ID: 972350955

View in Genome Browser
Species Human (GRCh38)
Location 4:38235880-38235902
Sequence CATACTGAGTAGACGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972350949_972350955 2 Left 972350949 4:38235855-38235877 CCCAGTAAAGAACAGATGCCACT No data
Right 972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG No data
972350950_972350955 1 Left 972350950 4:38235856-38235878 CCAGTAAAGAACAGATGCCACTC No data
Right 972350955 4:38235880-38235902 CATACTGAGTAGACGGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972350955 Original CRISPR CATACTGAGTAGACGGAGGA GGG Intergenic
No off target data available for this crispr