ID: 972339295

View in Genome Browser
Species Human (GRCh38)
Location 4:38137214-38137236
Sequence TGCTTACCTTAGAACTGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972339289_972339295 25 Left 972339289 4:38137166-38137188 CCACCATTGAGAAGCTCCTGAGC 0: 1
1: 0
2: 0
3: 17
4: 165
Right 972339295 4:38137214-38137236 TGCTTACCTTAGAACTGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 122
972339290_972339295 22 Left 972339290 4:38137169-38137191 CCATTGAGAAGCTCCTGAGCAGT 0: 1
1: 0
2: 0
3: 11
4: 156
Right 972339295 4:38137214-38137236 TGCTTACCTTAGAACTGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 122
972339291_972339295 9 Left 972339291 4:38137182-38137204 CCTGAGCAGTGAGAGCAAGCTGA 0: 1
1: 0
2: 0
3: 14
4: 158
Right 972339295 4:38137214-38137236 TGCTTACCTTAGAACTGGAGCGG 0: 1
1: 0
2: 0
3: 8
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972339295 Original CRISPR TGCTTACCTTAGAACTGGAG CGG Exonic
900805538 1:4765229-4765251 TGTTGACCTTGGAAGTGGAGAGG + Intronic
900833055 1:4978808-4978830 ATCTTATTTTAGAACTGGAGAGG - Intergenic
903012576 1:20342244-20342266 TGCGTCCCTGAGTACTGGAGGGG + Intronic
907127105 1:52060638-52060660 TACTTACCTCAGACCTGAAGTGG + Intronic
908233578 1:62129614-62129636 TGCTTACCATAGGTCTGCAGAGG + Intronic
910571651 1:88711856-88711878 TGTTTATATTAGAACTGTAGAGG - Intronic
911222299 1:95261829-95261851 TGATTACCTAAGAAGAGGAGGGG - Intergenic
916207177 1:162326321-162326343 TGCTGACTTTAGGACTGCAGAGG - Intronic
917075392 1:171199502-171199524 TGCTTACCATGTACCTGGAGGGG + Intronic
917388855 1:174510049-174510071 TGCTTTCTTAAGAACTGGACTGG + Intronic
917465977 1:175276432-175276454 TACTTACCTTAAAATTGGATTGG + Intergenic
919638561 1:200027439-200027461 TGATTAACTCAGAAGTGGAGAGG - Intergenic
920857738 1:209676468-209676490 TTCTTACCTGAGCACTGCAGAGG + Intergenic
923989194 1:239415712-239415734 TGTTTAAATAAGAACTGGAGAGG + Intronic
1063928559 10:11005530-11005552 TCCTTACCTTAGAAGAGAAGGGG + Intronic
1064791905 10:18966991-18967013 TGCTAACTTTAGGATTGGAGAGG + Intergenic
1065119634 10:22515934-22515956 TGCTTAGTTGAAAACTGGAGAGG + Intergenic
1070256697 10:74819126-74819148 TGGTTACCTTATAGCTGGAAAGG + Intergenic
1072831162 10:98660329-98660351 TTATTACTTTAGAACTGGAAGGG + Intronic
1074205678 10:111280907-111280929 TGCTTCCCTCAGATCTGGAAGGG - Intergenic
1074868557 10:117559534-117559556 TGCTCTACATAGAACTGGAGGGG - Intergenic
1080721718 11:34855690-34855712 TGCATAACTTAGTACTGGGGAGG - Intronic
1081565673 11:44259608-44259630 TGCTTAGCTTACCAATGGAGGGG - Intergenic
1086824646 11:91481512-91481534 TGCTTATCTTTAAAATGGAGGGG - Intergenic
1088851399 11:113706274-113706296 TGCTGGCCTGAGAACAGGAGCGG - Exonic
1091873670 12:3916182-3916204 TGCTTATATTAAAATTGGAGGGG - Intergenic
1092395742 12:8124213-8124235 GCCTTAGCTCAGAACTGGAGTGG - Intronic
1095921665 12:47538081-47538103 GGCTTACCTGAAAAGTGGAGAGG + Intergenic
1096840311 12:54375837-54375859 TTCTTACCTGAGAATTGAAGCGG + Exonic
1101988457 12:109465580-109465602 TGCTTACCTTTGGAAGGGAGAGG + Intronic
1104508062 12:129351170-129351192 TACTTACCTTATAACTGGACTGG + Intronic
1108172007 13:47751302-47751324 TGCTTACCCCAGAAATTGAGGGG + Intergenic
1110358843 13:74601597-74601619 TGCTTACTTTTGAACTTGAGTGG - Intergenic
1111381892 13:87466091-87466113 TGGTTACATTAGAGGTGGAGAGG + Intergenic
1112070249 13:95842204-95842226 TGCTTACCTGGGGACTGGATTGG - Intronic
1112210571 13:97373295-97373317 TGCTTACATTCTAACTGTAGAGG + Intronic
1113013197 13:105794154-105794176 TGCTTACCTGATAACAGGAGTGG + Intergenic
1113602766 13:111582504-111582526 CTCTTACCTTTGAATTGGAGAGG + Intergenic
1115402354 14:32976473-32976495 TTCGTACTTTAGAAATGGAGTGG + Intronic
1120313905 14:82866953-82866975 TCCTTACATTAGAAGTTGAGGGG + Intergenic
1121637536 14:95463774-95463796 TGCTTGCCTTCAAACTGCAGGGG + Intronic
1123833327 15:24164133-24164155 TACTTACCTTACAGCTGGATTGG - Intergenic
1123852999 15:24379727-24379749 TACTTACCTTACAGCTGGACTGG - Intergenic
1123868956 15:24552295-24552317 TACTTACCTTACAGCTGGACCGG - Intergenic
1125463092 15:39924620-39924642 TGACTACCTTCGAACTGGGGCGG + Intergenic
1128668825 15:69559031-69559053 AGCTTGCCTTAAAAGTGGAGCGG - Intergenic
1132471350 16:105306-105328 TCCTAACCTTAGAACTAGACAGG + Intronic
1134361082 16:13531748-13531770 TGCTTACCTGTGAAATGGTGGGG + Intergenic
1134483825 16:14641003-14641025 TGAACACCTTAGAACTGAAGAGG - Intronic
1136092191 16:27928465-27928487 TGTTTTCCTTAGAACTGGGCTGG - Intronic
1137017535 16:35392802-35392824 TGCTCTCCTTAGAACTGTTGTGG + Intergenic
1137450201 16:48566343-48566365 TGCTTACATTAGAAAAGAAGAGG - Intronic
1139352118 16:66343309-66343331 TGGTTCCCCTAAAACTGGAGCGG + Intergenic
1146912782 17:36658963-36658985 TGCTTTACCTAGAACGGGAGGGG - Intergenic
1147510905 17:41068184-41068206 TACTTACCCTATAACTGGACTGG - Intergenic
1148509558 17:48157184-48157206 TGCTTCCCTGAGAACAGGACAGG + Intronic
1148839723 17:50487381-50487403 TGCTTACCTGAGAGGTGGGGAGG - Intergenic
1149087883 17:52741395-52741417 TGCTTTCCTTTCAAGTGGAGGGG + Intergenic
1149421217 17:56512135-56512157 TGCTTAACTTAGAATTGTAAAGG - Intergenic
1150199589 17:63340944-63340966 TGCTAACACTAGAACTGCAGAGG - Intronic
1150531793 17:65991126-65991148 GGATTACCCTAGAACTTGAGTGG + Intronic
1153755391 18:8277417-8277439 TGCTTGAGTTAGCACTGGAGAGG + Intronic
1156684574 18:39629158-39629180 CTCTTACCCTAGAAATGGAGCGG - Intergenic
1156729244 18:40170427-40170449 TCCTTACCTCAGATGTGGAGTGG - Intergenic
1158873873 18:61714179-61714201 TACTTACCTTATAACTGAACTGG + Intergenic
1158985369 18:62810076-62810098 TGTTTAACTTAGAGCTGAAGTGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
931987354 2:67754876-67754898 GGCTTACCTGGGATCTGGAGTGG - Intergenic
933515506 2:83295500-83295522 TAATTACCTTACAACTGTAGAGG + Intergenic
935006247 2:99080534-99080556 TGCTTACCTTAGATCTTTATTGG + Intronic
935122529 2:100195588-100195610 TGCATCCATCAGAACTGGAGTGG + Intergenic
938976706 2:136485520-136485542 AGCTTACCTTAGAACTGCAATGG - Intergenic
940849906 2:158678384-158678406 TGCTTACCTCAGGGCTGGTGGGG - Intronic
944080800 2:195786460-195786482 TGAGTACATCAGAACTGGAGAGG + Intronic
944311431 2:198237899-198237921 TGCTTACCTCAAAACTCCAGGGG + Intronic
947304153 2:228724858-228724880 TGCTTACCTTAAAAGTAGAATGG - Intergenic
1170286669 20:14717638-14717660 TGGTCACGTTAAAACTGGAGAGG - Intronic
1172590914 20:36117234-36117256 TGCCTGCCTGAGAGCTGGAGGGG + Intronic
1178755400 21:35344813-35344835 TGCTTGTTTTAGAAATGGAGGGG - Intronic
1179214867 21:39358742-39358764 TACTTACCTTCTAACTGGACCGG + Intergenic
1183867542 22:40715771-40715793 TGCTTACCTTTGCAGTTGAGGGG + Intergenic
1185288426 22:50012538-50012560 AGCTTACCTGAGAACAGGAGAGG + Exonic
951748578 3:26007785-26007807 TTCTTCCCTTGGAACTGGAAGGG - Intergenic
954395998 3:50293625-50293647 TGATCACCTCAGAGCTGGAGAGG + Exonic
956220008 3:66892901-66892923 GGCTTACCTGAGAAGTGCAGGGG + Intergenic
957800468 3:85072825-85072847 TGATTACCTTAAAAATGCAGAGG + Intronic
961489766 3:127246743-127246765 TACTTATCTTATAACTGGACTGG - Intergenic
962198695 3:133384084-133384106 TGCTTTCCTGATAACTAGAGTGG - Intronic
965931173 3:174044460-174044482 TGCTGAACTTTGAACTGGAGAGG - Intronic
966660335 3:182407779-182407801 TGTTTGCCTTAGAAGTGGAGTGG + Intergenic
968851198 4:3079808-3079830 TGCTTATCTGAGCACTGCAGTGG - Intronic
971757195 4:30720163-30720185 TGCTCACCTTTGAACTGCAAAGG + Intergenic
972339295 4:38137214-38137236 TGCTTACCTTAGAACTGGAGCGG + Exonic
987380838 5:17284479-17284501 TGTTTACTCAAGAACTGGAGAGG + Intergenic
988379159 5:30478526-30478548 TGCTAACATTATAACTTGAGGGG + Intergenic
988534494 5:32054205-32054227 TTCTTACCTTAGGGCTGGTGTGG + Intronic
988849389 5:35163512-35163534 GGCTTACATTAGAACATGAGTGG + Intronic
993132488 5:83916454-83916476 TTCTTAGCATAGAACTTGAGTGG - Intergenic
994635319 5:102339149-102339171 TACTCACCTTATAACTGGACTGG - Intergenic
997293133 5:132752123-132752145 TCATCACCTTAGAGCTGGAGAGG + Exonic
999097931 5:148997514-148997536 TGGTTACTTTAGAACAGGATTGG - Intronic
1001716887 5:173823825-173823847 TGCTATCCTAAGAAGTGGAGAGG + Intergenic
1005854666 6:29851807-29851829 TCCTTCCCTGAGAACTGGCGGGG + Intergenic
1015092935 6:129380450-129380472 AGCTTACCTTACAGTTGGAGAGG + Intronic
1015376241 6:132513203-132513225 TCCTTAGCTTGGAACCGGAGGGG - Intergenic
1020000987 7:4755451-4755473 TGCTTCCCTTAAAACAGAAGAGG + Intronic
1020546848 7:9543059-9543081 TGCTTGCATTAGGATTGGAGAGG + Intergenic
1024976176 7:55115938-55115960 TGCTTCCCATGTAACTGGAGAGG + Intronic
1028148987 7:87350614-87350636 TACCTACCTTACAACTGGACTGG - Intronic
1028773103 7:94649755-94649777 TTCTGACCTAACAACTGGAGTGG + Intronic
1029941014 7:104480842-104480864 TGCTGACCTTTAAACTAGAGTGG + Intronic
1030505052 7:110410941-110410963 TGCTTACCTAAGAGCTGTAATGG - Intergenic
1031663843 7:124460697-124460719 TGTTTACCTTAGGATTGGGGAGG - Intergenic
1034357974 7:150468358-150468380 TGCTTACACTTTAACTGGAGTGG + Intronic
1035041228 7:155929004-155929026 TGCTTGCCTTGGACCTGGAGAGG + Intergenic
1039115913 8:34091040-34091062 TACTTACCTTATAACTGTACTGG + Intergenic
1044383006 8:91555775-91555797 TGCTTTGCTAAGCACTGGAGTGG + Intergenic
1048576228 8:135692117-135692139 AATTTACTTTAGAACTGGAGTGG + Intergenic
1049378398 8:142300373-142300395 TGCTTGCCCTTGACCTGGAGGGG - Intronic
1055018835 9:71647525-71647547 AGCTTGTCTGAGAACTGGAGTGG + Intergenic
1057435888 9:95040339-95040361 TGGTTTCTTGAGAACTGGAGCGG + Intronic
1058510199 9:105710062-105710084 TGCTTACTTTCAAACTTGAGGGG + Intronic
1060121858 9:120999023-120999045 TGATTTCCTTAGAACAGCAGGGG + Intronic
1060420702 9:123467679-123467701 TTTTTACCTTTGAACTGGTGTGG - Intronic
1188519304 X:31020266-31020288 TACTCACCTTTGAAATGGAGAGG - Intergenic
1191647776 X:63501928-63501950 TGGTTACCTGAGACTTGGAGTGG + Intergenic
1194196052 X:90894036-90894058 AGCTTTCCTAAGAACTTGAGGGG + Intergenic
1199642642 X:149878860-149878882 TGCCTGCCTTAGAACGGTAGAGG - Intergenic
1199731161 X:150633521-150633543 TGCTTTCATTAAAATTGGAGGGG - Intronic
1200541896 Y:4468217-4468239 AGCTTTCCTAAGAACTTGAGGGG + Intergenic
1202063939 Y:20917662-20917684 TACTTACATTATAACTGGACAGG + Intergenic