ID: 972351012

View in Genome Browser
Species Human (GRCh38)
Location 4:38236251-38236273
Sequence GCCTGATGTCCAAGAGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972351009_972351012 -9 Left 972351009 4:38236237-38236259 CCAGAGAACCTGAAGCCTGATGT No data
Right 972351012 4:38236251-38236273 GCCTGATGTCCAAGAGCAGGAGG No data
972351006_972351012 6 Left 972351006 4:38236222-38236244 CCCAGATTCCAAAGGCCAGAGAA No data
Right 972351012 4:38236251-38236273 GCCTGATGTCCAAGAGCAGGAGG No data
972351008_972351012 -2 Left 972351008 4:38236230-38236252 CCAAAGGCCAGAGAACCTGAAGC No data
Right 972351012 4:38236251-38236273 GCCTGATGTCCAAGAGCAGGAGG No data
972351007_972351012 5 Left 972351007 4:38236223-38236245 CCAGATTCCAAAGGCCAGAGAAC No data
Right 972351012 4:38236251-38236273 GCCTGATGTCCAAGAGCAGGAGG No data
972351004_972351012 28 Left 972351004 4:38236200-38236222 CCGTGAAGCAGCTGCTGCAACTC No data
Right 972351012 4:38236251-38236273 GCCTGATGTCCAAGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972351012 Original CRISPR GCCTGATGTCCAAGAGCAGG AGG Intergenic
No off target data available for this crispr