ID: 972338146

View in Genome Browser
Species Human (GRCh38)
Location 4:38127140-38127162
Sequence GGAGGTAAACAATGTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972338146 Original CRISPR GGAGGTAAACAATGTCAGCT GGG (reversed) Intronic
901501507 1:9655252-9655274 GGAGGAAAATATTGTCATCTTGG + Intronic
903460680 1:23518606-23518628 GGAGGTTGGCAACGTCAGCTGGG + Intronic
904578903 1:31525006-31525028 GGAGGGAAACAAATTCAGTTTGG + Intergenic
906059838 1:42941339-42941361 GGAGGTCAACAAGGTAAGGTAGG - Intronic
906471590 1:46135184-46135206 AAAGGTAAAAAATGTTAGCTCGG + Intronic
908479598 1:64525389-64525411 GGAGGAAAAGAATGTCTGATAGG - Intronic
908842241 1:68291815-68291837 GGAGGTAAAAAGTGTTAACTGGG + Intergenic
909888662 1:80974618-80974640 GGAGGGAAAAAATATCAGTTTGG + Intergenic
915387391 1:155507924-155507946 GGAGGTACACAAAGGCATCTTGG - Intronic
916049799 1:161028269-161028291 GAAAGTAAAAAATGTCGGCTGGG - Intronic
917228454 1:172809866-172809888 GCTGATAAACAATGTCAGCAAGG - Intergenic
917255234 1:173108759-173108781 GGAGGACCTCAATGTCAGCTGGG + Intergenic
923416728 1:233769834-233769856 GTAGGTACACAAAGCCAGCTGGG - Intergenic
1063044536 10:2378327-2378349 GGAGTTTCACCATGTCAGCTAGG - Intergenic
1063085492 10:2814304-2814326 AGAGGTAAACAAGGTGATCTGGG - Intergenic
1067772211 10:49135016-49135038 GGAGCTAAACAGGGTCAGCGTGG - Intergenic
1071007229 10:80896698-80896720 GGACTTAAACAATGTTAGTTTGG - Intergenic
1071178520 10:82955851-82955873 GGAGGTAAACAATACCAGAATGG - Intronic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1073581059 10:104665941-104665963 GGATGTAGACACTGTCTGCTTGG + Intronic
1073616629 10:105003058-105003080 GGAAGTAAACCCTGACAGCTGGG + Intronic
1074085506 10:110206813-110206835 GCAGTGAAACAATGTCAGCTGGG + Intergenic
1074412729 10:113242324-113242346 AGAGGTGAAAAATGTCACCTGGG + Intergenic
1075979344 10:126723438-126723460 GGAGGAAAGCCATGTGAGCTGGG - Intergenic
1084565888 11:69928551-69928573 GAAGGCAAACAATGTCTCCTGGG - Intergenic
1086933447 11:92718681-92718703 GGAGGAGAACAATGTATGCTTGG - Intronic
1088173593 11:107024280-107024302 GGAGGGAAACACAGTCACCTGGG - Intergenic
1093471125 12:19503286-19503308 GGAGGTAAACAATCTCTACAAGG - Intronic
1094163065 12:27412196-27412218 GGAGCTAAACATTGACAACTGGG + Intronic
1097732877 12:63150239-63150261 CGAGGTGAACAATGTCACCAAGG - Exonic
1099444967 12:82741633-82741655 GCAGGTAAAGAAGGTCAGATTGG - Intronic
1100081519 12:90857821-90857843 CAAGGTAAACCATGTCACCTTGG - Intergenic
1104744223 12:131201041-131201063 GGGGTCAAATAATGTCAGCTGGG - Intergenic
1104790156 12:131476182-131476204 GGGGTCAAATAATGTCAGCTGGG + Intergenic
1105019136 12:132804818-132804840 GGAGGCAAAAAATGCCAGCCTGG - Exonic
1106911139 13:34464846-34464868 TGAGGTAGATAATGTCAGCTGGG + Intergenic
1107803226 13:44130366-44130388 GTTGGGAAACAATGTCAGATAGG + Intergenic
1109488416 13:63059356-63059378 GGAGGTAATAAATGTGAACTGGG + Intergenic
1110657625 13:78019013-78019035 GGAGGTAGACAAGGTCAGGGTGG + Intergenic
1110657631 13:78019035-78019057 GGAGGTAGACAAGGTCAGGGTGG + Intergenic
1112018139 13:95348515-95348537 GGAGGAAAACTTGGTCAGCTGGG - Intergenic
1113366685 13:109683046-109683068 GGAGGTAAAAAAGGTGAGCATGG - Intergenic
1113828373 13:113274519-113274541 TGAAGCAAACACTGTCAGCTGGG + Intergenic
1118140488 14:63075348-63075370 GGAAAGAAAGAATGTCAGCTGGG + Intronic
1121562620 14:94886262-94886284 ACAGGTAAACAAGGTAAGCTCGG + Intergenic
1121593927 14:95144411-95144433 GCAAGTAAACAATGTTAGCGAGG - Intronic
1122747901 14:103910494-103910516 GGAGCTAGAGAATGTCACCTGGG - Intergenic
1124026003 15:25966462-25966484 GGAGCTACAGAATGTCAACTAGG - Intergenic
1129932693 15:79425597-79425619 GGAGGTAAAAATTGGCAGCCAGG + Intronic
1131360841 15:91789196-91789218 GGTGGTTAAAAATGTGAGCTGGG + Intergenic
1135432259 16:22395608-22395630 TGTGGTAAAAAATGACAGCTTGG + Intronic
1138512464 16:57516494-57516516 GGAGGGAATCAGTATCAGCTTGG + Intronic
1139544635 16:67644634-67644656 GGTGGGAAAAAATGTCAGATGGG - Intergenic
1140534295 16:75695290-75695312 AGAGGAAAAAAATGTCAGCCTGG - Intronic
1146678597 17:34791200-34791222 GGAAGTGGGCAATGTCAGCTTGG - Intergenic
1153126181 18:1793437-1793459 TGAGTTATACAATGTCAGATGGG - Intergenic
1155089424 18:22492064-22492086 AGAGATAAAAAATGTCAGCAAGG - Intergenic
1155571717 18:27202015-27202037 GGATTAAAACAATGTCAGCTGGG + Intergenic
1160454329 18:78988320-78988342 GTAAGTAAATAATGTCAGATTGG + Intronic
1160515617 18:79477910-79477932 GGGGTTAAACAATGTCATCAGGG - Intronic
925192405 2:1895150-1895172 GGAGGTGAACAATGTCCACAAGG + Intronic
925591099 2:5510877-5510899 GGAGTCAAACAATGCCATCTGGG - Intergenic
925725068 2:6864708-6864730 GAGGGAAAATAATGTCAGCTGGG - Intronic
929797999 2:45075011-45075033 GGAGGCAAACAACTTCAGCTGGG + Intergenic
934055855 2:88251025-88251047 GGAGGTAAACAATTGCAGTGAGG + Intergenic
937030094 2:118731786-118731808 GGAGATACACAATCTGAGCTGGG - Intergenic
941711894 2:168723306-168723328 GGAGGTAAACTATGACAGCCTGG - Intronic
942629367 2:177939236-177939258 GGAGATATATAATGTCTGCTTGG - Intronic
945142130 2:206698351-206698373 GGAGGTAAAATAGGTCTGCTTGG - Intronic
946215620 2:218181264-218181286 AGAAATAAACAATGACAGCTTGG + Intergenic
946825059 2:223669336-223669358 GGAGGTAAACAATGCCATCCTGG - Intergenic
948063492 2:235059376-235059398 TGAGGGAAACATTGTCAGTTTGG + Intergenic
948177743 2:235957462-235957484 AGAGGTACACAATGTCAGAGGGG - Intronic
1168998180 20:2147806-2147828 AGAGCTAAACAATGTCAGCTTGG - Exonic
1169864045 20:10181005-10181027 GGGGCTCAGCAATGTCAGCTGGG + Intergenic
1169920709 20:10731670-10731692 GGAGGAAAATAATGTCATCTAGG - Intergenic
1170868566 20:20183351-20183373 GGAGTTTCACCATGTCAGCTGGG + Intronic
1171392834 20:24812151-24812173 TGAGGTAGACAGTGTCAGGTGGG - Intergenic
1172269171 20:33643631-33643653 TGAGGGAAGCAATATCAGCTGGG + Intronic
1172902903 20:38347781-38347803 GGAGGCAGACATTGGCAGCTGGG + Intronic
1178076333 21:29016453-29016475 GGAGTTACACCATGTCAGTTGGG + Intronic
1181970521 22:26686402-26686424 CGAGGTCAACAAGGTAAGCTGGG + Intergenic
1183525629 22:38320859-38320881 GCAGGTAAAAAATGTCAGTTTGG - Intronic
1184400922 22:44274024-44274046 GGAGGTTCACTATGTCAGCCAGG - Intronic
949133066 3:529436-529458 GGAAGTAATCAAGGCCAGCTGGG - Intergenic
949238604 3:1841955-1841977 GGAGGGAAACAAAGACAGCAAGG - Intergenic
949738893 3:7207086-7207108 GAAGGAAAACAATGTTCGCTGGG + Intronic
950814756 3:15689183-15689205 AGAGCTGAAAAATGTCAGCTTGG - Intronic
952921521 3:38288059-38288081 GTAGGTACAGAATTTCAGCTTGG - Intronic
954101513 3:48376591-48376613 TGAGAGAAACACTGTCAGCTTGG + Intronic
956766824 3:72491244-72491266 AGAGGTCAAGAATGTCAGCCTGG - Intergenic
958673451 3:97234225-97234247 GGAGATAAACAAAACCAGCTAGG - Intronic
960262374 3:115582370-115582392 AGGGGTAAACAAGGACAGCTTGG - Intergenic
962041459 3:131711713-131711735 GGAGGAAAACAATAACTGCTTGG - Intronic
966818668 3:183908546-183908568 GGAGATAAACAATGGGGGCTGGG + Intergenic
967961308 3:194926850-194926872 GGAAGTAAACAATATCATCTAGG + Intergenic
969583500 4:8079007-8079029 GGAGGAAAAGAACGTGAGCTGGG - Intronic
970499993 4:16667334-16667356 CCAGGTAAACAATGTCACCCAGG - Intronic
972338146 4:38127140-38127162 GGAGGTAAACAATGTCAGCTGGG - Intronic
973760538 4:54110633-54110655 CCAGGTAACCAATGTGAGCTAGG - Intronic
973926041 4:55738532-55738554 GGAGGTAAACAATCTCTACAAGG + Intergenic
976610124 4:87022009-87022031 GGAGTTTCACCATGTCAGCTAGG - Intronic
976668517 4:87626354-87626376 TGAGCTAAACAATGTCAACCAGG + Intergenic
977562186 4:98543879-98543901 GGGCTTAAAAAATGTCAGCTAGG + Intronic
983508404 4:168580939-168580961 GGAGGAAAACAATGGAAACTGGG + Intronic
984349248 4:178569843-178569865 GGTGGGAAAGAATGTCTGCTGGG - Intergenic
985378981 4:189372474-189372496 GGAGGTAAATAATGACGGTTCGG - Intergenic
987236232 5:15944661-15944683 CCAGGGAAACAATGCCAGCTTGG - Intergenic
989606225 5:43246676-43246698 GGAGCCAAACAATGAGAGCTAGG - Intronic
990538237 5:56745781-56745803 GGAAGTGAACAATGTCACTTTGG - Intergenic
991065268 5:62417834-62417856 GGAGGAAAACAATGTCAGGAAGG - Intronic
996636851 5:125701261-125701283 AGATTTAAAAAATGTCAGCTAGG + Intergenic
997800828 5:136860016-136860038 GGGGATAAAAAATGTCATCTTGG - Intergenic
999506295 5:152200866-152200888 GAAGGTAAACAATTTCTTCTTGG - Intergenic
1002712433 5:181203649-181203671 GAAGGGAAACAATGTAAGGTGGG + Intronic
1005265912 6:24112215-24112237 GGATGTGAACAATTTCAGGTAGG - Intergenic
1005505080 6:26462589-26462611 GGAGGTAAACAGTGTGAATTAGG + Intronic
1008901413 6:56621633-56621655 GGACAGAATCAATGTCAGCTGGG + Intronic
1009916925 6:70007271-70007293 AAAGGTAAAGAATGTCAGATTGG + Intronic
1011051905 6:83160336-83160358 GGTGGTGAAGAATGACAGCTGGG + Intronic
1014066985 6:117138566-117138588 GGATGGAAAGAATATCAGCTAGG + Intergenic
1015283044 6:131454504-131454526 GGAGGTAAGCTGGGTCAGCTGGG - Intergenic
1018503530 6:164439664-164439686 AATGATAAACAATGTCAGCTAGG + Intergenic
1020760273 7:12260812-12260834 TGAGGAAAATGATGTCAGCTAGG - Intergenic
1022028955 7:26474456-26474478 GAAGGTAAACCAAGGCAGCTGGG - Intergenic
1022311915 7:29204948-29204970 TGAGTTAAACGATGTCATCTGGG + Intronic
1022455624 7:30555970-30555992 GGAGCTATACAATGTCAACAGGG - Intergenic
1028995046 7:97090905-97090927 GGAGGGAAGCAAGGACAGCTGGG + Intergenic
1030446600 7:109653126-109653148 GGAGAAAATCAAGGTCAGCTGGG - Intergenic
1031731401 7:125306396-125306418 AGAGGTGAACAATTTCAGCTTGG + Intergenic
1033201957 7:139380764-139380786 TGAGGAAAAAAATGACAGCTTGG - Intronic
1037089571 8:14897081-14897103 GGAGGTTAAGAAAGTCAGCCAGG - Intronic
1038517057 8:28196266-28196288 GGGGGCAAACAATGTCTGCCAGG - Intergenic
1038588330 8:28811714-28811736 AGAGATAAACCATGTCGGCTGGG - Intronic
1039408332 8:37331391-37331413 GGAGGGAAAGAAGGGCAGCTTGG + Intergenic
1040419171 8:47223020-47223042 GCAGGCAAACAATCCCAGCTTGG + Intergenic
1042436232 8:68768262-68768284 GGAAATATACAATGTAAGCTTGG - Intronic
1044116342 8:88340034-88340056 GGAGGTAAAGAATGTAAACAGGG + Intergenic
1050054539 9:1637941-1637963 GCAGGAAAACAAGGGCAGCTTGG - Intergenic
1052430871 9:28365291-28365313 GGAGGTTGAAAATGTCACCTGGG + Intronic
1053641919 9:40091417-40091439 GAAGATAAACATTGTCAGCTGGG + Intergenic
1053764218 9:41374042-41374064 GAAGATAAACATTGTCAGCTGGG - Intergenic
1054322813 9:63688811-63688833 GAAGATAAACATTGTCAGCTGGG + Intergenic
1054542830 9:66285225-66285247 GAAGATAAACATTGTCAGCTGGG - Intergenic
1055325145 9:75120892-75120914 GGAAGTATTTAATGTCAGCTTGG - Intronic
1055503481 9:76924957-76924979 GGAGGCAGAAGATGTCAGCTGGG + Intergenic
1057710233 9:97434376-97434398 GGACGTACACAATTTCAGTTAGG + Intronic
1058203737 9:102075328-102075350 TCAGGCAAACAATGTGAGCTAGG + Intergenic
1059126703 9:111695046-111695068 GGAGGAAAACAGTGTCAGACAGG - Intronic
1059358385 9:113719079-113719101 GGAAGGAAAGCATGTCAGCTTGG + Intergenic
1186404325 X:9288528-9288550 GGAGGTAAACAATTACTTCTTGG - Intergenic
1187049847 X:15685075-15685097 CAAGGTAAACAATGTAAACTCGG - Intergenic
1187813966 X:23211146-23211168 GGAGGTAAAGAAAGCCAGATTGG + Intergenic
1198157387 X:133974865-133974887 GGAGGTAGAAAATGTCTGCTAGG - Intronic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic