ID: 972342646

View in Genome Browser
Species Human (GRCh38)
Location 4:38165850-38165872
Sequence CAGTGTGCCCAAAGAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972342646_972342650 -1 Left 972342646 4:38165850-38165872 CCAGCATCTCTTTGGGCACACTG No data
Right 972342650 4:38165872-38165894 GGGCACACTGGAGAGAGCCCTGG No data
972342646_972342652 5 Left 972342646 4:38165850-38165872 CCAGCATCTCTTTGGGCACACTG No data
Right 972342652 4:38165878-38165900 ACTGGAGAGAGCCCTGGACTGGG No data
972342646_972342651 4 Left 972342646 4:38165850-38165872 CCAGCATCTCTTTGGGCACACTG No data
Right 972342651 4:38165877-38165899 CACTGGAGAGAGCCCTGGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972342646 Original CRISPR CAGTGTGCCCAAAGAGATGC TGG (reversed) Intergenic
No off target data available for this crispr