ID: 972346453

View in Genome Browser
Species Human (GRCh38)
Location 4:38196515-38196537
Sequence CAGGAGAAGGGGGAGTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972346446_972346453 -5 Left 972346446 4:38196497-38196519 CCATAGGAAAAAATCGAGCAGGA No data
Right 972346453 4:38196515-38196537 CAGGAGAAGGGGGAGTTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972346453 Original CRISPR CAGGAGAAGGGGGAGTTGGA GGG Intergenic
No off target data available for this crispr