ID: 972344423

View in Genome Browser
Species Human (GRCh38)
Location 4:38180954-38180976
Sequence TACAGACAAACTAAGATTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972344420_972344423 2 Left 972344420 4:38180929-38180951 CCTGGAGAAGTAAGCAAACCCAT No data
Right 972344423 4:38180954-38180976 TACAGACAAACTAAGATTTAAGG No data
972344417_972344423 21 Left 972344417 4:38180910-38180932 CCTTCATGTCTCAAAACCACCTG No data
Right 972344423 4:38180954-38180976 TACAGACAAACTAAGATTTAAGG No data
972344419_972344423 5 Left 972344419 4:38180926-38180948 CCACCTGGAGAAGTAAGCAAACC No data
Right 972344423 4:38180954-38180976 TACAGACAAACTAAGATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972344423 Original CRISPR TACAGACAAACTAAGATTTA AGG Intergenic
No off target data available for this crispr