ID: 972342896

View in Genome Browser
Species Human (GRCh38)
Location 4:38167851-38167873
Sequence TCAGAGCCCTGGTGTCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972342891_972342896 10 Left 972342891 4:38167818-38167840 CCTCAAATTAAAAACAGTCTCCT No data
Right 972342896 4:38167851-38167873 TCAGAGCCCTGGTGTCAGGATGG No data
972342889_972342896 30 Left 972342889 4:38167798-38167820 CCCACTAGATAATATCTCTACCT No data
Right 972342896 4:38167851-38167873 TCAGAGCCCTGGTGTCAGGATGG No data
972342890_972342896 29 Left 972342890 4:38167799-38167821 CCACTAGATAATATCTCTACCTC No data
Right 972342896 4:38167851-38167873 TCAGAGCCCTGGTGTCAGGATGG No data
972342892_972342896 -10 Left 972342892 4:38167838-38167860 CCTTCCTACTTGTTCAGAGCCCT No data
Right 972342896 4:38167851-38167873 TCAGAGCCCTGGTGTCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972342896 Original CRISPR TCAGAGCCCTGGTGTCAGGA TGG Intergenic