ID: 972340090

View in Genome Browser
Species Human (GRCh38)
Location 4:38144981-38145003
Sequence TCAGAAACATAAAATTACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972340090_972340092 3 Left 972340090 4:38144981-38145003 CCAATGTAATTTTATGTTTCTGA No data
Right 972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG No data
972340090_972340095 14 Left 972340090 4:38144981-38145003 CCAATGTAATTTTATGTTTCTGA No data
Right 972340095 4:38145018-38145040 AATGGAAGATGGGAAGCTGTAGG No data
972340090_972340093 4 Left 972340090 4:38144981-38145003 CCAATGTAATTTTATGTTTCTGA No data
Right 972340093 4:38145008-38145030 ACAGTGACCAAATGGAAGATGGG No data
972340090_972340091 -4 Left 972340090 4:38144981-38145003 CCAATGTAATTTTATGTTTCTGA No data
Right 972340091 4:38145000-38145022 CTGAAAGCACAGTGACCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972340090 Original CRISPR TCAGAAACATAAAATTACAT TGG (reversed) Intergenic
No off target data available for this crispr