ID: 972340092

View in Genome Browser
Species Human (GRCh38)
Location 4:38145007-38145029
Sequence CACAGTGACCAAATGGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972340088_972340092 26 Left 972340088 4:38144958-38144980 CCTTAAGATCATGTCATGCTAGC No data
Right 972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG No data
972340089_972340092 4 Left 972340089 4:38144980-38145002 CCCAATGTAATTTTATGTTTCTG No data
Right 972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG No data
972340090_972340092 3 Left 972340090 4:38144981-38145003 CCAATGTAATTTTATGTTTCTGA No data
Right 972340092 4:38145007-38145029 CACAGTGACCAAATGGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972340092 Original CRISPR CACAGTGACCAAATGGAAGA TGG Intergenic
No off target data available for this crispr