ID: 972351279

View in Genome Browser
Species Human (GRCh38)
Location 4:38238304-38238326
Sequence CTGTAGAAATGTAGGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972351279_972351284 -2 Left 972351279 4:38238304-38238326 CCAAATTCCCTACATTTCTACAG No data
Right 972351284 4:38238325-38238347 AGTGGAGGTGTATTACTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972351279 Original CRISPR CTGTAGAAATGTAGGGAATT TGG (reversed) Intergenic
No off target data available for this crispr