ID: 972351998

View in Genome Browser
Species Human (GRCh38)
Location 4:38244559-38244581
Sequence CAAGGGAAGGAGGAGGGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
972351998_972352008 -5 Left 972351998 4:38244559-38244581 CCGGCCCCCTCCTCCTTCCCTTG No data
Right 972352008 4:38244577-38244599 CCTTGCTTCCACTTTCAGTTGGG No data
972351998_972352006 -6 Left 972351998 4:38244559-38244581 CCGGCCCCCTCCTCCTTCCCTTG No data
Right 972352006 4:38244576-38244598 CCCTTGCTTCCACTTTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
972351998 Original CRISPR CAAGGGAAGGAGGAGGGGGC CGG (reversed) Intergenic
No off target data available for this crispr