ID: 972346446

View in Genome Browser
Species Human (GRCh38)
Location 4:38196497-38196519
Sequence TCCTGCTCGATTTTTTCCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972346446_972346463 28 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346463 4:38196548-38196570 GGCAGGTTGTGGTATTAAGTAGG No data
972346446_972346456 1 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346456 4:38196521-38196543 AAGGGGGAGTTGGAGGGCCGGGG No data
972346446_972346461 17 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346461 4:38196537-38196559 GCCGGGGCTGGGGCAGGTTGTGG No data
972346446_972346451 -9 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346451 4:38196511-38196533 CGAGCAGGAGAAGGGGGAGTTGG No data
972346446_972346457 5 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346457 4:38196525-38196547 GGGAGTTGGAGGGCCGGGGCTGG No data
972346446_972346458 6 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346458 4:38196526-38196548 GGAGTTGGAGGGCCGGGGCTGGG No data
972346446_972346455 0 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346455 4:38196520-38196542 GAAGGGGGAGTTGGAGGGCCGGG No data
972346446_972346454 -1 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346454 4:38196519-38196541 AGAAGGGGGAGTTGGAGGGCCGG No data
972346446_972346453 -5 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG No data
972346446_972346459 7 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346459 4:38196527-38196549 GAGTTGGAGGGCCGGGGCTGGGG No data
972346446_972346452 -6 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346452 4:38196514-38196536 GCAGGAGAAGGGGGAGTTGGAGG No data
972346446_972346460 11 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346460 4:38196531-38196553 TGGAGGGCCGGGGCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972346446 Original CRISPR TCCTGCTCGATTTTTTCCTA TGG (reversed) Intergenic
No off target data available for this crispr