTCATGG + Intronic
1162942273 19:14018184-14018206 GGTCTTGAATCCTGACCTCAGGG - Intergenic
1163562901 19:18031075-18031097 TGTCCAGCATGGTGACCACATGG - Intergenic
1166985370 19:46657102-46657124 TGACAATGATGGTGACCTCAGGG + Intronic
926958147 2:18324277-18324299 GGTCAAAAATAGTGACACCATGG - Intronic
931285708 2:60829922-60829944 GGTCAAGGATGGTTTCCCCAAGG + Intergenic
934619392 2:95794757-95794779 GGTCAAGAGTGGAGACCAGAAGG + Intergenic
934641500 2:96029800-96029822 GGTCAAGAGTGGAGACCAGAAGG - Intronic
939801926 2:146721113-146721135 AGTGAAGAATGTTGACCTTATGG + Intergenic
942022096 2:171876001-171876023 AGTCAAGAATGTTGACATCTTGG - Intronic
945105299 2:206306478-206306500 GGAGAAGAATGCTGACCTTATGG + Exonic
945670500 2:212796497-212796519 GGTCAAGACTTCTGACCTCATGG - Intergenic
945992252 2:216405859-216405881 GGTCAGGAAAGGTGTCCCCAGGG - Intergenic
947481118 2:230500906-230500928 GTGGAAGAATGGAGACCTCAAGG - Intronic
948078003 2:235181532-235181554 GGTTAGGAATGGTGCCCTCATGG + Intergenic
1170964542 20:21054564-21054586 GGCCAAGATTGGTAACCTCAAGG - Intergenic
1172082575 20:32353911-32353933 TGTCAATAATGGTTACCTCTGGG - Intergenic
1173161153 20:40653416-40653438 GGAAAAGAATGGAGACCTCAAGG - Intergenic
1173800331 20:45891042-45891064 GGGCAATGATGGTGACCGCAAGG + Exonic
1174445982 20:50591624-50591646 GTTCAGGAAGGGTGACATCAAGG - Intronic
1174506054 20:51018302-51018324 GGATAAGATTGCTGACCTCACGG + Intronic
1175520315 20:59598583-59598605 GGCCATGAATGGTGAAATCAGGG + Intronic
1176144055 20:63557666-63557688 AGTCAAGGCTGGTGGCCTCAGGG + Intergenic
1176902110 21:14454776-14454798 AGTCAAGAATGATTACCTAAAGG + Intergenic
1177158566 21:17523363-17523385 GATCAAGAATAGGTACCTCATGG + Intronic
1178130045 21:29561970-29561992 AGTCAAGATTGATGATCTCAAGG + Intronic
1180680357 22:17621692-17621714 GAGAAAGAATGGTGAGCTCAAGG - Intronic
955600870 3:60643674-60643696 AGTCAAGAATGATCACCTTAGGG + Intronic
959521676 3:107328728-107328750 TGTCCAGCATGGTGACCACATGG + Intergenic
960541386 3:118865848-118865870 GGCCTGGAATGGGGACCTCATGG + Intergenic
960844979 3:121996821-121996843 GGTAAGGAATGGTGACCAAAGGG - Intronic
961392239 3:126558962-126558984 TGTCACCAATTGTGACCTCAAGG - Exonic
966847876 3:184144566-184144588 GGCCAATAAAGGGGACCTCAGGG - Intronic
971668383 4:29523394-29523416 TTTCAAGAATGATGACCTTAGGG + Intergenic
972336363 4:38110294-38110316 GGTCAAGAATGGTGACCTCAGGG - Intronic
975683036 4:76895914-76895936 AGCCAAACATGGTGACCTCAGGG - Exonic
975765738 4:77665854-77665876 GGACTATAATGCTGACCTCATGG + Intergenic
980198161 4:129618601-129618623 GGTCAAGAATGGGGAAGCCATGG - Intergenic
981721254 4:147803634-147803656 GGCCAATAAAGTTGACCTCATGG - Intronic
984427464 4:179606107-179606129 CATCCATAATGGTGACCTCAGGG - Intergenic
985511365 5:315932-315954 GGACAAGGAAGTTGACCTCATGG - Intronic
985958962 5:3285326-3285348 GGTCAAGACTTGGGATCTCATGG - Intergenic
992434542 5:76742686-76742708 GCTGAAAAATGGTGACCTCAGGG + Intergenic
999429240 5:151511914-151511936 GGATATGAATGGGGACCTCAGGG - Intronic
1000872964 5:166600146-166600168 GGACAAGAATGATGACCACTAGG - Intergenic
1001106654 5:168860414-168860436 GGTGAGGAATGGTGGCCTAATGG + Intronic
1003988568 6:11462741-11462763 GGTTCAGCAGGGTGACCTCAGGG + Intergenic
1004945860 6:20611955-20611977 GGCTAAAAATGTTGACCTCATGG - Intronic
1009744808 6:67798799-67798821 GGTCTGGAATGGGGGCCTCAGGG - Intergenic
1013351840 6:109312892-109312914 GGCCAAGCATGGTGACATGAAGG - Intergenic
1018090415 6:160342050-160342072 GGTGAAGATTGGTCACATCAGGG + Intergenic
1019183498 6:170207711-170207733 GGTCAGGAATGCTGGTCTCAGGG - Intergenic
1020428150 7:8092835-8092857 GGCTAAAAATGGTGACATCAAGG + Intronic
1021490907 7:21219329-21219351 GGTAAAGGATGGTTACTTCAAGG - Intergenic
1022364437 7:29698021-29698043 GGTGAAGAATGGGGTCCTCTGGG - Intergenic
1022696922 7:32715717-32715739 GGTGAAGAATGGGGTCCTCTGGG + Intergenic
1022933441 7:35146793-35146815 GGTGAAGAATGGGGTCCTCTGGG + Intergenic
1023914417 7:44577962-44577984 TGTCAAGAATGGGGAACTAATGG + Exonic
1024228599 7:47346947-47346969 GGTCAAGAGTGGGGACCCCAGGG - Intronic
1028204156 7:87997027-87997049 CTTCAAGACAGGTGACCTCATGG - Intronic
1029573729 7:101389020-101389042 GGTGAAAAACGGTCACCTCAAGG - Intronic
1029829370 7:103239565-103239587 GGTGAAGAATGGGGTCCTCTGGG + Intergenic
1032582893 7:133119631-133119653 GATTCTGAATGGTGACCTCATGG + Intergenic
1033020763 7:137722064-137722086 GGTGAAAAAGGGTAACCTCAAGG + Intronic
1033314109 7:140283538-140283560 GGTCAAGGAGGGTGACTTCATGG + Intergenic
1035937127 8:3853087-3853109 GATCAAGAATGATGAGGTCAGGG - Intronic
1038374221 8:27022233-27022255 GTCTAAGAATGGTGACCCCAAGG - Intergenic
1038862140 8:31399337-31399359 GGTATAGAAGAGTGACCTCATGG + Intergenic
1045051884 8:98334914-98334936 AGTCAAGGATGGTGTCCTAAGGG - Intergenic
1046827092 8:118703326-118703348 GGTGAAAAATGTCGACCTCAAGG - Intergenic
1047658749 8:127009154-127009176 GCCCAAGAATGGAGACCACAAGG + Intergenic
1048293962 8:133200700-133200722 GGCCATCAATGCTGACCTCATGG + Intronic
1050913910 9:11107767-11107789 GGCCTAGAATGGGGGCCTCACGG - Intergenic
1055148504 9:72965463-72965485 GGTCAAGACTAGTTACCTCCTGG - Intronic
1055172306 9:73273699-73273721 AGTCAAGAAAGGTGTCCTCATGG - Intergenic
1057298272 9:93861762-93861784 GGGCAAGAAAGGGGACATCAGGG - Intergenic
1059612239 9:115911103-115911125 ACTCCAGAATGCTGACCTCAGGG - Intergenic
1060914983 9:127382948-127382970 GGTCAAGAAGGGACACCTGACGG - Intronic
1186875958 X:13818077-13818099 GGTTGAGAATGTTGGCCTCATGG - Intronic
1186967629 X:14805156-14805178 AGTCAGGAATGGTGGGCTCAGGG - Intergenic
1188897408 X:35686308-35686330 GGCCTGGAATGGTGGCCTCACGG - Intergenic
1196598572 X:117574109-117574131 GTTCAACATTGGTTACCTCACGG - Intergenic
1196927235 X:120645604-120645626 GCTCAACAATTGTCACCTCAAGG - Intergenic
1197701749 X:129605022-129605044 CACCAAGAATGGAGACCTCAGGG + Intergenic
1199569960 X:149257266-149257288 GGTCAAGAACTGGGTCCTCAAGG + Intergenic
1199660664 X:150047053-150047075 GGAAAAGAATGGTGTTCTCAGGG + Intergenic
1200169434 X:154061657-154061679 GGTCATCACTGGAGACCTCATGG + Intronic