ID: 972344420

View in Genome Browser
Species Human (GRCh38)
Location 4:38180929-38180951
Sequence ATGGGTTTGCTTACTTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972344420_972344423 2 Left 972344420 4:38180929-38180951 CCTGGAGAAGTAAGCAAACCCAT No data
Right 972344423 4:38180954-38180976 TACAGACAAACTAAGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972344420 Original CRISPR ATGGGTTTGCTTACTTCTCC AGG (reversed) Intergenic
No off target data available for this crispr